Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Guidade protokoll för fekal mikrobiell karakterisering av 16S rRNA-amplikon sekvensering

doi: 10.3791/56845 Published: March 19, 2018

Summary

Detta manuskript beskriver en detaljerad standardiserade protokollet av hög genomströmning 16S rRNA-amplikon sekvensering. Protokollet införs ett integrerat, uniformerad, genomförbart och billig protokoll från fekal provtagning genom dataanalyser. Detta protokoll möjliggör analys av stora mängder prover med stränga normer och flera kontroller.

Abstract

Den mänskliga tarmen mikrobiomet spelar en central roll i att skydda celler från skada, i bearbetning av energi och näringsämnen och att främja immunitet. Avvikelser från vad som anses vara en hälsosam bakterieflora sammansättning (dysbios) kan försämra vitala funktioner leder till patologiska förhållanden. Senaste och pågående forskningsinsatser har varit riktad mot karakterisering av associationer mellan mikrobiell komposition och människors hälsa och sjukdom.

Framsteg i hög genomströmning sekvensering teknik gör det möjligt för karakterisering av gut mikrobiella sammansättningen. Dessa metoder inkluderar 16S rRNA-amplikon sekvensering och shotgun sekvensering. 16s rRNA-amplikon sekvensering används för att profilera mångfaldskonventionen sammansättning, medan shotgun sekvensering ger ytterligare information om genen förutsägelser och funktionella anteckning. En fördel med en riktad sekvensering metod för regionen 16S rRNA-genen på variabel är dess betydligt lägre kostnad jämfört med shotgun sekvensering. Sekvens skillnader i 16S rRNA-genen används som en mikrobiell fingeravtryck att identifiera och kvantifiera olika taxa inom ett enskilt prov.

Stora internationella insatser har värvat standarder för 16S rRNA-amplikon sekvensering. Flera studier rapporterar dock en vanlig källa till variation som orsakas av batch effekt. För att minimera denna effekt, uniformerade protokoll för provtagning, måste bearbetning och sekvensering genomföras. Detta protokoll föreslår en integrering av i stort sett använda protokollen från fekal provtagning till dataanalyser. Detta protokoll innehåller en kolumn-fri, direkt-PCR-metod som möjliggör samtidig hantering och DNA-extraktion av stora mängder fecal prov, tillsammans med PCR-amplifiering av regionen V4. Dessutom protokollet beskriver rörledningen analys och ger ett manus som använder den senaste versionen av QIIME (QIIME 2 version 2017.7.0 och DADA2). Denna stegvisa protokollet syftar till att vägleda dem intresserade av att inleda användning av 16S rRNA-amplikon sekvensering i ett robust, reproduktiva, lätt att använda, detaljerade sätt.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Koncentrerad ansträngningar har gjorts för att bättre förstå mikrobiomet mångfald och överflöd, som en annan aspekt av att fånga skillnad och likheter mellan individer i friska och patologiska förhållanden. Ålder2,3, geografi4, livsstil5,6och sjukdom5 visade sig vara associerade med sammansättningen av de gut microbiom, men många villkor och populationer har ännu inte fullt kännetecknas. Det har nyligen rapporterats att mikrobiomet kan ändras för terapeutiska tillämpningar7,8,9. Ytterligare insikt i förhållandet mellan olika fysiologiska förhållanden och mikrobiella sammansättningen därför det första steget mot optimering av potentiella framtida ändringar.

De traditionella mikrobiella kultur metoderna begränsas av låg avkastning10,11, och är conceptualized som ett binärt tillstånd där en bakterie är antingen presentera i tarmen eller inte. Hög genomströmning DNA-baserade sekvensering har revolutionerat mikrobiell ekologi, aktivera tillfångatagandet av alla medlemmar i mikrobiell gemenskapen. Men läsa sekvens längd och kvalitet är fortfarande betydande hinder för korrekta taxonomin tilldelning12. Dessutom kan hög genomströmning baserat experiment lida av batch effekter, där mätningar påverkas av icke-biologiskt eller icke-vetenskapliga variabler13. Under de senaste åren har flera program fastställts för att studera den mänskliga microbiom, inklusive amerikanska Gut projektet, Förenta staterna (USA) Human mikrobiomet Project och Förenade kungariket (Storbritannien) MetaHIT projektet. Dessa initiativ har genererat enorma mängder data som inte är enkelt jämförbara på grund av bristande konsekvens i sina metoder. En mängd internationella projekt såsom internationella mänskliga mikrobiomet konsortiet, det internationella mänskliga mikrobiomet Standards projektet, och National Institute of Standards och Technology (NIST) försökte ta dessa frågor14 , och utvecklat standarder för mikrobiomet mätningar som bör göra det möjligt att uppnå tillförlitlig reproduktiv resultat. Beskrivs här är en integrerad protokoll flera metoder i huvudsak använts15,16 för 16S rRNA hög genomströmning sekvensering (16S-seq) start från fekal provtagning thru dataanalyser. Protokollet beskrivs en kolumn-fri PCR-metoden, ursprungligen avsedd för direkt utvinning av växt DNA16, aktivera samtidig hantering av stora mängder fecal prov i en relativt kort tid med hög kvalitet förstärkt DNA för riktad sekvensering av regionen för mikrobiell V4 för variabel på en gemensam plattform för sekvensering. Detta protokoll syftar till att vägleda forskare intresserade av att inleda användning av 16S rRNA-amplikon sekvensering i ett robust, reproduktiva, lätt att använda, detaljerade sätt, med hjälp av viktiga kontroller. Att ha en guidad och detaljerade steg-för-steg-protokollet kan minimera batch effekt och därmed kommer att tillåta mer jämförbara sekvensering resultat mellan labs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Etiskt godkännande för studien beviljades av den Sheba lokal forskningsetisk kommitté och alla metoder utfördes i enlighet med de relevanta riktlinjer och förordningar. Protokollet fick ett undantag för patientens samtycke från den lokala etikprövningsnämnden, sedan den fekalt material som användes redan lämnats till mikrobiologi kärnan som del av kliniska workup och utan identifierbar patientinformation än ålder, kön och mikrobiell resultat. Skrivet, informerat samtycke erhölls från friska frivilliga och institutionella granskning styrelsen godkände studien. Några av dessa prover har redan inkluderats i en tidigare analys1.

1. provhantering

  1. Samla en ca 5 mm2 smear (ungefär storleken av ett suddgummi) från en färsk fecal prov med en steril kompress i ett test tube (se Tabell för material). Lagra alla kompresser som innehåller fecal prov vid-80 ° C inom 24 h. De fekal kompresser kan förbli det tills vidare bearbetning.

2. DNA-extraktion

  1. Tina de utvinning och utspädning lösningarna vid rumstemperatur (se Tabell för material).
  2. Överföring fekal pinnen till en tom 2 mL samling röret (se Tabell för material). Justera pinnen pinne storlek genom att skära den med en ren sax för att aktivera tube stängning med minsta korskontaminering. Tillsätt 250 μL av extraktionslösningen i varje samling rör som innehåller fekal kompress och vortex att blanda.
  3. Värma proverna för 10 min i kokande vattenbad (95 – 100° C). Tillsätt 250 μL av utspädning lösning till varje prov och vortex att blanda.
  4. Lagra de 2 mL rör som innehåller extraherade DNA och pinnen vid 4 ° C.

3. PCR och bibliotek förberedelse

Steg 3.1 och 3.2, arbeta i en PCR-arbetsstation som erbjuder rena, mall och amplikon miljö.

  1. Etikett primers (tabell 1) enligt deras streckkod. Späd varje primer i dubbel destillerat vatten (DDW) till en 50 μM koncentration och förvaras vid-20 ° C.
  2. Använda en plattan med 96 brunnar för PCR-reaktioner. Varje platta kan innehålla 32 olika prover, som är märkta av 32 olika index primrar. Tina den framåt primern och 32 omvänd primers i rumstemperatur och späda ut dem till 5 μM.
  3. Förbered PCR reaktionsmixar för 100 reaktioner (slutlig volym i varje brunn blir 20 μl) genom att blanda 100 μL av 5 μM Forward primer, 1 mL 2 X PCR Master mix och 400 μL DDW. Lägg 15 μL av denna PCR-mix i varje brunn (totalt 96 brunnarna). Tillsätt 1 μL av varje 5 μM omvänd indexerade primer till 3 olika brunnar (32 olika grundfärger i exemplar ger sammanlagt 96 brunnarna).
  4. I en pre-PCR dedikerad zon, vilket innebär en ren bänk som är mall och amplikon gratis, tillsätt 4 μL av varje extraherad DNA-prov till reaktion blandningar (varje extraherad DNA-prov förstärks i tre exemplar — 32 prover per plattan med 96 brunnar).
  5. Köra PCR med följande inställningar: inledande denaturering 94 ° c i 3 min. följt av 35 cykler av denaturering vid 94 ° C i 1 min, glödgning vid 55 ° C i 1 min och förlängning vid 72 ° C i 1 min. och en sista förlängning vid 72 ° C i 10 min.
  6. På en annan bänk, vilka kommer att definieras som en post-PCR dedikerad zon, kombinera varje tre exemplar PCR-reaktion i en enda volym röret (60 μl per prov).
  7. För att bedöma kvaliteten på PCR-amplikoner, kör 4 μL av varje kombination-PCR-reaktion på en etidiumbromid bromid-färgade 1% agarosgel. Under UV våglängd av 260 nm, den positiva amplikoner visas i en förväntad bandstorlek på 375 – 425 bp. Endast dessa amplikoner kommer att ingå i de efterföljande stegen.
    Obs: Varje prov förstärks i tre exemplar, menande att varje prov förstärks i 3 olika PCR-reaktioner. Inte skala upp.

4. biblioteket kvantifiering och rengöring

  1. För att få en equimolar koncentration pool av samtliga PCR-prov, kvantifiera varje Restriktionsenzymanalys av en dubbel stranded DNA (dsDNA kvantifiera reagens) fluorescerande nukleinsyra fläcken (se Tabell för material), lämplig för samtidig kvantifiering av en stor antalet prover.
    Obs: Eftersom den storlek Restriktionsenzymanalys av kopian är tvetydiga, används det faktiska beloppet i nanogram att ladda en equimolar koncentration.
  2. Kombinera 500 ng av varje prov till ett enda, sterilt provrör. Vortex att blanda.
  3. Kör 200 μL av poolade biblioteket på en etidiumbromid-färgade 1% agarosgel. Extrahera de 375 – 425 bp band från gelen med en gel utvinning kit enligt tillverkarens anvisningar (se Tabell av material) och eluera sammanslagna biblioteket i 80 μl DDW.
    Obs: Poolade biblioteket bör vara storlek valt att minska icke-specifik amplifiering produkter från värd DNA.
  4. Mäta den slutliga bibliotek koncentration med hjälp av en mycket känslig dsDNA upptäcka kit enligt tillverkarens anvisningar (se Tabell för material). Mäta korrekt bibliotek storlek med en mycket känslig separation och analys-kit för DNA bibliotek enligt tillverkarens anvisningar (se Tabell för material).

5. sekvensering

  1. Späd det sammanslagna biblioteket till 7 pM med tillägg av 20% kontrollbibliotek (se Tabell för material), enligt protokollet sekvensering maskin.
  2. För sekvensering Läs använda specialdesignade primers som är avgiftsfritt till V4 förstärkning primers (se tabell 1).
  3. Använd en tredje anpassade utformade sekvensering primer som läser streckkoden i ytterligare en cykel (se tabell 1) och genererar Parade-end läsningar av 175 baser i längd i varje riktning, enligt tillverkarens specifikationer.
  4. Kör maskinen sekvensering och få FASTQ filer enligt tillverkarens protokollet.

6. databearbetning

  1. Sy ihop och bearbeta överlappande Parade-end FASTQ filerna i en data curation pipeline genomförs i QIIME 2 version 2017.7.017. Multiplex läser enligt prov särskilda streckkoder.
  2. Använd DADA218 för kvalitetskontroll och sekvens variant (SVs) upptäckt. Trunkera läsningar på 13 baser från den 3'-änden och 15 baser från 5' slutet, kassera läser med mer än 2 förväntade fel. Identifiera och ta bort de chimärer använda metoden konsensus — chimärer upptäcks i prover individuellt och sekvenser hittade chimär i en tillräcklig bråkdel av prover tas bort.
  3. Utföra SVs taxonomiska klassificering med hjälp av en Naive Bayes utrustade klassificerare, utbildade det augusti 2013 99% identitet Greengenes databas6, för 175 lång läsningar och framåt/bakåt primern inställd.
  4. Rarefy alla prover till djup av 2 146 sekvenser.
  5. Använda ovägda UniFrac för mätning av β-mångfald (mellan prov mångfald19,20) på förtunnade prover, för att undvika en prov storlek effekt.
  6. Du kan använda matrisen resulterande avståndet för att utföra en huvudsakliga koordinater analys (PCoA).
    Obs: Databehandling script och mappning filerna tillhandahålls som kompletterande material (kompletterande Material 1 och 2).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En Schematisk illustration av protokollet visas i figur 1.

Vi samlat prospektivt avföringsprover från inlagda patienter med misstänkt smittsam diarré. Dessa prover har lämnats in till klinisk mikrobiologi Lab vid Sheba Medical Center mellan februari och maj 2015, som var tidigare beskrivna1. Avföringsprover utsattes till konventionella mikrobiologiska kultur utförs på klinisk mikrobiologi Lab och behaglig hög genomströmning 16S-seq parallellt. Dessutom var avföringsprover från friska vuxna sekvenserade för jämförelse.

I denna analys var fokus på kvalitetskontroll av data och Visa representativa resultat av produktionen erhålls från QIIME217. Inledningsvis, sekvensering resultat som uppnåtts i 6 negativa kontrollprover granskades för kvalitetskontroll inklusive: (i) PCR utan mall, ii) PCR på rena och sterila kompresser i utvinning och utspädning lösning och iii) PCR på blandade utvinning och utspädning lösningar. Tabell 2 visar att alla negativa kontrollprover hade ≤118 Totalt läser (medeltal 29 sekvenser), främst från de Mycoplasma taxa, medan alla andra prover analyseras visade medelvärdet total läser av 10622.57 (±1211.34 standard fel) och ingen Mycoplasma Läs passerat kvalitetskontrollen av de huvudsakliga proverna.

Sexton prover att alla härstammar från samma pall prov men gick igenom olika bibliotek förberedelser med olika omvänd barcoded primers användes som positiva kontroller. Dessa 16 prover ingår 8 med positiva kulturer för Campylobacter, Salmonellaeller Shigella som rapporterades av klinisk mikrobiologi lab och 8 som rapporterades ha negativa kulturer. Ett område tomt på phyla nivå visas i figur 2. Prover som härstammar från samma pall prov men gick igenom olika bibliotek förberedelser med olika omvänd barcoded primers Visa mycket konsekvent relativa överflöd (Mantel test mellan dubbletter av fylum nivå taxonomiska relativa överflöd värden simuleras p-värde = 1 x 10-04 baserat på 9999 replikat).

Huvudsakliga koordinater analys (PCoA), vilket minskar dimensionalitet av dataunderlaget, användes på UniFrac matrix att visuellt utforska prov separation och likhet. I figur 3A, är sekvenserade prover som härstammar från samma ursprungliga avföringsprov men gick igenom olika bibliotek förberedelse färgade samma. De är verkligen ligger relativt nära i PCoA tomten (Mantel test mellan dubbletter PC1 PC2 värden simulerade p-värde = 1e-04 baserat på 9999 replikat). Genomsnittliga ovägda unifrac beta mångfald avståndet mellan prover i denna studie är dessutom 0.706, medan den genomsnittliga avståndet mellan två dubbletter är 0,235 (Wilcoxon rank sum test p-värde = 4.205 x 10-11). Intressant, prover som var positiva för Campylobacter, Salmonellaeller Shigella tarmpatogener kultur visade signifikant olika PC1 värden (Wilcoxon rank sum test p-värde = 0,011) i jämförelse med prover med negativa kultur resultat. Figur 3B visar samma PCoA tomt men nu prover är färgade av de relativa överflödet av Proteobacteria. Prover med hög Proteobacteria överflöd hade signifikant PC1 värden (Spearman korrelation r =-0.533, p-värde = 0.000975). Dessa resultat överensstämmer med tidigare analys av dessa data, där intagna patienter har djupgående ökar i taxa från Proteobacteria stam1. Här visade vi att PC1 är korrelerad med Proteobacteria överflöd, med kultur positiva prover klustring mestadels på ena sidan av PC1 axis och kultur negativa proverna klustring mestadels på andra sidan, tillsammans med de friska proverna.

Figure 1
Figur 1 : Flödesschema från fecal prov till relativa mikrobiell överflöd. 1) provhantering: vänster, fekal prover samlas i en steril kompress tub. Höger, justeras pinnen pinne storleken genom att klippa den för att aktivera stängningen av 2ml tub, och lagring. 2) DNA-extraktion: DNA extraheras genom direkt PCR kolumner-gratis strategi. 3) bibliotek förberedelse: vänster, 4 μL extraherat DNA förstärks med framåt/bakåt-index grundfärger. Varje reverse primer innehåller en 12 bas streckkod. Varje prov förstärks i tre exemplar. En plattan med 96 brunnar innehåller 32 olika streckkoder. Höger, kombinera varje streckkod tre exemplar i en enda volym tube. En plattan med 96 brunnar innehåller 96 olika streckkoder. 4) bibliotek kvantifiering: övre panelen, screening för positiva prover, amplikoner upptäcktes på etidiumbromid-färgade 1% agarosgel. Nedre panelen, kvantifiering av den positiva amplikoner till equimolar koncentration av 500 ng amplikon från varje prov in en enda bibliotek. 5) bibliotek rening: övre panelen, poolade biblioteket är gel extraheras för storlek urval och rening. Nedre panelen, bibliotek exakta storlek och koncentration mäts. 6) sekvensering: hög genomströmning sekvensering av poolade biblioteket. 7) sekvensering data analyseras av ett bioinformatiska försäljningsförlopp för 16S rRNA-amplikon mikrobiell ekologi. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : Konsekvent relativa överflöd mellan prover som härstammar från samma pall prov men gick igenom olika bibliotek förberedelse. Taxonomiska relativa överflöd på stam nivå visas per prov som anges. Relativa överflöd visas 16 fekal produktproverna inlagda patienter med misstänkt smittsam diarré att varje gick igenom olika bibliotek förberedelse (Duplicate 1 och 2) med olika omvänd barcoded primers och av 3 friska kontroller. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : Phylogenetic mångfald visar konsekvent resultat för prover som härstammar från samma pall prov men gick igenom olika bibliotek förberedelse. Huvudsakliga koordinater analys (PCoA) som minskar dimensionalitet av dataunderlaget användes på UniFrac matrix att visuellt utforska prov separation och likhet. Avståndet mellan två samplingarna representerar skillnaden i deras mikrobiomet sammansättning. (A) ovägda UniFrac PCoA tomt. Varje punkt representerar en enda sekvenserade prov. Prover som härstammar från samma ursprungliga pall provet färgas samma. Prover från inlagda patienter med positiv pall kultur rapporteras av klinisk mikrobiologi1 markeras av torg, inlagda patienter med kultur negativt i trianglar1och friska vuxna från en separat sekvensering run1 markeras med fylld i cirklar. (B) samma PCoA som i A, men proverna är nu färgad av sin relativa överflöd av Proteobacteria, som anges. Klicka här för att se en större version av denna siffra.

Primer namn Primer sekvens Primer Beskrivning
Forward primer AATGATACGGCGACCACCGAGATCTACAC - TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA 5' adapter sekvens - vidarebefordra primer pad - vidarebefordra primer linker - Forward primer
Omvänd index primer CAAGCAGAAGACGGCATACGAGAT - XXXXXXXXXXXX - AGTCAGTCAG - CC - GACTACHVGGGTWTCTAAT Omvänd komplement av 3' adapter sekvens - Golay barcode - Reverse primer pad - Reverse primer linker - Reverse primer
Läs 1 sekvensering primer TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA Vidarebefordra primer pad - vidarebefordra primer linker - Forward primer
Läs 2 sekvensering primer AGTCAGTCAG - CC - GGACTACHVGGGTWTCTAAT Reverse primer pad - Reverse primer linker - Reverse primer
Index-sekvens primer ATTAGAWACCCBDGTAGTCC - GG - CTGACTGACT Omvänd komplement av reverse primer - omvänd komplement för reverse primer linker - omvänd komplement av reverse primer pad

Tabell 1: Primer lista.

Prov Antal läsningar post
inledande kvalitetskontroll i
QIIME
PCR på rena kompresser i utvinning och utspädning lösning -1 118
PCR på rena kompresser i utvinning och utspädning lösning -2 39
PCR utan mall -1 0
PCR utan mall -2 0
PCR på utvinning och utspädning lösningar mix - 1 16
PCR på utvinning och utspädning lösningar mix - 2 0
Prover (medelvärde ± medelfel) 10622.57 ± 1211.34

Tabell 2: Antal läsningar för negativa kontroller och för fekal prover.

Kompletterande Material 1: databehandling script. Vänligen klicka här för att hämta den här filen.

Kompletterande Material 2: mappningsfil. Vänligen klicka här för att hämta den här filen.

Kompletterande Material 3: Primer system. Vänligen klicka här för att hämta den här filen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

16s rRNA-amplikon och metagenomik shotgun sekvensering har vunnit popularitet i klinisk mikrobiologi program21,22,23. Dessa tekniker är fördelaktigt i deras ökade förmåga att fånga odlingsbara och icke-odlingsbara taxa, som tillhandahåller data om det relativa överflödet av de patogena inokulatet och deras förmåga att identifiera mer exakt en polymikrobiella smittsamma Fingerprint24. Framsteg inom mikrobiomet forskningsområdet har genererat enorma mängder data som inte är enkelt jämförbara på grund av bristande konsekvens i de olika modellerna. Under senare år har har flera konsortier försökt att åtgärda några av dessa frågor. Detta protokoll följer liknande bibliotek preparatet som jorden mikrobiomet projektet (EMP). Lagt till är dock ett detaljerade stegvisa protokoll för DNA-extraktion från fecal prov via analyser pipeline.

16S rRNA sekvensering har tidigare använts för att karakterisera de mikrobiella sammansättning mönster av fecal prov från friska icke-sjukhus och inlagda patienter med misstänkt smittsam diarré och traditionell kultur resultat. Resultaten från denna analys visade att intagna patienter har djupgående ökar i taxa från Proteobacteria stam1. Beskrivs här är en integrerad protokoll av i stort sett använda metoderna för 16S rRNA amplikon gensekvensering använder den direkta PCR kolumner-gratis strategi som var ursprungligen avsedd för utvinning av växt DNA16. Detta tillvägagångssätt kan effektivt och extrahera snabbt bra förstärks-DNA bibliotek inriktning V4 variabla regionen av 16S rRNA genen från ett stort antal prover som är lämpliga för hög genomströmning 16S rRNA sekvensering.

Eftersom detta är en metod för DNA-baserade sekvensering, fås uppgifter om både Aerober och anaerober mikrobiella samhällen i en individuell fecal prov. Protokollet antogs primers som var ursprungligen utformade15 mot regionen V4 av 16S rRNA-genen. Ännu viktigare, omvänd förstärkning primer innehåller en tolv bas streckkod-sekvens som stöder utbyte av upp till 2 167 olika prover i varje lane15. Framåt förstärkning primer innehåller nio extra baser i regionen adapter som stöder Parade-end sekvensering på sekvensering plattform25 (tabell 1 och kompletterande Material 3). Detta tillvägagångssätt aktiverad hantering ett bibliotek består av 250 fecal prov som var sekvenserade på ett körfält med en rinnande djup av 10622.57 ± 1211.34 (medelvärde ± medelfel) läser per prov med en kostnad på ~ 30 dollar per prov.

För att säkerställa kvalitetskontroll, föreslår vi att du använder följande negativa kontroller; i) PCR utan DNA-mall, ii) PCR på DNA extraheras från en ren steril kompress, och iii) PCR på blandade utvinning och utspädning lösning. När det gäller positiva kontroller rekommenderar vi inklusive prover som härstammar från samma pall prov men gick igenom olika bibliotek preparationen med olika omvänd barcoded primers och prover från tidigare körningar som interna kvalitetskontroll. Att notera är andra valfria positiva kontroller användas de mikrobiomet mätstandarder som tillhandahålls av NIST. Genomsnittligt läser täckning för de negativa kontrollerna är anmärkningsvärt lägre jämfört med de faktiska avföringsprov (tabell 1) och bestod främst från de Mycoplasma taxa. Vi visade ytterligare konsekvens av sekvensering resultaten med hjälp av prover som alla härstammar från samma fekalt material men som gick igenom olika bibliotek förberedelse (figur 3). Detta resultat bekräftar också att, när du använder vår integrerad metod, det finns ingen korskontamination mellan prover.

I detta protokoll introducerar vi ett integrerat uniformerade, genomförbara protokoll för att analysera stora mängder prover. Detta protokoll syftar till att vägleda forskare intresserade av att inleda användning av 16S rRNA-amplikon sekvensering i ett robust, reproduktiva, lätt att använda, billig, detaljerade sätt från fekal samling att dataanalyser, med viktiga kontroller. Använder denna standardiserade detaljerad guidade protokollet, kan minimera batch effekter och möjliggöra mer jämförbar sekvensering resultaten mellan olika laboratorier.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Detta arbete stöds delvis av programmet jag-CORE (bidrag nr 41/11), Stiftelsen Israel vetenskap (grant nr 908/15), och Europeiska Crohns och kolit organisation (ECCO).

Materials

Name Company Catalog Number Comments
Primers Integrated DNA Technologies (IDT)
Extraction solution Sigma-Aldrich E7526
Dilution solution Sigma-Aldrich D5688
Kapa HiFi HotStart ReadyMix PCR Kit KAPABIOSYSTEMS KK2601 PCR Master mix
Quant-iT PicoGreen dsDNA Reagent kit Invitrogen P7589 dsDNA quantify reagent
MinElute Gel extraction kit Qiagen 28606
Agarose Amresco 0710-250G
Ultra Pure Water Dnase and Rnase Free Biological Industries 01-866-1A
Qubit dsDNA HS assay kit Molecular probes Q32854 dsDNA detecting kit
High Sensitivity D1000 Agilent Technologies Screen Tape 5067-5582 separation and analysis
Screen Tape Assay Agilent Technologies Reagents 5067-5583 for DNA libraries
PhiX Control v3 Illumina 15017666 control library
MiSeq Reagent Kit v2 (500 cycle) Illumina MS-102-2003
Ethidium Bromide Amresco E406-10mL-TAM
2 mL collection tubes SARSTEDT 72.695.400 Safe Seal collection tubes
Plastic stick swab in PP test tube STERILE INTERIOR 23117
Name Company Catalog Number Comments
Equipment
PCR Machine Applied Biosystems 2720 Thermal Cycler
Sequncing Machine Illumina Miseq
PCR workstation Biosan UV-cleaner
scissors
vortexer Scientific Industries Vortex-Genie 2

DOWNLOAD MATERIALS LIST

References

  1. Braun, T., et al. Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis. Scientific Reports. 7, 1088 (2017).
  2. De Filippo, C., et al. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).
  3. Yatsunenko, T., et al. Human gut microbiome viewed across age and geography. Nature. 486, 222-227 (2012).
  4. Rodriguez, J. M., et al. The composition of the gut microbiota throughout life, with an emphasis on early life. Microbial Ecology in Health and Disease. 26, 26050 (2015).
  5. Turnbaugh, P. J., et al. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature. 444, 1027-1031 (2006).
  6. McDonald, D., et al. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. The ISME Journal. 6, 610-618 (2012).
  7. Bakken, J. S., et al. Treating Clostridium difficile infection with fecal microbiota transplantation. Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).
  8. Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea. Journal of Clinical Gastroenterology. 44, 354-360 (2010).
  9. Nood, E. V., et al. Duodenal infusion of donor feces for recurrent Clostridium difficile. The New England Journal of Medicine. 368, 407-415 (2013).
  10. Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. Value of stool cultures. The Lancet. 316, 413-416 (1980).
  11. Platts-Mills, J. A., Liu, J., Houpt, E. R. New concepts in diagnostics for infectious diarrhea. Mucosal Immunology. 6, 876-885 (2013).
  12. Bokulich, N. A., et al. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nature Methods. 10, 57-59 (2013).
  13. Leek, J. T., et al. Tackling the widespread and critical impact of batch effects in high-throughput data. Nature Reviews Genetics. 11, (2010).
  14. Dubilier, N., McFall-Ngai, M., Zhao, L. Create a global microbiome effort. Nature. 526, 631-634 (2015).
  15. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. PNAS. 108, 4516-4522 (2011).
  16. Flores, G. E., Henley, J. B., Fierer, N. A direct PCR approach to accelerate analyses of human-associated microbial communities. PloS One. 7, (2012).
  17. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature Methods. 7, 335-336 (2010).
  18. Callahan, B. J., et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nature Methods. 13, 581-583 (2016).
  19. Lozupone, C., Knight, R. UniFrac: A new phylogenetic method for comparing microbial communities. Applied and Environmental Microbiology. 71, 8228-8235 (2005).
  20. Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. UniFrac: An effective distance metric for microbial community comparison. The ISME Journal. 5, 169-172 (2011).
  21. Srinivasan, R., et al. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens. PloS One. 10, e0117617 (2015).
  22. Hiergeist, A., Gläsner, J., Reischl, U., Gessner, A. Analyses of intestinal microbiota: culture versus sequencing. ILAR Journal. 56, 228-240 (2015).
  23. Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. Transforming clinical microbiology with bacterial genome sequencing. Nature Reviews Genetics. 13, 601-612 (2012).
  24. Salipante, S. J., et al. Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections. PloS One. 8, e65226 (2013).
  25. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME Journal. 6, 1621-1624 (2012).
Guidade protokoll för fekal mikrobiell karakterisering av 16S rRNA-amplikon sekvensering
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).More

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter