Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

X-ışını kristalografisi Nsa1 S. Cerevisiae üzerinden yapılandırılmamış bölgelerinde modellemek için küçük açı X-Ray saçılma ile birleştirerek

doi: 10.3791/56953 Published: January 10, 2018

Summary

Bu yöntem klonlama, ifade ve yapısal tayini için rekombinant Nsa1 arınma x-ışını kristalografisi ve küçük açı X-ray saçılma (SAXS) tarafından açıklar ve diğer proteinlerin hibrid yapısal analiz için geçerlidir her ikisi de içeren düzenli ve düzensiz etki alanları.

Abstract

Saccharomyces cerevisiae (S. cerevisiae) elde ribozom derleme faktörü Nsa1 tam uzunlukta yapısını belirlenmesi zor nedeniyle düzensiz ve proteaz değişken C-terminus protein. Bu el yazması x-ışını kristalografisi ve SAXS göre yapısal analiz için S. cerevisiae üzerinden rekombinant Nsa1 arındırmak için yöntemleri açıklar. X-ışını kristalografisi Nsa1 iyi N-terminal WD40 etki alanı yapısını çözmek için kullanılmıştır ve sonra SAXS Nsa1, C-terminus yapısında çözüm çözmek için kullanıldı. Çözüm saçılma veriler çözüm tam uzunlukta Nsa1 üzerinden toplanmıştır. Teorik saçılma genlikleri WD40 etki alanı yüksek çözünürlüklü kristal yapısı hesaplanan ve C-terminus Nsa1, katı vücut ve ab initio modelleme bir arada ortaya koydu. Bu melez yaklaşımla tüm protein dördüncül yapısının yeniden. Burada sunulan yöntemleri genel olarak yapılandırılmış ve yapılandırılmamış etki alanları karışımından oluşan diğer proteinlerin hibrid yapısal kararlılık için uygulanabilir olmalıdır.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ribozom mRNA tüm canlı hücrelerdeki protein dönüştürerek httpd'ye temel rolü gerçekleştirmek büyük Ribonükleoprotein makinelerdir. Ribozom ribozom biyongenezi1,2,3,4olarak adlandırdığı karmaşık bir süreç içinde üretilen iki altbirimden oluşur. Ökaryotik ribozom derleme gerekli ribozomal derleme faktörler2,3,5yüzlerce yardımıyla dayanır. Nsa1 (Nop7 ilişkili 1) özellikle büyük ribozomal altbirimde6üretimi için gerekli olan bir ökaryotik ribozom derleme bir faktördür ve WD yineleme olarak bilinen 74 (WDR74) daha yüksek organizmaların7içeren. WDR74 fareler8blastosist oluşumu için gerekli olduğu gösterilmiştir ve WDR74 düzenleyici sık kanser hücreleri9' mutasyona uğramış. Ancak, işlev ve Nsa1/WDR74 kesin mekanizmaları ribozom derlemesinde hala büyük ölçüde bilinmeyen vardır. Nsa1/WDR74 rolü ökaryotik ribozom olgunlaşma sırasında ortaya çıkarmak başlamak için birden çok yapısal analiz, x-ışını kristalografisi ve küçük açı X-ray saçılma (SAXS)10gibi yapıldı.

X-ışını kristalografisi, Nükleer manyetik rezonans (NMR) spektroskopisi, elektron mikroskobu ve SAXS makromoleküllerin yapısı eğitim için tüm önemli teknikler vardır. Boyut, şekil, kullanılabilirliğini ve kararlılığını belirli bir makromolekül en iyi olacak Yapısal Biyoloji yöntemi uygun oluştururlar etkiler, ancak bir çok teknik bir sözde "melez" yaklaşımla birleştirerek haline geliyor bir giderek daha faydalı aracı11. Özellikle x-ışını kristalografisi ve SAXS yapısal oluştururlar12tespiti için güçlü ve tamamlayıcı yöntemler vardır.

Kristalografi ribozom gibi büyük hücresel makine küçük moleküller arasında değişen yüksek çözünürlüklü atomik yapıları sağlar ve proteinleri ve diğer biyolojik fonksiyonların anlamada çok sayıda devrimler yol açmıştır oluştururlar13. Ayrıca, uyuşturucu yapısı tabanlı tasarım hesaplama yöntemleri, ilaç bulma ve geliştirme14için kritik bir boyut ekleme tarafından Moleküler yerleştirme için kristal yapıları gücünü. Onun geniş uygulanabilirliği rağmen esnek ve düzensiz kristal ambalaj engel veya elektron yoğunluğu eşlemeleri tamamlanmamış olabilir beri kristalografisi, ya da düşük kaliteli değerlendirmek için zorlu sistemlerdir. Tersine, SAXS çözüm tabanlı ve düşük çözünürlüklü yapısal yaklaşım düzensiz döngüler ve termini özünde düzensiz proteinler12,15,16' kadar esnek sistemleri açıklayan yeteneğine sahip olduğunu. Parçacık boyutları12geniş bir yelpazesi ile uyumlu olduğunu düşünürsek, SAXS sinerjik kristalografisi yapısal çalışmaları tarafından ele alınması biyolojik sorular aralığı genişletmek için çalışabilirsiniz.

Bir fonksiyonel ama esnek C-hangi x-ışını kristalografisi yöntemleri için müsait değildir terminus ardından iyi yapılandırılmış bir WD40 etki alanı içerdiği için Nsa1 bir melez yapısal yaklaşım için uygundur. Klonlama, ifade ve arıtma S. cerevisiae Nsa1 x-ışını kristalografisi tarafından hibrid yapısal tayini için ve SAXS için bir protokol aşağıdadır. Bu iletişim kuralı bir arada düzenli ve düzensiz bölgeler oluşmaktadır diğer proteinler yapılarının çalışmaya adapte edilebilir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. rekombinant Protein üretimi ve Nsa 1 arıtma

  1. Nsa1 ifade plazmid tasarım ve klonlama
    1. Elde etmek veya S. cerevisiae genomik DNA satın alın.
    2. PCR yükseltmek Nsa1 hedef dizisi (Nsa1FL, artıkları 1-463) ve C-terminal kesildi Nsa1 (Nsa1ΔC, artıkları 1-434) S. cerevisiae ve erime sıcaklığını izole genomik DNA'yı kullanarak uygun astar ile yaklaşık 1-2 dk bir uzantısı zaman ile 60 ° C. Aşağıdaki astar Nsa1 yükseltmek için kullanılmıştır:
      SC_Nsa1_FLFw:CGCCAAAGGCCTATGAGGTTACTAGTCAGCTGTGTGGATAG
      SC_Nsa1_FLRv:AATGCAGCGGCCGCTCAAATTTTGCTTTTCTTACTGGCTTTAGAAGCGC
      SC_Nsa1ΔcFw:GGGCGCCATGGGATCCATGAGGTTACTAGTCAGCTGTGTGG
      SC_Nsa1ΔcRv: GATTCGAAAGCGGCCGCTTAAACCTTCCTTTTTTGCTTCCC
    3. Bir N-terminal içeren Escherichia coli (e.coli) ifade vektör pHMBP Nsa1 subclone 6 X-histidin etiketi ardından maltoz bağlayıcı Protein (MBP) ve standart klonlama teknikleri17 kullanarak bir tütün Etch virüs (TEV) proteaz site ekleyin .
    4. DNA sıralama Nsa1 N-terminal MBP O'nun etiketiyle çerçevesindeki klonlanmış doğrulamak için kullanın.
  2. Nsa1 Protein ifade
    1. İfade plasmid(s) uygun bir E. coli dönüşümü ifade gerilme T7 organizatörü tabanlı bir sistemin ile. Transformants 100 µg/mL Ampisilin içeren LB agar plakalar üzerinde plaka ve plaka gecede 37 ° C'de ters kuluçkaya
    2. 100 µg/mL Ampisilin dönüştürme plaka ile LB 50 mL kültürünü aşılamak ve gecede 200 devirde 37 ° C'de sallayarak ile büyür
    3. 3 x 1000 mL lb Fernbach şişeler 100 µg/mL Ampisilin ile yapılan gecede kültür 15 mL ile aşılamak ve 37 ° C'de 200 devirde sallayarak ile büyür
      Not: protein yapısı çözüm için selenomethionyl (SeMet) birleşme hücreleri ile SeMet ve bir amino asit karışımı metiyonin üretim indüksiyon, LB medya aksine önce etkisizleştirmek için takıma M9 en az orta büyüyen tarafından elde edilebilir 18.
    4. OD600 ~0.8 Buna ek olarak izopropil β-D-1 thiogalactopyranoside (IPTG) tarafından ulaştığında 1 mM gecede 200 devir / dakikada sallayarak ile kuluçka 25 ° c ve ardından son bir konsantrasyon, Nsa1 ifade teşvik.
    5. Santrifüjü 5,050 x g de 15 dakika 4 ° C'de tarafından hücre hasat.
      Not: Hücreleri uzun vadeli-80 ° C'de depolanan veya hemen protein arıtma için kullanılan.
  3. Nsa1 Protein saflaştırma
    1. Bir EDTA ücretsiz proteaz inhibitörü tablet içeren 4 ° C'de önceden soğutulmuş lizis arabelleği (50 mM Tris-HCl, pH 7.5, 500 mM NaCl, % 10 gliserol, 10 mM MgCl2) 25 mL hücrelerde resuspend.
    2. 4 ° C'de sonication tarafından hücreleri Parçalayıcı (zaman 7 dk., 2 dönemi, 2 s s döngüsü kapalı; genlik: % 70).
    3. Santrifüjü 26,900 x g 4 ° C'de 45 dk için de tarafından lysate açıklamak
    4. Geçerli bir yerçekimi akışı sütuna immobilize kobalt benzeşme reçine 10 mL ile yüklenen lysate açıklık, önceden lizis arabellek ile dengelenmiş.
    5. Yerçekimi akımını 4 ° C'de reçine geçmek ve reçine lizis arabelleği 100 mL ile iki kez yıkayın süpernatant izin.
    6. Nsa1 20 mL elüsyon arabellek (50 mM Tris-HCl pH 7.5, 500 mM NaCl, 5 mM MgCl2, % 5 gliserol ve 200 mM imidazole) ile elute.
    7. Eluate 15 μL al ve kaç protein benzeşme reçine (şekil 1A) eluted doğrulamak için bir 4-%15 SDS-sayfa jel üzerinde.
    8. MBP etiketi TEV proteaz sindirim tarafından kaldırın. TEV proteaz19 (1 mg/mL stok) 1 mL Nsa1 benzeşme reçine elüsyon için ekleyin ve bir gecede 4 ° C'de kuluçkaya.
    9. Konsantre MBP i ciddi Nsa1 için ~ 5 mL bir molekül ağırlığı ile santrifüj filtre kullanarak kapalı 10 kDa kes.
    10. MBP i ciddi Nsa1 geçerli bir jel-filtrasyon sütun için arabellek (20 mM Tris-HCl pH 7.5, 100 mM NaCl, 1 mM MgCl2, % 5 gliserol ve 1 mM β-mercaptoethanol) önceden equilibrated (şekil 1B).
    11. Sütun kesirler MBP i ciddi ve Nsa1 15 μL örnekleri 4-%15 SDS-sayfa jel (şekil 1B) üzerinde çalıştırarak ayrılmış doğrulamak için jel filtrasyon üzerinden analiz.
    12. Nsa1 içeren kesirleri birleştirin ve 8 mg/mL 10 kDa uzakta-in kesmek bir molekül ağırlığı ile santrifüj filtre kullanarak için konsantre.
    13. 280 Absorbans ölçerek protein konsantrasyonu belirlemek yok olma katsayısı 42530 M-1cm-1' i kullanarak bir Spektrofotometre nm. Protein hemen proteolitik tarama ve kristalizasyon denemeler için kullanın.

2. kristalizasyon ve Nsa 1 proteolitik tarama

  1. Seyrek matris kristal tarama Nsa1
    1. Nsa1 8 mg/mL stok vasıl 10 dk 4 ° C'de 16.000 x g 500 μL santrifüj kapasitesi.
    2. Kristalizasyon denemeler kristalizasyon robot ve seyrek matris kristal ekranlar kullanarak kurulum. Bireysel kristal ekran reaktifler seyrek matris kristalizasyon ekranlar üzerinden 30 μl ile 96 iyi tepsiler rezervuar doldurun. 250 karıştırılarak robot ile oturma damla kurulum nL 250 ile iyi çözüm nL protein çözüm.
    3. Kristalizasyon plakalarının bant ile ve onları 25 ° C'de kuluçkaya
    4. Tabakları her iki günde bir stereomicroscope ile ilk 2-3 hafta boyunca kontrol edin.
    5. Potansiyel kristalleri sayısı UV mikroskopla protein içerdiğini doğrulayın.
      Not: Nsa1 iki farklı kristal formlar için (kübik ve Ortorombik, şekil 2A) aşağıdaki ekranları 1 hafta içinde elde edilmiştir: JCSG + condition B11 (1.6 M sodyum sitrat Tribazik kurutmak, pH 6,5) ve Sihirbazı Precipitant sinerji ekran blok 2 C11 durumu (20.1%(v/v) 1500 PEG, 13.4%(v/v) 400 PEG, 0.1 M Tris HEPES/sodyum hidroksit, pH 7.5).
  2. Proteolitik tarama
    Not: kristalizasyon en iyileştirme sırasında bu Nsa1 Ortorombik kristalleri proteolitik bölünme sonucu olarak ortaya çıktı ve tam uzunlukta protein kullanarak kristallerin çoğaltılamadı keşfedildi. Sınırlı proteolizis kütle spektrometresi ile birleştiğinde kullanarak, bu Nsa1, C-terminus proteolizis için hassas ve C-terminal kuyruk kaldırılması Ortorombik kristal formu (sonraki üreme için gerekli belirlendi Nsa1ΔC).
    1. 1 mg/mL proteaz hisse senedi çözümleri aşağıdaki proteaz α-kimotripsin, Tripsin, elastase, papain, subtilisin ve endoproteinase Glu-C. hazırlamak
    2. 1:10, 1: 100 ve 1: 1000 dilutions her 1 mg/mL proteaz stokunun ile seyreltme tampon (10 mM HEPES, pH 7.5, 500 mM Sodyum Klorür) oluşturun.
    3. Proteaz stokunun (1:10, 1: 100 ve 1: 1000) 1 μL pipet protein (1 mg/mL) taranması her proteaz için 9 μL aliquots içine.
    4. Çözüm için 1 h 37 ° C'de kuluçkaya.
    5. Reaksiyon 10 μL 2 x SDS-sayfa örnek arabelleği ekleyerek durdurmak ve 5 min için 95 ° C'de tepki ısı.
    6. Özetler bir % 4-15 SDS-sayfa jel (şekil 2B) çalıştırarak analiz.
    7. Hedef protein proteaz dayanıklı etki alanlarına göre jel kütle spektrometresi analiz tanımlayın.
    8. Proteaz değişken bölgeler kesilmiş ifade yapılarını oluşturarak ve yukarıda açıklanan klonlama, ifade ve arıtma iletişim kuralı aşağıdaki hedef protein kaldırın.
  3. Kristalizasyon en iyi duruma getirme
    1. Hazırlamak veya hisse senedi çözümleri aşağıdaki ilk kristalizasyon reaktifler, alın: 1.6 M sodyum sitrat Tribazik kurutmak pH 6,5, 100%(v/v) 400 PEG, 50%(v/v) 1500 PEG, 1 M HEPES/sodyum hidroksit, pH 7.5.
    2. Nsa1 stok çözeltisi hazırlamakFL ve Nsa1ΔC , 8 mg/mL yukarıda açıklandığı gibi.
    3. Nsa1 kübik kristaller optimize (Nsa1FL).
      1. 1-1.6 m sodyum sitrat ile pH 6,5-1,6 M sodyum sitrat Tribazik hisse senedi bir çözüm pH 6,5 ile gradyan ile 500 µL içeren wells ile 24-iyi kılavuz ekran hazırlayın.
      2. Mix 1 µL 1 µL iyi çözüm ve yeri bir kapak silikonlu slayt üzerine karışımı ile protein. Dikkatli önceden yağlanmış üstüne kapak slayt iyi ve emin olmak ters çevir'i de kapalı ama değil damla rahatsız veya kapak slayt kırmak için özen gösterin. Tepsi doldurulur kadar bu işlemi yineleyin ve ardından 25 ° C'de depolayın
        Not: Küçük kübik kristaller 2-7 gün içinde görünmelidir.
      3. Bir microseed hisse senedi kübik kristaller hazırlayın. Bir monte naylon döngü ~ 10 küçük kübik kristaller küçük boncuk ve 1,6 M sodyum sitrat Tribazik zekâ pH 6,5 50 µL içeren 1,5 mL mikro-santrifüj tüpü aktarmak için kullanın.
      4. Girdap 1,5 mL mikro-santrifüj tüpü yüksek hızda (~ 3000 devir/dakika) 1 dk için.
      5. Karışım iyice 5 için 1,6 M sodyum sitrat Tribazik ve girdap ile tohum stokunun 10 kat seri dilutions bir dizi yapmak s.
      6. Her doldurmak iyi bir 24-şey tablo, 1,6 M sodyum sitrat Tribazik pH 6,5 500 µL ile ekran.
      7. Microseeding koşulları damla protein tohum stok Çözümleri (şekil 3A) ile değişen oranlara sahip ayarlayarak en iyi duruma getirme. Yüksek kırınım kalite daha büyük kübik kristaller (şekil 3 c) 2-5 gün içinde görünmelidir.
    4. Ortorombik kristalleri optimize (Nsa1ΔC)
      1. 500 µL 24 farklı koşullar (şekil 3B) ile her iyi bir kılavuz ekran 50%(v/v) PEG 1500 ve 100%(v/v) PEG 400 hisse senedi çözümlerinden hazırlayın. Ek olarak degradeler PEG 1500 ve PEG 400 her şey aynı 0.1 M HEPES/sodyum hidroksit pH 7.5 içermelidir.
      2. Protein çözüm 1 µL silikonlu kapak Slayt üzerindeki iyi çözüm 1 µL karıştırın. Dikkatli önceden yağlanmış üstüne kapak slayt iyi ve emin olmak ters çevir'i de kapalı. Tüm belgili tanımlık tepsi dolu kadar bu işlemi yineleyin. Tepsiler 25 ° C'de depolayın
        Not: Nsa1 Ortorombik kristalleri 2-7 gün içinde görünmelidir.
      3. Kübik kristaller (Adım 2.3.3.3-2.3.3.7) açıklandığı gibi Ortorombik kristalleri microseeding tarafından daha fazla optimize 20.1%(v/v) 1500 PEG, 13.4%(v/v) PEG 400 ve 0.1 M HEPES/sodyum hidroksit pH 7.5 500 µL iyi çözüm olarak kullanarak.
        Not: Nsa1 SeMet kristalleri benzer şekilde yerel kristaller daha optimize edilmelidir.

3. x-ışını kırınım veri toplama ve Nsa 1 yapı çözüm

  1. Cryo-kristaller ve x-ışını kırınım veri toplama korunması
    1. Ortorombik kristalleri (Nsa1ΔC), 22.5%(v/v) 1500 PEG, 15%(v/v) PEG 400 ve 0.1 M HEPES/sodyum hidroksit pH 7.5 içeren 1 mL cryoprotectant solüsyon hazırlamak.
    2. Bir köpük Dewar sıvı azot ile doldurun ve kristal Pak önceden serin. Sıvı azot ile çalışırken dikkatli olun ve koruyucu eldiven ve gözlük.
    3. Dikkatle de içeren bir stereomicroscope sahneye kristalleri kristalleşme kapak slayt tersine çevirin.
    4. Yeni bir kapak slayt üzerine cryoprotectant çözümün 2 µL pipet.
    5. Bir monte naylon döngü kristal için uygun büyüklükte bir manyetik cryo değnek iliştirin.
    6. Stereomicroscope yardımıyla kullanarak, hızlı bir şekilde bir kristal takılı cryo döngü ile cryoprotectant çözüm aktarın.
    7. 5 dakika içinde cryoprotectant çözüm için equilibrate kristal ver.
    8. Stereomicroscope yardımıyla kullanarak, hızlı bir şekilde cryoprotectant çözüm ve Dalma-freeze gelen kristal sıvı azot döngüsü.
    9. Kaynama durdurmak için döngü etrafında sıvı azot bekleyin ve değneği üzerinden döngü kristal puck içinde belirli bir konuma bırakın.
    10. Kübik Nsa1FL kristalleri cryoprotected olmak gerekli olmayan ve olmak doğrudan flaş dondurulmuş (adımları 3.1.8-3.1.9 yukarıdaki).
    11. Cryo araçlarını kullanarak kristal puck mühür ve bir nakliye baston önceden soğutulmuş dewar içinde transfer. Kristalleri adam/dewars veri toplama kadar saklayın.
    12. Eğer bir sinkrotron veri toplama, Kuru bir nakliyeci kullanarak sinkrotron kristal gemi.
    13. Aşağıdaki standart teknikleri20x-ışını kırınım veri toplamak.
      Not: Nsa1 yerli ve SAD için (tek dalga boyu anormal dağılım) veri kümeleri 100 K 22-ID ve 22-BM Argonne Ulusal Laboratuvarı (Chicago, Il) gelişmiş foton kaynağının SER-kedi ışın satırlarındaki toplanmıştır. SAD Nsa1 veri kümesi λ toplanan 0.97911 Å =. Veri 1 s çekim hızı ve 0.5 ° salınımlarını kullanarak kaydedildi. Bu kristaller mosaicity genellikle yaklaşık 0.3 ° yapıldı.
    14. İşlem ve ölçeği x-ışını kırınım yansıma dosyaları her veri kümesi için uygun alan grubunda oluşturmak resimlerini.
      Not: HKL200021Nsa1 Difraksiyon veri kümeleri işlendi. Nsa1 kübik kristaller uzay grubu P213 işlendi ve Ortorombik kristaller içinde alan grup P212121işlendi.
  2. Nsa1 yapı çözüm.
    Not: Çözmek ve rafine Phenix ve CCP422,23dahil olmak üzere kristal yapılar için kullanılan birkaç kristalografisi yazılım paketleri vardır. Phenix yazılım Süiti22kullanarak Nsa1 yapı çözüm için protokol aşağıdadır.
    1. Çözümlemek veri kümeleri phenix.xtriage22ile yerli ve SAD ölçekli.
    2. ÜZGÜN tepe yansıma dosyası22,24kullanarak Phenix.autosol ile Nsa1 yapısını çözmek. AutoSol programını çalıştırmak için selenomethionine sitelerin sayısı giriş (siteleri = 9), Nsa1ΔC ve üzgün veri toplamak için kullanılan dalga boyu fasta sıra dosya (λ 0.97911 Å =).
      Not: Nsa1 SAD kümesinden phenix.autosol deneysel aşamada belirlemek ve çoğu model oluşturmak gerekir.
    3. Coot25phenix.refine22,26arıtma ardından, modeliyle manuel ayarlamalar.
    4. Yüksek çözünürlüklü yerli Ortorombik kristal ve kübik kristal yapısı moleküler yedek tarafından fazer27,28kullanarak çözmek.
    5. Model ve elektron yoğunluğu başarılı yapı çözüm sonra incelemek harita Coot25.
    6. Oluşturmak ve phenix.refine22,26 , Sakarmeke25bina modelini arıtma yinelemeli tur çalıştırarak yapılar rafine.

4. SAXS veri toplama, işleme ve modelleme

  1. SAXS veri toplama
    Not: Tam uzunlukta S. cerevisiae için SAXS veri kaydedildi, Gelişmiş ışık kaynağında yüksek üretilen iş FALCILAR beamline 12.3.1 Lawrence Berkeley Ulusal Laboratuvarı, Berkeley, CA29Nsa1.
    1. Nsa1 arındırmak yukarıda açıklanan protokol sonrasıFL . Nsa1 Sevkiyat öncesinde 24 hFL beamline, protein bir jel filtrasyon sütun üzerinde çalıştırmak için önceden dengelenmiş bir arabellek A.
    2. Nsa1 içeren kesirleri havuz ve daha önce anlatıldığı gibi protein konsantrasyonu belirlemek.
    3. Toplama serisi 1 Nsa1 6,2 mg/ml arabellek c.kullanarak 30 μl aliquots hazırlamak
    4. Nsa1 her konsantrasyon dizi 20 μl etek net tam 96 iyi Mikroplaka arabellek A yalnız denetimleri ile birlikte aktarın.
      Not: SAXS veri toplama, arası parçacık itme ve radyasyon hasarı etkileri önlemek için saflaştırılmış örnek çeşitli konsantrasyonları kullanarak sulu çözümler üzerinde toplanır.
    5. Mikroplaka sızdırmazlık mat ve gemi gecede 4 ° c beamline ile bir silikon ile kapatın.
    6. 4 ° C'de Mikroplaka veri toplama kadar saklayın.
    7. Hemen veri toplama önce 3200 x g 10 dk 4 ° C'de potansiyel toplamları kaldırmak ve hava kabarcıkları için plaka döndür.
    8. Kayıt SAXS veri.
      Not: Nsa1 için SAXS veri arabelleği için önce ve sonra her protein konsantrasyonu serisi kaydedildi. Otuz üç ardışık s Nsa1 için toplanan 0,3 taranmasınıFL 10 ° C'de bir konsantrasyon dizi (1-6,2 mg/mL) üzerinden
    9. Arabellek çıkarma SAXS veriler için gerçekleştirme.
      Not: Nsa1 için arabellek çıkarma otomatik olarak beamline yapıldı ama arabellek çıkarma dağılım30 ve31ATSAS Süiti gibi veri azaltma yazılımı kullanılarak da gerçekleştirilebilir. Arabellek çıkarma SAXS veri analizi kritik bir parçasıdır ve çıkarma için kullanılan arabellek protein örnek arabellek için aynı olması için özen göstermelidir.
    10. Ortalama 33 ardışık her konsantrasyon için bir *ave.dat dosyası oluşturmak için tarar.
      Not: eğrileri karşılaştırmak için 33 ardışık kareyi yerleşimi. Saçılma eğrileri zaman içinde değişiklikler kez radyasyon hasar göstergesi. Bu kareler ortalaması üzerinden hariç. Nsa1 üst üste taranmasını ortalama FALCILAR beamline otomatik olarak gerçekleştirildi.
  2. SAXS veri işleme ve konsantrasyon serisi karşılaştırılması
    Not: SAXS verileri çözümlemek için kullanılan çeşitli yazılım paketleri vardır. Nsa1 için RADIUS eylemsizlik ve pair-wise mesafe dağıtım işlevleri tespit PRIMUS32 ve Gnom33 ATSAS 2.7.2 üzerinden kullanarak suite31 ve radyasyon yok olduğunu emin olmak için tüm protein konsantrasyonları arasında karşılaştırıldığında hasar veya konsantrasyon bağımlı arası parçacık etkileşimleri10.
    1. Bir terminal kabuğu'nu açın ve SAXS veri içeren dizine gidin.
    2. PRIMUS32 GUI üzerinden terminal kabuk içinde denize indirmek.
    3. PRIMUS GUI içinde saçılma eğrileri yüklemek (* ave.dat).
    4. Eylemsizlik yarıçapı (Rg) belirlemek ve saçılım yoğunluğu I(0), her saçılma Curve iletmek için AutoRg kullanın (* ave.dat).
    5. Kratky araziler her saçılma Curve oluşturmak (* ave.dat), anlatım derecesini değerlendirmek için.
    6. AutoGNOM33 pair-wise dağılım fonksiyonu hesaplamak için kullanın (her saçılma eğrisi için P(r)) olarak da bilinir (* ave.dat). Bir başlangıç Dmax ≈ girin 3 * Rg ve Dmax değeri düz bir P(r) eğri elde etmek için en iyi duruma getirme. Dmaxgetirilmesi sırasında hesaplanan P(r) işlevi tarafından bildirilen χ2 değeri denetleme ve görsel olarak saçılma eğriyi uydurmak genel değerlendirilmesi deneysel saçılma eğrisi ile tutarlı olduğundan emin olun.
    7. Nsa1 molekül ağırlığı korelasyon34hacmi kullanarak saçılma eğriler üzerinden hesaplamak.
    8. Yapısal parametreleri yok radyasyon hasarı veya konsantrasyon bağımlı etkileri olduğundan emin olmak için her konsantrasyon için karşılaştırın.
      Not: Konsantrasyon etkileri artan Rg ve Den fazla artan bir protein konsantrasyonu ile ilgili olarak meydana gelen. İleri I(0) örnek konsantrasyon tarafından bölünmüş saçılma da protein konsantrasyonu serisi arasında sabit kalmalıdır.
  3. SAXS modelleme
    Not: C-terminus, Nsa1 konumunu belirlemek içinFL, Nsa1 kristal yapısı10 (PDB 5SUM) ve SAXS saçılma eğrileri bir arada katı vücut ve modelleme, grup programları kullanarak ab initio taşımak için kullanılan 35 ve Ensemble optimizasyonu yöntemi (EOM)36 ATSAS yazılım Süiti31. Deneysel SAXS verileri sığdırmak için C-terminus, Nsa1 ile birlikte çeşitli düzensiz döngüler WD40 etki alanından örnek alınarak iken Nsa1 WD40 etki katı bir organ olarak tedavi edildi.
    1. Giriş PDB dosya (lar) oluşturur. PDB dosyasını her zaman artıkları arasındaki ana zinciri eksik ve PDB dosyasını içeren birden fazla biçimler, ligandlar, ya da su molekülleri bölmeniz gerekir.
    2. Grup (pre_bunch.pdb) için giriş PDB dosyasını hazırlamak için Pre_BUNCH35 programını çalıştırın. Hedef protein (*.seq), etki alanları/PDB 4.3.1 içinde oluşturulan sayısını dizisi giriş ve bireysel PDB dosyalarının her birinin yukarıda oluşturulan.
    3. Her bireysel PDB dosyasını programda CRYSOL37saçılma genlikleri hesaplayın. CRYSOL çalıştırmak için bireysel PDB dosyasını ve deneysel SAXS saçılma eğrisi (*.dat) giriş. Bu bir genlikleri dosyası oluşturur (* .alm).
    4. Program grup35 Nsa1 WD40 etki alanı karşı Birleşik bir katı vücut ve ab initio yaklaşım kullanarak SAXS veri modeli için çalıştırın. Girdi PDB dosyasını Pre_BUNCH (pre_bunch.pdb) üzerinden, deneysel SAXS saçılma eğrisi (*.dat) ve bireysel genlik (* .alm) CRYSOL tarafından oluşturulan her kısmi PDB dosyası için dosyaları.
    5. Başlangıç PDB (5SUM) χ2 değerinden modelinden deneysel SAXS verileri kullanarak grup tarafından oluşturulan ab initio bununla karşılaştırırsınız.
      Not: Başarılı bir grup model başlangıç modeli daha önemli ölçüde daha düşük χ2 değeri olmalıdır. Grup modeli teorik saçılma Ayrıca de deneysel veriler arasında grup modeli SAXS verilere teorik saçılma ve χ2 değerini (şekil 4, düzeninin görsel denetim tarafından karar olarak açıklamalıdır Merkezi boru hattı).
    6. Grup ve SAXS zarf (şekil 4, Merkezi boru hattı) tarafından oluşturulan modeli ile kristal yapısı yerleşimi için Pymol38 grup üzerinden çıktı dosyalarında el ile kontrol edin.
    7. Grup 10 - 20 kez yeniden çalıştırın modelleri benzer olduğunu doğrulamak için bağımsız modelleri oluşturmak için.
      Not: Nsa1 için χ2 değerleri ~ 1 3 20 bağımsız çalışan bir dizi vardı.
    8. Ensemble modelleme
      Not: bir isteğe bağlı bir yaklaşım grup EOM36 veya Minimal Ensemble arama39 (MES) çalıştırın. EOM ve MES proteinler ile birden fazla biçimler esnek etki alanları/bölgeler için uygundur ensemble yaklaşımları kullanın.
      1. EOM36 ATSAS online server kullanarak programı çalıştırın. EOM çalıştırmak için 4.3.1, hedef protein (*.seq) ve deneysel SAXS veri (*.dat) dizisi PDB dosyalarından girdi.
      2. Başlangıç PDB (5SUM) χ2 değerleri ile deneysel SAXS verileri kullanarak EOM tarafından oluşturulan topluluk karşılaştırmak.
        Not: Başarılı bir EOM topluluğu başlangıç modeli daha önemli ölçüde daha düşük χ2 değeri olmalıdır. Teorik saçılma Ensemble Ayrıca de deneysel veri SAXS veri topluluk teorik saçılma ve χ2 değerini (şekil 4, sağ arasında düzeninin görsel denetim tarafından karar olarak açıklamalıdır boru hattı). Bir de grup ve EOM hangi modeli en iyi deneysel SAXS verileri tanımlayan belirlemek için χ2 değerleri karşılaştırmak gerekir.
      3. El ile EOM conformers Pymol38 kristal yapısı ile EOM (şekil 4) tarafından oluşturulan conformers yerleşimi kontrol edin. Conformers toplam sayısı ve doluluk kısmını saçılma eğrisi için katkıda bulunan her conformer için dikkat edin. Nsa1 gibi daha sert molekülleri conformers sayısı küçük olmalıdır (1-5) (şekil 4, doğru boru hattı)36.
      4. EOM yeniden çalıştırmak tutarlı sonuçlar sağlamak için birkaç kez.
        Not: Nsa1 için conformers sayısı genellikle 3-4 0,1 0,3 için değişen χ2 değerleri ile oldu.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nsa1 S. cerevisiae genomik DNA'güçlendirilmiş ve ardından MBP ve TEV proteaz site bir N-terminal 6 x-histidin benzeşme etiketi içeren bir vektör içine subcloned PCR yapıldı. Nsa1 E. coli BL21(DE3) hücrelere dönüştü ve yüksek verim protein ifade aşağıdaki IPTG ile indüksiyon ve 25 ° c gece (şekil 1A) büyüme elde edilmiştir. Nsa1 benzeşme saf üzerinde immobilize kobalt benzeşme reçine, MBP bölünme TEV proteaz ile izledi ve sonunda boyutu dışlama Kromatografi (şekil 1B) tarafından çözüldü. Nsa1 içeren boyut dışlama Kromatografi gelen kesirler havuza alınmış, 8 mg/mL konsantre ve kristalizasyon robot ile kristalizasyon denemeler için kullanılan. İlk seyrek matris kristal ekranlar iki farklı kristal biçimi Nsa1, küp ve Ortorombik (şekil 2A) vermiştir.

Küp ve Ortorombik kristalleri en iyileştirme sırasında Ortorombik kristalleri Nsa1 proteolitik bölünme sonucu olarak ortaya çıkan keşfedilmiştir. Sınırlı proteolizis ve kütle spektrometresi proteolizis için hassas Nsa1 bölge belirlemek için kullanıldı ve Nsa1 konsantrasyon degradeye proteaz elastase (şekil 2B), hassas gözlendi. Sonraki kütle spektrometresi analiz bu bozulma C-terminus, Nsa1 kaybından sonuçlandı doğruladı. Nsa1, C-terminal truncations bir dizi oluşturulan, proteolitik duyarlı C-terminus (şekil 2C) kaldırmak için. Ortorombik kristalleri sonuçta ÜZÜCÜ yapı belirlenmesi için kullanılan Nsa1ΔC (artıkları 1-434) kesme ile tekrarlanan. Ortorombik kristaller de Nsa1 tedavisi ile tekrarlanmasıFL elastase 4 ° C'de crystal tekneleri ayarlama önce 1 saat ile.

Kübik Nsa1 kristalleri Nsa1 kullanarak optimizeFL sodyum sitrat degradeler, bir birleşimi yoluyla microseeding (şekil 3A) ile birleştiğinde. Bu büyük, tekrarlanabilir kübik kristaller, kırınım sınırı yaklaşık 2.8 olan Å çözünürlük (şekil 3 c, sol) vermiştir. Ortorombik kristalleri sadece konsantrasyon degradeler PEG 1500 ve PEG 400, büyük kristal kırınım sınırı olan yaklaşık 1,25 vermiştir microseeding ile birlikte değişen tarafından Nsa1, C-terminal kesme türevleri kullanarak optimize Å Çözünürlük (Şekil 3A-C). Nsa1 deneysel aşamalarında SeMet-SAD SeMet türevi Nsa1ΔC10üzerinden tarafından belirlendi.

Ancak her iki yapıları elektron yoğunluğu Nsa1 C-terminus için yoksun Nsa1 N-terminal yedi başlı β-pervane WD40 etki de her iki küp ve Ortorombik kristal yapılarını çözüldü. SAXS sonra Nsa1 eksik C-terminal etki alanında çözüm konumunu belirlemek için kullanıldı. En iyi duruma getirme veri toplama için örnek konsantrasyon sonra kısmi atomun yapısı vücut katı modelleme gerçekleştirmek ve bir ab initio yeniden inşası eksik bileşenleri oluşturmak için kullanılmıştır. Model için hesaplanan saçılma eğrileri deneysel verilere (şekil 4, Merkezi boru hattı) uyum iyiliği açısından değerlendirilmiştir. Nsa1 yalnız WD40 etki alanı, deneysel SAXS verilerin uygun değil olarak kristal yapısı PDB kimliği 5SUM oluşturulan teorik saçılma eğrisi ile deneysel saçılma eğrisi arasında tutarsızlık kanıtladığı (şekil 4, sol boru hattı). Vücut katı modelleme yanı sıra, topluluk modelleme de yapıldı. Bu 3-4 conformers Nsa1, bir topluluğu üretilen ve daha düşük bir χ2 değer (şekil 4, doğru boru hattı) sonuçlandı. Ensemble modelleme kullanarak modeli tutarsızlık (χ2) azalma çözüm Nsa1 C-terminal kuyrukta konformasyon örnekleme saptandı.

Figure 1
Şekil 1. İfade ve Nsa1 arınma 6 X-His-MBP füzyon etiketle. (A) BL21 protein ifadede SDS-sayfa analizi (DE3) hücreleri 25 ° C'de gecede ve kobalt benzeşme reçine kullanarak ilk arıtma adım. (B) temsilcisi boyutu dışlama Kromatografik TEV bölünme takip. Boyutu dışlama Kromatografi gelen kesirler SDS-PAGE tarafından analiz edildi. Kesirler 1 içeren Nsa1 toplanmış ve yapısal analiz için kullanılan en yüksek dan. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Şekil 2. Nsa1, C-terminus için proteolizis duyarlıdır. (A) Nsa1 ilk kristalizasyon çalışmaların iki farklı kristalleri form vermiştir: kübik ve Ortorombik. UV mikroskop kristalleri protein içerdiği doğrulamak için kullanıldı. Vis: Görünür ışık, UV: UV mikroskoplar. Ölçek çubuğu her penceresinde 50 µm =. (B) proteolitik tarama SDS-PAGE tarafından analiz. Üç dilutions (1:10, 1: 100, 1: 1000) her proteaz hissenin (0,1, 0.01 0.001 mg/mL) taranması için protein (1 mg/mL) aliquots ile kombine edilmiştir. Proteaz dayanıklı etki alanları analiz SDS-sayfa ve 37 ° C kuluçka 60 dk. Nsa1-FL sonra kütle spektrometresi: taze saf protein, Nsa1Δ: saf protein 4 ° C'de 3 hafta sonra protein bozulmuş form gözlenen depolanan. (C) şematik diyagramı Nsa1 tam uzunlukta (üst) ve C-terminal kesme (alt) oluşturun. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3. Nsa1 kristalizasyon optimizasyonu. (A) bir tohum stok ilk küçük kristaller hazırlanan ve seyreltme dizi yapmak için kullanılan (1 x ~ 1/104x) (microseeding). Protein 1 µL seyreltilmiş tohum stok 1 µL ile karıştırılarak, daha büyük tek kristalleri bir hafta içinde büyüdü. (B) precipitant konsantrasyon gradyanı Ortorombik kristal optimizasyonu için. (C) üçüncü ve Ortorombik kristalleri veri toplamak için kullanılan en iyi duruma getirilmiş. Yeşil daireler veri toplama kalite kristalleri vermiştir kristal tepsilerinin tipik alanını gösterir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4. Şematik Nsa1 SAXS analizi. SAXS verileri işlemek ve modelleri ile grup (Merkezi) ve EOM (sağda) oluşturmak için kullanılan boru hattı genel bakış. Sol boru hattı deneysel saçılma eğrisi arasında farklılık gösterir (kırmızı daireler, protein konsantrasyonu: 6 mg/mL) ile kristal yapısı PDB kimliği 5SUM oluşturulan teorik saçılma eğrisi (mavi çizgi). Modelleri deneysel SAXS saçılma eğrisi karşılaştırarak değerlendirildi (kırmızı daireler, protein konsantrasyonu: 6 mg/mL) ile saçılma eğrisi Nsa1 grup modelinden türetilmiş (siyah çizgi) veya Nsa1 EOM conformers (siyah çizgi). Her modelde WD40 etki alanı gösterilir (PDB kimliği 5SUM), yeşil renkli karikatür esnek C-terminus için bireysel EOM conformers grup ve yeşil, kırmızı, mavi ve sarı kırmızı renkli küreler gösterilir. EOM elde edilen her conformer kısmını modeli yanındaki etiketlenir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu iletişim kuralını kullanan, rekombinant Nsa1 S. cerevisiae gelen yapısal çalışmaları için x-ışını kristalografisi ve SAXS tarafından oluşturuldu. Nsa1 çözümde su kuyusu-davranmak ve kristal yükseltgen kristalize. Bu kristaller en iyileştirme sırasında C-terminus Nsa1, proteaz düşmesine duyarlı keşfedilmiştir. Yüksek çözünürlüklü Ortorombik kristal formu sadece çoğaltılamaz C-terminal kesme türevleri Nsa1, büyük olasılıkla ile esnek C-terminus Nsa1, kristal ambalaj engelledi çünkü. Nsa1 yapısını x-ışını kristalografisi yüksek çözünürlüklü tarafından çözüldü, ama değil sipariş çünkü C-terminus kristal form oluşturulamadı. Herhangi bir yöntemle gibi kristalografisi bazı kısıtlamalar bulunmaktadır ancak kristalografisi atomik çözünürlük yapıları oluştururlar çevresinde Nsa1, boyutunu belirlemek için galası bir tekniktir. Kristalografi büyük sınırlamalar biridir proteinler40,41düzensiz bölgeler çözme yeteneğinin olmaması.

C-terminus Nsa1, onun yapısı10çalışma gereğini vurgulamış protein, uygun genelde yerelleştirme için önemlidir. C-terminus, Nsa1, SAXS, x-ışını kristalografisi için tamamlayıcı Yapısal Biyoloji tekniği tarafından çözülmüş. SAXS veri için tam uzunlukta Nsa1 bir konsantrasyon serisi kaydedildi. Bu konsantrasyon serisi, Nsa1 SAXS veri toplama ve işleme için en iyi konsantrasyon tespit edilmiştir. SAXS veri Nsa1 için 6, 4.5 ve 3.0 mg/mL kaydedildi. Guinier bölgesi, P(r) fonksiyon ve molekül ağırlığı konsantrasyon serisi örnek su kuyusu-davranmak ve test deneysel koşullar altında toplanan değil emin olmak için belirlenmiştir. Nsa1 tam uzunlukta yapısını yeniden oluşturmak için teorik saçılma genlik kısmi kristal yapısı tespit edildi ve daha sonra ab initio yöntem esnek C-terminus modellemek için kullanılmıştır. Bu melez yaklaşım, bu esnek C-terminus Nsa1, dışarıya doğru sıralı WD40 etki alanından uzanır belirlendi.

İşleme araçları gelişmeler SAXS popülerlik makromoleküllerin yapısal çalışmalar için tahrik. SAXS x-ışını saçılması modeli gelen rastgele odaklı protein molekül ağırlığı ve genel şekli de dahil olmak üzere düşük çözünürlüklü yapısal bilgi sağlamak için çözüm ölçer. Sonuç olarak, SAXS kristalografisi için güçlü dik yapı doğrulama aracı olarak ortaya çıkmıştır. Bu büyük ölçüde atomik yapıları teorik saçılma ve bunları için deneysel SAXS veri37karşılaştırarak hesaplamak için hesaplama yöntem geliştirme kaynaklanmaktadır. Bu yaklaşım, konformasyon devlet, dördüncül yapı ve kristal kafes içinde gözlenen üst düzey derleme kullanarak çözümündeki zerresi yapısal özellikleri karşılaştırılabilir. Ayrıca, düzensiz döngüler ve x-ışını kristalografisi tarafından belirlenen yüksek çözünürlüklü yapılarda eksik termini çözüm saçılma verileri kullanarak modellenebilir. Bu melez yapısal yaklaşım kristal yapısı bir yapı taşı olarak SAXS destekli modelleme eksik kalıntılarının için kullanır ve C-terminus Nsa110, hem de grip A virüs M1 makromoleküllere eşleştirmesi'nde etkili olduğu kanıtlanmıştır matris protein42ve ölü-box RNA etmez43. Gelişmiş SAXS tabanlı modelleme yazılımı da özünde düzensiz proteinler gibi daha karmaşık sistemler birlikte genel saçılma katkıda conformers bir dizi kullanarak bu sistemlerin konformasyon manzara eşleyerek hitap edebilecek Çözüm16,39' parçacık potansiyelini. SAXS veri toplama ve işleme araçları alınan birlikte, son gelişmeler zorlu biyolojik sistemleri mücadele için hibrid Yapısal Biyoloji yaklaşımlar başarısı için katkıda bulunur.

Çözüm saçılma yüksek çözünürlüklü yapıları ile kombinasyonu esneklik ve oluştururlar44dinamikleri hakkında önemli soruları cevaplamak için hazırlanıyor. Nsa1 gibi birçok protein biyolojik fonksiyonu için önemli dinamik bölgeler var. Bu el yazması bir şablon iletişim kuralı olan SAXS birlikte yüksek çözünürlüklü yapı belirlenmesi detayları x-ışını kristalografisi tarafından sağlanır. X-ışını kristalografisi, SAXS de NMR dahil olmak üzere diğer Yapısal Biyoloji teknikleri iltifat için kullanılabilir ek olarak elektron paramagnetic rezonans (EPR) ve floresan rezonans enerji (FRET) transfer, SAXS önemini vurgulayarak daha fazla bir tamamlayıcı Yapısal Biyoloji tekniği45,46,47.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Kırınım veri Güneydoğu bölgesel işbirliği Access ekibi (SER-CAT) 22-ID ve 22-BM beamlines, Gelişmiş foton kaynak (APS), Argonne Ulusal Laboratuvarı, toplanmıştır. SAXS veri FALCILAR beamline, önceden ışık kaynağı (ALS), Lawrence Berkeley Ulusal Laboratuvarı üzerinde toplandı. FALCI beamline onların yardımıyla uzak veri toplama ve işleme için personel teşekkür etmek istiyorum. Ulusal çevre sağlık Bilimler Enstitüsü (NIEHS) kütle spektrometresi araştırma ve destek grubu için protein etki alanı sınırları belirleme konusunda yardım için sana şükrediyoruz. Bu eser bize Ulusal Enstitüsü, sağlık Intramural araştırma programı tarafından desteklenen; ABD Ulusal Enstitüsü çevre sağlığı Bilimleri (NIEHS) (R. E. S. için Ziya ES103247) ve sağlık araştırması (CIHR, 146626 M.C.P için) Kanadalı Enstitüleri. APS kullanımı bize Enerji Bakanlığı, bilim Office, Office temel Enerji Bilimler altında Sözleşme No Filtresi tarafından desteklenen yapıldı. W-31-109-Eng-38. Kullanım gelişmiş ışık kaynağı (ALS) Yönetmen, bilim Office, Office temel Enerji Bilimler, Sözleşme No altında ABD Enerji Bakanlığı tarafından desteklenmiştir DE-AC02-05CH11231. Ek destek FALCILAR SAXS beamline Ulusal Sağlık Enstitüsü gelir için project MINOS (R01GM105404) ve bir yüksek-son araçları Grant S10OD018483. Biz de Andrea ay ve Dr Sara Andres Bu el yazması onların eleştirel okuma için teşekkür etmek istiyorum.

Materials

Name Company Catalog Number Comments
Molecular Cloning of Nsa1
pMBP2 parallel vector Sheffield et al, Protein Expression and Purification 15, 34-39 (1999) We used a modified version of pMBP2 which included an N-terminal His-tag (pHMBP)
S. cerevisiae genomic DNA ATCC 204508D-5
Primers for cloning Nsa1
SC_Nsa1_FLFw IDT CGC CAA AGG CCT
ATGAGGTTACTAGTCAGCTGTGT
GGATAG
SC_Nsa1_FLRv IDT AATGCAGCGGCCGCTCAAATTTT
GCTTTTCTTACTGGCTTTAGAAGC
AGC
SC_Nsa1_DeltaCFw IDT GGGCGCCATGGGATCCATGAGG
TTACTAGTCAGCTGTGTGG
SC_Nsa1_DeltaCRv IDT GATTCGAAAGCGGCCGCTTAAAC
CTTCCTTTTTTGCTTCCC
Recombinant Protein Production and Purification of Nsa1
Escherichia coli BL21 (DE3) Star Cells Invitrogen C601003
pMBP- NSA1 and various truncations Lo et al., 2017
Selenomethionine Molecular Dimensions MD12-503B
IPTG, Dioxane-Free Promega V3953
EDTA Free Protease Inhibitor Cocktail Sigma-Aldrich 4693159001
Sodium Chloride Caledon Laboratory Chemicals 7560-1-80
Magnesium Chloride hexahydrate Sigma-Aldrich M2670
Tris Buffer, 1 M pH7.5 KD Medical RGF-3340
Glycerol Invitrogen 15514-029
beta-mercaptoethanol Sigma M6250
1M Imidazole, pH 8.0 Teknova I6980-06
Talon Affinity Resin Clonetech 635503
Amicon Ultra 15 mL Centrifugal Filter (MWCO 10K) Millipore UFC901024
HiLoad 16/600 Superdex 200 Prep Grade Gel Filtration Column GE-Healthcare 28989335
TEV Protease Prepared by NIEHS Protein Expression Core Expression plasmid provided by NCI (Tropea et al. Methods Mol Biology, 2009)
4-15% Mini-PROTEAN TGX Precast Protein Gels BioRad 456-8056
Crystallization, Proteolytic Screening
Crystal Screen Hampton Research HR2-110
Crystal Screen 2 Hampton Research HR2-112
Salt Rx Hampton Research HR2-136
Index Screen Hampton Research HR2-144
PEG/Ion Screen Hampton Research HR2-139
JCSG+ Molecular Dimensions MD1-37
Wizard Precipitant Synergy Molecular Dimensions MD15-PS-T
Swissci 96-well 3-drop UVP sitting drop plates TTP Labtech 4150-05823
3inch Wide Crystal Clear Sealing Tape Hampton Research HR4-506
Proti-Ace Kit Hampton Research HR2-429
PEG 1500 Molecular Dimensions MD2-100-6
PEG 400 Molecular Dimensions MD2-100-3
HEPES/sodium hydroxide pH 7.5 Molecular Dimensions MD2-011-
Sodium Citrate tribasic Molecular Dimensions MD2-100-127
22 mm x 0.22 mm Siliconized Coverslides Hampton Research HR3-231
24 Well Plates with sealant (VDX Plate with Sealant) Hampton Research HR3-172
18 mM Mounted Nylon Loops (0.05 mm to 0.5 mM) Hampton Research HR4-945, HR4-947, HR4-970, HR4-971
Seed Bead Kit Hampton Research HR2-320
Magnetic Crystal Caps Hampton Research HR4-779
Magnetic Cryo Wand Hampton Research HR4-729
Cryogenic Foam Dewar Hampton Research HR4-673
Crystal Puck System MiTeGen M-CP-111-021
Full Skirt 96 well Clear Plate VWR 10011-228
AxyMat Sealing Mat VWR 10011-130
Equipment
UVEX-m JAN Scientific, Inc.
Nanodrop Lite Spectrophotometer Thermo-Fisher
Mosquito Robot TTP Labtech
Software/Websites
HKL2000 Otwinoski and Minor, 1997
Phenix Adams et al., 2010
Coot Emsley et al., 2010
ATSAS Petoukhov et al., 2012 https://www.embl-hamburg.de/biosaxs/atsas-online/
Scatter Rambo and Tainer, 2013
Pymol The PyMOL Molecular Graphics System, Version 1.8 Schrödinger, LLC.
BUNCH Petoukhov and Svergun, 2005
CRYSOL Svergun et al, 1995
PRIMUS Konarev et al, 2003
EOM Tria et al, 2015

DOWNLOAD MATERIALS LIST

References

  1. Thomson, E., Ferreira-Cerca, S., Hurt, E. Eukaryotic ribosome biogenesis at a glance. J Cell Sci. 126, (Pt 21), 4815-4821 (2013).
  2. Woolford, J. L. Jr, Baserga, S. J. Ribosome biogenesis in the yeast Saccharomyces cerevisiae. Genetics. 195, (3), 643-681 (2013).
  3. Kressler, D., Hurt, E., Bassler, J. A Puzzle of Life: Crafting Ribosomal Subunits. Trends Biochem Sci. (2017).
  4. Tomecki, R., Sikorski, P. J., Zakrzewska-Placzek, M. Comparison of preribosomal RNA processing pathways in yeast, plant and human cells - focus on coordinated action of endo- and exoribonucleases. FEBS Lett. (2017).
  5. Kressler, D., Hurt, E., Bassler, J. Driving ribosome assembly. Biochim Biophys Acta. 1803, (6), 673-683 (2010).
  6. Kressler, D., Roser, D., Pertschy, B., Hurt, E. The AAA ATPase Rix7 powers progression of ribosome biogenesis by stripping Nsa1 from pre-60S particles. J Cell Biol. 181, (6), 935-944 (2008).
  7. Hiraishi, N., Ishida, Y., Nagahama, M. AAA-ATPase NVL2 acts on MTR4-exosome complex to dissociate the nucleolar protein WDR74. Biochem Biophy Res Co. 467, (3), 534-540 (2015).
  8. Maserati, M., et al. Wdr74 is required for blastocyst formation in the mouse. PLoS One. 6, (7), e22516 (2011).
  9. Weinhold, N., Jacobsen, A., Schultz, N., Sander, C., Lee, W. Genome-wide analysis of noncoding regulatory mutations in cancer. Nat Genet. 46, (11), 1160-1165 (2014).
  10. Lo, Y. H., Romes, E. M., Pillon, M. C., Sobhany, M., Stanley, R. E. Structural Analysis Reveals Features of Ribosome Assembly Factor Nsa1/WDR74 Important for Localization and Interaction with Rix7/NVL2. Structure. 25, (5), 762-772 (2017).
  11. Lander, G. C., Saibil, H. R., Nogales, E. Go hybrid: EM, crystallography, and beyond. Curr Opin Struc Biol. 22, (5), 627-635 (2012).
  12. Putnam, C. D., Hammel, M., Hura, G. L., Tainer, J. A. X-ray solution scattering (SAXS) combined with crystallography and computation: defining accurate macromolecular structures, conformations and assemblies in solution. Q Rev Biophys. 40, (3), 191-285 (2007).
  13. Jaskolski, M., Dauter, Z., Wlodawer, A. A brief history of macromolecular crystallography, illustrated by a family tree and its Nobel fruits. FEBS J. 281, (18), 3985-4009 (2014).
  14. Zheng, H., et al. X-ray crystallography over the past decade for novel drug discovery - where are we heading next? Expert Opin Drug Dis. 10, (9), 975-989 (2015).
  15. Kikhney, A. G., Svergun, D. I. A practical guide to small angle X-ray scattering (SAXS) of flexible and intrinsically disordered proteins. FEBS Lett. 589, (19 Pt A), 2570-2577 (2015).
  16. Bernado, P., Mylonas, E., Petoukhov, M. V., Blackledge, M., Svergun, D. I. Structural characterization of flexible proteins using small-angle X-ray scattering. J Am Chem Soc. 129, (17), 5656-5664 (2007).
  17. Sheffield, P., Garrard, S., Derewenda, Z. Overcoming expression and purification problems of RhoGDI using a family of "parallel" expression vectors. Protein Expres Purif. 15, (1), 34-39 (1999).
  18. Doublie, S. Preparation of selenomethionyl proteins for phase determination. Methods Enzymol. 276, 523-530 (1997).
  19. Tropea, J. E., Cherry, S., Waugh, D. S. Expression and purification of soluble His(6)-tagged TEV protease. Methods Mol Biol. 498, 297-307 (2009).
  20. Wlodawer, A., Minor, W., Dauter, Z., Jaskolski, M. Protein crystallography for aspiring crystallographers or how to avoid pitfalls and traps in macromolecular structure determination. FEBS J. 280, (22), 5705-5736 (2013).
  21. Otwinowski, Z., Minor, W. Processing of X-ray diffraction data collected in oscillation mode. Macromolecular Crystallography, Pt A. 276, 307-326 (1997).
  22. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D. 66, (Pt 2), 213-221 (2010).
  23. Winn, M. D., et al. Overview of the CCP4 suite and current developments. Acta Crystallogr D. 67, (Pt 4), 235-242 (2011).
  24. Terwilliger, T. C., et al. Decision-making in structure solution using Bayesian estimates of map quality: the PHENIX AutoSol wizard. Acta Crystallographica Section D. 65, 582-601 (2009).
  25. Emsley, P., Lohkamp, B., Scott, W. G., Cowtan, K. Features and development of Coot. Acta Crystallogr D. 66, (Pt 4), 486-501 (2010).
  26. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallogr D. 68, (Pt 4), 352-367 (2012).
  27. McCoy, A. J. Solving structures of protein complexes by molecular replacement with Phaser. Acta Crystallogr D. 63, (Pt 1), 32-41 (2007).
  28. McCoy, A. J., et al. Phaser crystallographic software. J Appl Crystallogr. 40, (Pt 4), 658-674 (2007).
  29. Dyer, K. N., et al. High-throughput SAXS for the characterization of biomolecules in solution: a practical approach. Methods Mol Biol. 1091, 245-258 (2014).
  30. Forster, S., Apostol, L., Bras, W. Scatter: software for the analysis of nano- and mesoscale small-angle scattering. J Appl Crystallogr. 43, 639-646 (2010).
  31. Petoukhov, M. V., et al. New developments in the ATSAS program package for small-angle scattering data analysis. J Appl Crystallogr. 45, 342-350 (2012).
  32. Konarev, P. V., Volkov, V. V., Sokolova, A. V., Koch, M. H. J., Svergun, D. I. PRIMUS: a Windows PC-based system for small-angle scattering data analysis. J Appl Crystallogr. 36, 1277-1282 (2003).
  33. Svergun, D. I. Determination of the Regularization Parameter in Indirect-Transform Methods Using Perceptual Criteria. J Appl Crystallogr. 25, 495-503 (1992).
  34. Rambo, R. P., Tainer, J. A. Accurate assessment of mass, models and resolution by small-angle scattering. Nature. 496, (7446), 477-481 (2013).
  35. Petoukhov, M. V., Svergun, D. I. Global rigid body modeling of macromolecular complexes against small-angle scattering data. Biophys J. 89, (2), 1237-1250 (2005).
  36. Tria, G., Mertens, H. D., Kachala, M., Svergun, D. I. Advanced ensemble modelling of flexible macromolecules using X-ray solution scattering. IUCrJ. 2, (Pt 2), 207-217 (2015).
  37. Svergun, D., Barberato, C., Koch, M. H. J. CRYSOL - A program to evaluate x-ray solution scattering of biological macromolecules from atomic coordinates. J Appl Crystallogr. 28, 768-773 (1995).
  38. Schrödinger, LLC. The PyMOL Molecular Graphics System Version 1.8. Available from: https://pymol.org (2015).
  39. Pelikan, M., Hura, G. L., Hammel, M. Structure and flexibility within proteins as identified through small angle X-ray scattering. Gen Physiol Biophys. 28, (2), 174-189 (2009).
  40. Deller, M. C., Kong, L., Rupp, B. Protein stability: a crystallographer's perspective. Acta Crystallogr F. 72, (Pt 2), 72-95 (2016).
  41. Hinsen, K. Structural flexibility in proteins: impact of the crystal environment. Bioinformatics. 24, (4), 521-528 (2008).
  42. Shtykova, E. V., et al. Structural analysis of influenza A virus matrix protein M1 and its self-assemblies at low pH. PLoS One. 8, (12), e82431 (2013).
  43. Mallam, A. L., et al. Solution structures of DEAD-box RNA chaperones reveal conformational changes and nucleic acid tethering by a basic tail. Proc Natl Acad Sci U S A. 108, (30), 12254-12259 (2011).
  44. Papaleo, E., et al. The Role of Protein Loops and Linkers in Conformational Dynamics and Allostery. Chem Rev. 116, (11), 6391-6423 (2016).
  45. Rozycki, B., Boura, E. Large, dynamic, multi-protein complexes: a challenge for structural biology. J Phys Condens Matter. 26, (46), 463103 (2014).
  46. Schlundt, A., Tants, J. N., Sattler, M. Integrated structural biology to unravel molecular mechanisms of protein-RNA recognition. Methods. 118, 119-136 (2017).
  47. Thompson, M. K., Ehlinger, A. C., Chazin, W. J. Analysis of Functional Dynamics of Modular Multidomain Proteins by SAXS and NMR. Methods Enzymol. 592, 49-76 (2017).
X-ışını kristalografisi Nsa1 <em>S. Cerevisiae</em> üzerinden yapılandırılmamış bölgelerinde modellemek için küçük açı X-Ray saçılma ile birleştirerek
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Lo, Y. H., Pillon, M. C., Stanley, R. E. Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae. J. Vis. Exp. (131), e56953, doi:10.3791/56953 (2018).More

Lo, Y. H., Pillon, M. C., Stanley, R. E. Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae. J. Vis. Exp. (131), e56953, doi:10.3791/56953 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter