Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Cancer Research

Detectie van een CDH1 zeldzame Transcript Variant in vers bevroren maagkanker weefsels door Chip gebaseerde digitale PCR

doi: 10.3791/57066 Published: February 5, 2018

Summary

Het manuscript beschrijft een chip gebaseerde digitale PCR assay om te ontdekken een zeldzame CDH1 transcript variant (CDH1a) in normale vers bevroren en tumor weefsels verkregen van patiënten met maagkanker.

Abstract

CDH1a, een niet-canonieke transcript van de CDH1 -gen, is gebleken dat moet worden uitgedrukt in sommige cellijnen van maagkanker (GC), terwijl het is afwezig in normaal maagslijmvlies. Onlangs ontdekt we CDH1a transcript variant in vers bevroren tumor weefsels verkregen van patiënten met GC. De uitdrukking van deze variant in weefselsteekproeven werd onderzocht door de chip gebaseerde digitale PCR (dPCR) hier gepresenteerde benadering. dPCR biedt de mogelijkheid voor een nauwkeurige, robuuste en zeer gevoelige meting van nucleïnezuren en wordt steeds meer gebruikt voor vele toepassingen in verschillende velden. dPCR is geschikt voor het opsporen van zeldzame doelstellingen; dPCR biedt bovendien de mogelijkheid voor absolute en precieze kwantificering van nucleïnezuren zonder de noodzaak voor kalibratoren en standaard curven. In feite, verrijkt de reactie partitionering het doel van de achtergrond, die versterking efficiëntie en tolerantie voor remmers worden. Deze kenmerken maken dPCR een optimale tool voor de detectie van de zeldzame transcript van CDH1a .

Introduction

Het CDH1 -gen codeert voor E-cadherine, een belangrijke factor die betrokken zijn bij het onderhoud van de normale maag epitheel via de regulering van de cel adhesie, overleving, proliferatie en migratie1. Verlies van E-cadherine eiwitten als gevolg van schadelijke germline of somatische wijzigingen van CDH1 is gekoppeld aan de ontwikkeling van GC2,3. Niet-canonieke afschriften die voortvloeien uit intron 2 van het gen hebben ook zijn veronderstelde om te spelen een rol in de maag carcinogenese4,5. In het bijzonder, een dergelijke transcript, CDH1a, is aangetoond moet worden uitgedrukt in GC cellijnen maar afwezig is uit de normale maag-4. We onlangs ontdekt CDH1a in GC weefselmonsters van GC patiënten met chip gebaseerde dPCR5. dPCR werd gebruikt om te evalueren, voor het eerst, de aanwezigheid van het CDH1a gene transcript in intestinale GC en in normale weefsel.

De gouden standaard methode om te bepalen van genexpressie is kwantitatieve PCR in real time (qPCR). Echter de resulterende gegevens kunnen soms variabele en van slechte kwaliteit, vooral wanneer het niveau van de doelgroep in de steekproef is laag. Deze variabiliteit kan worden veroorzaakt door verontreinigingen, die remming van polymeraseactiviteit en primer gloeien, wat leidt tot niet-specifieke versterking en concurrerende kant reacties6.

Hoewel de biochemische basisprincipes van dPCR vergelijkbaar met die van qPCR zijn, dPCR toont enkele voordelen, waardoor voor zeer nauwkeurige metingen van genomic DNA (gDNA) / complementaire DNA (cDNA) moleculen. Inderdaad, dPCR is een eindpunt reactie die is gebaseerd op de geijkte partitioneren van een monster in duizenden wells, zodat elk goed nul of een één doelmolecule bevat. Versterking vervolgens treedt alleen op in de putjes met een kopie van de doelgroep en wordt aangegeven door een fluorescerende signaal. Het absolute aantal doel moleculen in de oorspronkelijke steekproef kan vervolgens worden berekend door het bepalen van de verhouding van positief naar totale partities met behulp van de binomiale Poisson statistieken7.

Bovendien, de techniek van de dPCR elimineert de noodzaak voor het uitvoeren van een standaard curve en dus de bijbehorende bias en variabiliteit, waardoor een directe kwantificering van de doelstellingen van de8,9; het produceert meer nauwkeurige en reproduceerbare resultaten onafhankelijk van contaminanten en efficiëntie toe te schrijven aan zijn hoge tolerantie voor remmers10; het is meer gevoelig en specifiek zijn dan qPCR, en is dus een betrouwbare methode voor de detectie van een zeldzame doel. Tot slot, het partitioneren van het monster in meerdere reacties vermindert de competitie met achtergrond moleculen en verbetert de limiet van Doelsector Detectie, versterking mogelijk te maken en het vergemakkelijken van de detectie van afzonderlijke moleculen van gDNA/cDNA6 . De detectie en kwantificering van nucleic zuren door chip gebaseerde dPCR is steeds meer toegepast als u wilt kopiëren van nummer variatie, kwantificering van DNA fragmenten en mutatie analyseert11,12,13, gegeven de precisie en lage materiaal ingang eis van de methode. Bovendien, heeft dPCR onlangs zijn geïntegreerd in de analyse van beide microRNAs14 en gene afschriften5,15.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Het protocol volgt de richtsnoeren van de ethische commissie voor het eerste menselijke onderzoek.

Opmerking: Deze procedure is speciaal ontworpen voor de detectie van een laag aantal cDNA moleculen in vers bevroren weefsels. De weefselsecties zijn gesneden op droog ijs, terwijl nog steeds bevroren, uit eerder gevalideerde patiënt afkomstige maag tumor of normale weefselmonsters.

1. RNA isolatie en zuivering

  1. RNA extractie
    Opmerking: RNA isolatie wordt uitgevoerd onder de motorkap met behulp van een specifiek product (Zie Tabel van materialen). Echter, een verscheidenheid van isolatie kits zijn commercieel verkrijgbaar.
    1. Meng 50-100 mg van fijn gesneden vers bevroren weefsel monster in een 1,5 mL-buis met 1 mL van het RNA isolatie reagens en vortex krachtig voor 15 s. Incubate de buizen bij-80 ° C's nachts.
    2. Incubeer de buis het monster bij kamertemperatuur voor 5 min en mix bevattende vortexing voor 15 s.
    3. Houd de buis op ijs, voeg 200 µL van chloroform en vortex krachtig gedurende 15 s.
    4. Incubeer de buizen bij kamertemperatuur voor 60 s en centrifuge op 12.000 x g gedurende 15 minuten staan bij 4 ° C.
    5. Overdracht van de waterfase in een tube van 1,5 mL en voeg toe 20 µg van glycogeen.
      Opmerking: Het is belangrijk om zorgvuldig te voorkomen dat de interfase of organische laag om de verontreiniging verminderen.
    6. Voeg 500 µL van isopropanol, omkeren van de buis om te mengen en incubeer op ijs gedurende 10 minuten.
    7. Centrifugeer de buis bij 12.000 x g gedurende 15 min bij 4 ° C te precipiteren van RNA.
      Opmerking: RNA zal in een gel-achtige pellet op de zijkant en onderkant van de buis, vaak onzichtbaar na het centrifugeren aanwezig zijn.
    8. Verwijder het supernatant zonder verstoring van de neerslag en wassen met 1 mL van 75% ethanol door pipetteren.
    9. Centrifugeer de buis bij 7.500 x g gedurende 5 min bij 4 ° C en verwijder de bovendrijvende vloeistof zonder de pellet te verstoren.
    10. Laat de pellet drogen totdat het precipitaat transparant wordt en los het dan op in 50 µL RNase-gratis water.
    11. Het bevriezen van de monsters bij-80 ° C ten minste 's nachts vóór kwantificering.
  2. Eliminatie van genomic DNA en RNA zuivering
    Opmerking: Een DNase spijsvertering stap, gevolgd door een kolom gebaseerde RNA zuivering, wordt aanbevolen voor analyses van lage-overvloed doelen om te verteren contaminerende DNA.
    1. Los van het gelyofiliseerd DNase ik (1.500 Kunitz eenheden) in 550 µL van RNase-vrij water met een injectiespuit, meng zachtjes door het omkeren van de flacon, en de gereconstitueerde stockoplossing in aliquots verdelen.
    2. Overdracht van de berekende hoeveelheid monster met 15 µg RNA in een tube 1,5 mL, 10 µL van de DNase spijsvertering buffer uit de kit (vermeld in Tabel of Materials), 2,5 µL van DNase ik stockoplossing en RNase-gratis water 100 µL. Incubate bij kamertemperatuur gedurende 10 minuten.
    3. Voeg 350 µL van weefsel lysis buffer (Zie Tabel van materialenuit de kit) en meng door pipetteren.
    4. Voeg 250 µL van 100% ethanol en meng door pipetteren.
    5. Overdracht van het gehele volume (700 µL) in een nieuwe kolom van de spin en centrifugeer bij 12.000 x g gedurende 15 s.
    6. Breng het filter in een nieuwe collectie buis, 500 µL van 80% ethanol toevoegen aan de kolom en de centrifuge op 12.000 x g gedurende 2 minuten.
    7. Open het deksel van de spin kolom en centrifuge op 12.000 x g gedurende 5 minuten met een nieuwe collectie buis te drogen van het filter; Breng het filter aan een 1,5 mL-buis.
    8. 14 µL van RNase-gratis water rechtstreeks toevoegen aan de kolom filter en centrifuge op 12.000 x g voor 1 min.
    9. Houd de monsters op ijs en overgaan tot kwantificering met behulp van 2 µL van het monster op een bank-top spectrofotometer of RNA bij-80 ° C bewaren tot gebruik.

2. cDNA synthese

  1. Plaats 1000 ng van RNA, 4 µL van master mix, 1 µL van reverse-transcriptase en RNase-gratis water tot een eindvolume van 20 µL in een steriele PCR-buis. Meng voorzichtig en spin naar beneden.
  2. Incubeer de mix in een thermische cycler, toepassing van de volgende voorwaarden: 5 min bij 25 ° C, 30 min op 42 ° C, 5 min op 85 ° C.
  3. De buizen kort centrifugeren en gaat u verder met de analyse van de dPCR of bewaren bij-20 ° C totdat het nodig is.

3. digitale PCR reactie instellen

  1. dPCR reactie mix en proef de voorbereiding
    1. Ontdooi de master mix en de test bij kamertemperatuur gedurende ten minste 20 minuten.
    2. Verdun de cDNA monsters tot een concentratie van 300 ng in 6 µL van water.
    3. Zachtjes vortex de master mix en de mix in een steriele buis met 8,7 µL van master mix, 0.87 µL van de CDH1a aangepaste ontworpen assay primer en 1,83 µL van nuclease-gratis water voorbereiden een eindvolume van 11.4 µL.
      Opmerking: Zie de Tabel van materialenvoor CDH1a aangepaste ontworpen assay primer details.
    4. 11.4 µL van het mengsel bereid overbrengen in het monster verdunde cDNA, meng zachtjes en kort centrifugeren.
      Opmerking: Volumes bevatten 20% teveel om volume verlies van pipetteren te compenseren. De mix voorbereiden op alle monsters en een sjabloon oncontroleerbaar (NTC).
  2. Voorbereiding van de chip
    Opmerking: Voor optimale resultaten laden de chips zo spoedig mogelijk.
    1. Sluit de lader chip en wacht totdat het indicatorlampje groen.
    2. Verwijder de dop van de immersie vloeistof spuit door het voorzichtig terugtrekken van de plunjer 1-2 mm en het vrijgeven van het om deze stap te vergemakkelijken, en te vervangen door een tip.
    3. Neem een nieuwe chip en neem nota van de code die is geschreven op het deksel te koppelen aan het monster.
    4. Houd het deksel zorgvuldig aan haar zijde, schil weg de beschermende folie, en plaats het deksel met de kleverige gezicht omhoog in de juiste richting.
    5. Zorgvuldig halen van een chip, verzorging niet te raken van het interne gedeelte, en het op het nest van de chip in de juiste positie te laden door op te drukken beneden de hendel te openen van de klem.
    6. Een nieuw mes van het laden op de lader laadt en duw voorzichtig om ervoor te zorgen dat er stevig op zijn plaats.
    7. Breng 14,5 µL van de dPCR reactie mix op het laden-blad zonder luchtbellen of afbuigspiegel het blad, na het indrukken van welke de zwarte knop om te verdelen het volume op de chip te laden.
    8. Gebruiken de immersie vloeistof spuit voor het overbrengen van ongeveer 20 druppels op het oppervlak van de chip verzorgen niet te raken het oppervlak met de tip.
      Opmerking: Het is belangrijk ter dekking van het gehele oppervlak zonder het morsen van vloeistof over de randen.
    9. Draaien van de arm van de lader om de deksel komen in contact met de chip en druk naar beneden voor 15 s.
    10. Druk op de knop van het deksel vrij te geven van de chip en de arm terug te keren naar zijn standpunt.
    11. Houden van de samengestelde chip op een hoek van 45° en zorgvuldig afzien van de immersie vloeistof met de spuit via de poort van de opvulling, draaien de chip iets naar zorg ervoor dat er geen luchtbellen en verwijder alle overtollige vocht met een steriel doekje.
    12. Zegel van het geval van de chip door voorzichtig peeling weg het label bovenop de deksel van de chip en de pers over de haven van de opvulling voor ten minste 5 s.
    13. Bewaren de chip in het donker tot klaar om te laden in de thermische cycler.
      Opmerking: Er is bereid chips dient binnen 2 uur.
  3. dPCR-reactie
    1. Open het deksel en installeer de adapters naar beide blokken, zelfs wanneer een enkel vriesblok wordt gebruikt.
    2. Plaats de fiches op het monster blok in de juiste positie.
      Opmerking: De vulling poort moet gericht zijn op de voorkant van de thermische cycler in een verhoogde positie om eventuele luchtbellen te zweven naar de top zonder verstoring van het venster van de chip. Gebruik lege chips naar het evenwicht tussen de twee blokken.
    3. Leg de thermische pad op het blok van de steekproef te volledig dekken de chips.
    4. Sluit het deksel en de PCR uitvoert, de volgende voorwaarden toe te passen van het begin: Houd bij 96 ° C gedurende 10 minuten; 45 cycles van 60 ° C gedurende 2 minuten en 98 ° C voor 30 s; Houd bij 60 ° C gedurende 2 min; Houd bij 4 ° C. Uitschakelen van de thermische cycler en ontdooien van de chips bij kamertemperatuur gedurende ten minste 10 minuten.
      Opmerking: Chip analyse moet worden uitgevoerd binnen één uur.
  4. Chip analyse
    1. Open het deksel van het instrument en verwijder de thermal pads en de chips uit de adapters verwijderen.
      Opmerking: Bewaar de chips in een donkere, schone locatie tot analyse.
    2. Reinig het oppervlak van de chip met isopropanol en een steriel doekje.
      Opmerking: Inspecteer elke spaander voor lekken of potentiële problemen.
    3. Steek de USB in de detector systeem de gegevens op te slaan.
    4. Open de lade van de spaander van de detector systeem, laden de chip gezicht-up in de juiste positie en sluit de lade.
    5. Wacht 30 s voor verwerking, dan verwijderen van de chip en de volgende dia invoegen.
    6. Wacht tot de analyse te worden voltooid voor alle verwerkte chips dan de USB in een computer om de bestanden plaatst.
      Opmerking: De totale tijd voor analyse is ongeveer 2 tot 3 min/chip.

4. data-analyse en interpretatie

  1. Verbinden met de cloud-gebaseerde softwareplatform dat nodig is voor het uitvoeren van alle downstream analyses.
  2. Een project maken en importeren van alle gegevensbestanden van de chips van belang.
  3. Voer de naam van het monster; Selecteer de kleurstof en assay gebruikt in het tabblad "Define Chips".
  4. Bepalen of de chip door het visualiseren van het in het tabblad "Toetsing gegevens" controleren hoe grondig het monster op de chip was geladen en hoeveel gegevenspunten zijn beoordeelbare aanvaardbaar is.
    Opmerking: Verwerpen chips met minder dan 13.000 beoordeelbare gegevenspunten.
  5. Ga naar de scatterplot van de geselecteerde chip aan de rechterkant van het scherm; een drempel van 6.000 voor de fluoresceïne amidite (FAM) verslaggever kleurstof signalen (y-as) van toepassing op alle de chips.
    Opmerking: De drempel instellen kan variëren aan de hand van de testen gebruikt.
  6. Verwijder geen dubieuze positieve signalen om te voorkomen dat vals-positieve resultaten door het selecteren van de relatieve plek op de scatter plot met behulp van het gereedschap lasso en op "onbepaald" te drukken. Alle resterende positieve plekken wijzen op de aanwezigheid van cDNA exemplaren van de zeldzame doelstelling geanalyseerd.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Met behulp van de procedure die hier, wij gecontroleerd voor de uitdrukking van de zeldzame transcript variant CDH1a in maag vers bevroren weefsels. De analyse door dPCR werd uitgevoerd op 21-gepaarde normaal en kanker weefselsteekproeven en in 11 extra tumor monsters. CDH1a was in 15 van 32 (47%) tumoren, worden opgespoord, terwijl geen normale weefselsteekproeven de aanwezigheid van deze zeldzame transcript5 toonde. In onze analyse, chips met minder dan 13.000 gegevenspunten verworpen, zoals chips met niet-homogene laden waren. Figuur 1 toont een chip bekijken voor zowel beoordeelbare (figuur 1A) en niet-beoordeelbare (figuur 1B, C) monsters. In het geval van de laatste, moet de chip worden verwijderd als gevolg van de aanwezigheid van meerdere bubbels (figuur 1B), een enkele grote zeepbel (Figuur 1 c), of als gevolg van een onvoldoende aantal gegevenspunten boven drempel (figuur 1B). Deze monsters moeten opnieuw worden uitgevoerd om interpreteerbare resultaten te verkrijgen. Met betrekking tot de scatterplot verstrekt door de software (Figuur 2), toont het normaal de signalen van de FAM verslaggever kleurstof (y-as) tegen signalen van de VIC (fabrikant merkgebonden) verslaggever kleurstof (x-as). De gegevenspunten gepresenteerd op de scatterplot zijn kleurgecodeerde, en hier, we alleen gevisualiseerd de FAM verslaggever kleurstof signalen in het blauw (figuur 2A), met vermelding van de putjes waarin het doel werd versterkt. Deze signalen bevinden zich dichter aan de y-as en verder van de oorsprong van de plot. De tweede kleur gezien op het perceel is geel en is een indicatie van de putjes waarin geen versterking is opgetreden. Een betrouwbare drempel voor de positieve signalen die was ingesteld en toegepast op alle de chips om te voorkomen dat vooringenomenheid van de oproep. De geselecteerde drempel was hier, 6.000 op basis van het aantal signalen waargenomen voor de verschillende chips in deze experimenten. CDH1a cDNA kopieën (blauwe signalen) werden gevonden in een aantal monsters van de tumor, tonen een duidelijk verschil in amplitude van negatieve signalen (figuur 2A). Daarentegen werden geen signalen boven de geselecteerde drempel gevonden in monsters negatief voor CDH1a afschrift, dat wil zeggen, alle normale weefselsteekproeven en sommige monsters van de tumor (figuur 2B). Geen positieve signalen werden ook ontdekt in de NTC waarin water is toegevoegd in plaats van cDNA, vandaar een negatieve controle voor de dPCR reactie (figuur 2C) bijeenkomen.

Een fijne chip analyse moet worden toegepast op de filter de lage kwaliteit gegevenspunten en elimineert het risico van meervoudige resultaten. Dit werd gedaan door de chip om te bepalen van de exacte locatie van het bijbehorende positieve signaal bekijken: als het blauwe signaal bevindt zich aan de zeer grenzen van de chip (figuur 3A) of rond bubbels (figuur 1B), het signaal is ontheven van de analyse . Om verder te voorkomen dat het risico van valse positieven, signalen boven 6000 voor het kanaal van de FAM en aan de rechterkant van het perceel werden beschouwd als waarschijnlijk aspecific en zijn dus uitgefilterd, hoewel ze waren gelokaliseerd ruim binnen de chip (figuur 3B). Op deze manier een steekproef wordt als positief beschouwd voor de uitdrukking van de zeldzame transcript, CDH1a, zelfs als het toont een interne versterking signaal, zolang dat signaal aan de bovengenoemde voorwaarden voldoet.

Figure 1
Figuur 1 . Representatieve beoordeelbare en niet-beoordeelbare chips. De blauwe stippen zijn putten waarin de tekst van de CDH1a werd versterkt; de gele stippen zijn putjes waarin geen versterking is opgetreden; de witte stippen zijn lege wells. Bovenstaande drempel gegevenspunten worden aangegeven onder elke chip. (A) een beoordeelbare chip met blauw signalen gelokaliseerd ruim binnen de grenzen van de chip. (B) een niet-beoordeelbare chip met bovenstaande drempel minder dan 13.000 gegevenspunten. (C) A niet-beoordeelbare chip met een grote zeepbel. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 . Representatieve digitale PCR scatter percelen van CDH1a expressie. Percelen verbeelden signalen van de FAM verslaggever kleurstof (y-as) tegen signalen van de VIC verslaggever kleurstof (x-as). De blauwe stippen zijn CDH1a positieve expressie signalen, terwijl de gele stippen de signalen "Geen versterking zijn". (A) CDH1a-positief monster. (B) CDH1a-negatief monster. (C) geen controle (NTC) van de sjabloon weergegeven: nul CDH1a expressie. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3 . Representatieve boete-chip analyse van digitale PCR spreiding percelen. Aan de linkerkant is de weergave van de chip met de signalen van belang is ingezoomd in een zwart vierkant, terwijl aan de rechterkant de bijbehorende scatterplot. (A) een blauwe signaal gelokaliseerd op het juiste gedeelte van het perceel, maar aan de grens van de chip. (B) drie blauwe signalen gemarkeerd in het grijs gelokaliseerd aan de rechterkant van het perceel, maar binnen de chip. Klik hier voor een grotere versie van dit cijfer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

dPCR werd oorspronkelijk ontwikkeld voor DNA moleculaire metingen10,11,12,13 en op tijd die werd deze technologie aangepast voor de kwantificering van microRNAs en RNA afschriften5, 14,,15. In dit protocol hebben we de lijst van toepassingen tot opsporing van zeldzame afschriften afgeleid van vers bevroren weefselsteekproeven uitgebreid. Voor dat doel gebruikt wij een vrij hoog bedrag van cDNA (300 ng). Hoewel dit bedrag niet de maximale hoeveelheid die kan worden gebruikt in dPCR, was het voldoende voor het opzetten van gestandaardiseerde condities om te vergelijken alle onze voorbeelden. Door het vaststellen van de drempel van de signaal bloeien op 6.000 en houd rekening met de locaties van positieve versterking signalen op de chip- en scatter perceel, ontdekt wij met succes deze zeldzame doelstelling in maag tumor weefselmonsters.

Door dPCR, we kunnen niet absoluut het kwantificeren van CDH1a, te wijten aan een erg laag bedrag van de doelgroep, maar wij op betrouwbare wijze de aanwezigheid/afwezigheid van deze zeldzame transcript kan beoordelen. Inderdaad, de kwantitatieve aard van deze techniek wordt beperkt door het aantal doelstellingen in de geanalyseerde monsters7aanwezig. Van belang zijn blijft de techniek zelf vrij duur en tijd-intensief. Dus, wanneer de analyse van de talloze voorbeelden en/of meerdere doelen vereist is, alternatieve technieken moeten worden overwogen7,8.

Dat gezegd zijnde, biedt dPCR ongetwijfeld de ultieme platform voor gevoelige meting en kwantificering van nucleïnezuren, zoals het verbetert de nauwkeurigheid en reproduceerbaarheid met betrekking tot qPCR7,8. Bovendien, het kan worden beschouwd als de enige methode beschikbaar voor het analyseren van de genexpressie van lage-overvloedig nucleic zuren die in de buurt van de grens van qPCR gevoeligheid6.

Het protocol hier beschreven kan worden aangepast aan de RNAs van alle weefsels, waardoor de detectie van zeldzame doelstellingen, zoals in onze studie. Bovendien kan de bepaling op absolute kwantificering van afschriften worden uitgebreid. In dergelijke gevallen moet het aantal kopieën/µL gerapporteerd door het instrument voor een monster gewoon worden vermenigvuldigd met het volume van geladen reactie en gedeeld door het aanvankelijke bedrag van cDNA. Om te overwinnen variabiliteit geproduceerd door omgekeerde-transcriptie, gen-specifieke kalibratoren moeten worden opgenomen, indien mogelijk6. Op zoek naar de toekomst, houdt dPCR aanzienlijke mogelijkheden om de goudstandaard platform, niet alleen voor de detectie van de zeldzame reeks, maar ook zeldzame mutatie detectie en exacte kopie nummer kwantificering7. Dit is vooral relevant in genetische mozaïcisme, zo goed zoals in kankeronderzoek waar tumor heterogeniteit kan invloed hebben op de klinische uitkomst van een patiënt en reactie op behandeling.

Vanuit het praktische oogpunt, bij het opzetten van het protocol van de dPCR zijn er meerdere kritische stappen die moeten worden benadrukt. Eerst en vooral, de mix van de reactie met de juiste hoeveelheid cDNA op basis van het doelniveau voor expressie die worden verwacht, moet worden overgedragen met grote zorgvuldigheid in het blad van de laden dus niet te maken van luchtbellen, die met het monster homogeniteit interfereren kunnen. Bovendien, moet het mes zich eerst op de juiste manier; worden geplaatst anders kan het resulteren in een ongelijke monster distributie. Bovendien moet de voldoende coating met immersie vloeistof en nauwkeurige afdichting van het deksel altijd te worden uitgevoerd. Wat betreft de chip verwerking en analyse is het belangrijk te weten van de mogelijkheid van accumulatie van condensatie op de chip; in zulk een scenario, moet de chip opnieuw ingewreven met isopropanol en opnieuw geanalyseerd. Bovendien, als dPCR is gebaseerd op Poisson statistieken, een minimum aantal beoordeelbare gegevens punten (> 10.000) moet aanwezig zijn op de chip, anders het monster opnieuw moet worden uitgevoerd. Tenslotte, voor lage doel kopie detectie experimenten, een kritische storende factor zou kunnen worden de signal-to-noise verhouding, maar een betrouwbare drempel positionering kan helpen bij het identificeren van echte positieve signalen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs melden geen belangenconflicten voor dit werk.

Acknowledgments

De auteurs bedank Gráinne Tierney voor redactionele ondersteuning.

Materials

Name Company Catalog Number Comments
TRIazol Reagent Thermo Fisher Scientific 15596018
Glycogen 20 mg/ml ROCHE 10901393001
RNeasy MinElute Cleanup kit QIAGEN 74204
iScript cDNA Synthesis kit BioRad 1708891
QuantStudio 3D Digital PCR Master Mix v2 Thermo Fisher Scientific A26358
CDH1a IDT custom designed assay Integrated DNA Technologies (IDT) NA F) GCTGCAGTTTCACTTTTAGTG
(R) ACTTTGAATCGGGTGTCGAG
(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/
[dPCR optimized assay concentrations: 900 nM (F),        900 nM (R), 250 nM (P)]
QuantStudio 3D Digital PCR 20K Chip Kit v2 Thermo Fisher Scientific A26316
Heraeus Biofuge Fresco Thermo  Scientific 75002402
Thermocycler (Labcycler) Sensoquest 011-103
GeneAmp PCR System 9700 Thermo Fisher Scientific N805-0200
Dual Flat Block Sample Module Thermo Fisher Scientific 4425757
QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700 Thermo Fisher Scientific 4486414
QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler Thermo Fisher Scientific 4485513
QuantStudio 3D Digital PCR Chip Loader Thermo Fisher Scientific 4482592
QuantStudio 3D Digital PCR Instrument with power cord Thermo Fisher Scientific 4489084

DOWNLOAD MATERIALS LIST

References

  1. van Roy, F., Berx, G. The cell-cell adhesion molecule E-cadherin. Cell Mol Life Sci. 65, (23), 3756-3788 (2008).
  2. Carneiro, P., et al. E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions. FEBS Lett. 586, (18), 2981-2989 (2012).
  3. Corso, G., et al. Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer. J Clin Oncol. 31, (7), 868-875 (2013).
  4. Pinheiro, H., et al. Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis. Hum Mol Genet. 21, (19), 4253-4269 (2012).
  5. Abou Khouzam, R., et al. Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer. Oncotarget. 8, (12), 18811-18820 (2017).
  6. Taylor, S. C., Laperriere, G., Germain, H. Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data. Sci Rep. 7, (1), (2017).
  7. Basu, A. S. Digital Assays Part I: Partitioning statistics and digital PCR. SLAS Technol. 22, (4), 369-386 (2017).
  8. Huggett, J. F., Whale, A. Digital PCR as a novel technology and its potential implications for molecular diagnostics. Clin Chem. 59, (12), 1691-1693 (2013).
  9. Alikian, M., et al. RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia. Clin Chem. 63, (2), 525-531 (2017).
  10. Hoshino, T., Inagaki, F. Molecular quantification of environmental DNA using microfluidics and digital PCR. Syst Appl Microbiol. 35, (6), 390-395 (2012).
  11. Salvi, S., et al. Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer. Oncotarget. 7, (25), 37839-37845 (2016).
  12. Tessitore, M. V., et al. Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs. J.Transl.Med. 15, (1), (2017).
  13. Sho, S., et al. Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens. PLoS One. 12, (1), e0170897 (2017).
  14. Conte, D., et al. Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR. BMC Genomics. 16, 849 (2015).
  15. Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. Evaluation of digital PCR for absolute RNA quantification. PLoS One. 8, (9), e75296 (2013).
Detectie van een <em>CDH1</em> zeldzame Transcript Variant in vers bevroren maagkanker weefsels door Chip gebaseerde digitale PCR
Play Video
PDF DOI

Cite this Article

Molinari, C., Abou Khouzam, R., Salvi, S., Rossi, T., Ranzani, G. N., Calistri, D. Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR. J. Vis. Exp. (132), e57066, doi:10.3791/57066 (2018).More

Molinari, C., Abou Khouzam, R., Salvi, S., Rossi, T., Ranzani, G. N., Calistri, D. Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR. J. Vis. Exp. (132), e57066, doi:10.3791/57066 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter