Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

실험실 주택의 청록색 송사리 (Nothobranchius furzeri)에 대 한 프로토콜

doi: 10.3791/57073 Published: April 11, 2018

Summary

실험실 주택 터키석 송사리 집 고 효율적으로 개별 물고기의 수천 고용 표준 zebrafish 시설에 사용 하는 동일한 인프라는 중앙 집중식된 물 여과 시스템에서 확장할 수 있습니다. 여기 우리가 유지 보수 효율적 송사리 수 있도록 표준화 된 절차의 목록을 자세하게.

Abstract

실험적인 목적을 위해 사용 하는 비 모델 실험실 물고기에서 농업 관행의 개발은 크게 혜택 참조 물고기의 설립에서 모델 시스템, 제 브라와 메 다카. 최근 몇 년 동안, 신흥 물고기-청록색 송사리 (Nothobranchius furzeri)-노화와 생태의 생물학의 분야에서 연구 그룹의 성장 수에 의해 채택 되었습니다. 4-8 개월의 포로 생활 스팬,이 종 감 금에서 발생 하는 shortest-lived 척추 이며 노화 속도와 수명이 변경으로 이어질 수 있는--짧은 시간에에서 테스트 실험 개입을 과학적으로 지역 사회를 수 있습니다. 이 종, 미 발달 diapause, 특징의 독특한 생물학 주어 폭발적인 성적 성숙, 표시 형태학과 행동 성적인이 형태 성-그리고 그들의 상대적으로 짧은 성인 수명- 임시 농업 관행은 긴급 수요입니다. 이 프로토콜 허용 최적의 청록색 송사리 실험실 관리, 강력한 실험실 동물 모델로이 종 채택 하 사회 과학을 사용 하는 주요 축산 측정값 집합을 보고 합니다.

Introduction

그들의 짧은 생애 경 간 및 빠른 라이프 사이클을 감안할 때, 청록색 송사리를 유망한 새로운 모델 유기 체 생물학1,2,3로 급속 하 게 성장 하고있다. 이 종 한 teleost, 미 발달 diapause, 급속 한 성적인 성숙, 및 post-reproductive 수명 연장된 단계4,5의 구성에 대 한 고유한 라이프 사이클에 의해 특징입니다. 최근 작품은 포로 야생6,7에서이 종의 생물학 elucidating에 기여 했다. 청록색 송사리 짐바브웨, 모잠비크는 아프리카 사바나에 우기 동안 양식 계절 신선한 물 시체에 살고 있습니다. 건조 한 계절, 태아 건조 진흙 물 diapause 이라는 스트레스 저항 생활 단계 미 덕의 부재에 남아 있다.

이 종족에 대 한 유전자 지도 생성 된8,9, 그리고 최근에 그들의 게놈 시퀀스 및 조립10,11되었습니다. 여러 가지 타고 난된 실험실 물고기 종자를 개발 하 고 transgenesis 및 CRISPR/Cas9를 통해 편집 하는 게놈이이 종, 사실상 경쟁 실험실 척추 모델 유기 체 로 청록색 송사리를 홍보에 제공 되 12,,1314.

실험실 프로토콜 이미이 종15게시 되었습니다, 비록 현재 프로토콜에서 우리 개발 특히 노화 및 생존을 조사 연구 목적으로 실험 실험실 지침의 포괄적인 목록. 현재 프로토콜 연구원은 제 브라와 메 다카 축산에 이미 익숙한 키 조정의 최소 수를 채택 하 여 청록색 송사리 축산에 조예가 될 수 있습니다. 동시에이 프로토콜 번성 청록색 송사리 식민지를 필수 도구로 생선 농업에 사전 경험 없이 연구를 제공 합니다.

Protocol

물고기는 물 재순환 시스템에서 28 ° C에서 발생 하는 (물 매개 변수 참조), 10-20% 일일 물 처리와. 3 다른 탱크 크기 권장: 0.8 L, 2.8 L, 그리고 9.5 l. 각 탱크는 2 mL/s의 지속적인 물 흐름을 받습니다.

1. 시 약 준비 (재료에 포함 되지 않음)

참고: 아프리카 터키석 송사리 (Nothobranchius furzeri) 설립된 연구소 주식에서 제공 될 수 있습니다. 연례 송사리 건조 방지 배아 우편으로 발송 될 수 있다. 8-30 ° C의 온도 범위 내에서 배아를 우주선에 중요 하다.

  1. 물 1 g/L humic 산 시스템에 용 해 하 여 humic 산 (부 화) 솔루션을 준비 합니다. 오토 클레이 브 그리고 최대 10 주 동안 4 ° C에서 저장소.
  2. HUFA Artemia 농축 준비, HUFA 농축 소금물 새우 솔루션의 농도 500 µ L/L에서 매일 소금물 새우 hatcher를 추가 합니다.
  3. Methylene 청색 이전 압력가 시스템 물에서 재고 솔루션의 100 µ L/L를 용 해 하 여 메 틸 렌 블루 솔루션을 준비 합니다. Methylene 청색 빛에 민감한 때문에, 어두운 병에 솔루션을 유지 또는 호 일 커버. 실시간에 저장소
  4. 태아 부 화에 대 한 고체 기판으로 코코넛 섬유를 준비 합니다. 또는 사용 하는 필터 종이 (섹션 1.5 참조).
    1. 증류수와 presoak 코코넛 섬유입니다. 오토 클레이 브 그리고 5 주까지 4 ° C에서 저장소.
    2. 배아 전송의 날, 촉촉한 코코넛 섬유와 페 트리 접시를 준비 합니다.
    3. 코코넛 섬유 연기 후드와 불꽃, 효 모와 박테리아에 의해 오염 줄이기 위해 옆으로 직경 90 mm 페 트리 접시를 채우십시오.
    4. 살 균 티슈로 1 ㎝의 높이에 코코넛 섬유를 압축. 시키는 초과 물을 흡수 하는 종이 접시 위에 종이 수건을 눌러 코코넛 섬유에서 수 분의 대부분을 제거 합니다. 프레임, 금속 숟가락을 열 고 코코넛 섬유의 전체 표면에 아래로 누릅니다. 이 코코넛 섬유 곰 팡 이/세균 오염을 방지합니다.
  5. 태아 부 화에 대 한 고체 기판으로 필터 종이 준비 합니다.
    1. 배아 전송의 날, 90 mm 페 트리 접시에 맞는 필터 종이 디스크의 3 레이어를 놓습니다. 습도 유지 humic 산 솔루션의 5 mL를 추가 합니다.

2입니다. 번 식

  1. 청록색 송사리 스트레인 유지 보수에 대 한 번 식
    참고:이 프로토콜에 따라 성적 성숙에 도달입니다 ~ 4 주에 7-9 주 사이 후 해칭 및 통치 봉우리. 통치 주파수 및 식품 품질; 먹이에 따라 하는 것이 중요 따라서, 탱크 사육 당 하루 두 개 이상 feedings는 것이 좋습니다 배아 수율 (참조 섹션 5.6.) 인상
    1. 9.5 L 사육 탱크 설치. 시스템 물으로를 한 남자와 두 여성 물고기를 추가할 수 있습니다.
    2. 남성 아프리카 터키석 송사리 표시는 여성의 성희롱으로 이어질 수도, 짝짓기 하는 동안 지배 짝짓기 스트레스를 줄이고 생식 출력 향상을 여성 보다 약간 작은 신체 크기를 가진 남성을 선택 합니다. 6/7 주 된 암컷과 5 주 된 남성을 설정 합니다.
    3. ~ 2-3 cm의 최종 깊이 도달 하는 압력가 모래 플라스틱 용기 (10 x 10 x 5 cm)를 번 식 탱크의 중심에 모래 상자를 배치.
    4. 터키석 송사리 지속적으로 번 식 하 고 수확 배아 배아 부 화에 대 한에 일주일에 한 번 보자.
      참고: 모래 기판의 사용 중앙 집중식된 여과 시스템에 도전 포즈 하 고 나중에 다른 방법으로 대체 한다. 가능한 대안 zebrafish 사육 탱크의 사용 될 수 있습니다.
  2. Transgenesis에 대 한 번 식
    참고: 배아 주사에 사용할 1-셀-단계에서 동기화 하 고이에서는 그들은 수정 직후 수집.
    1. 주입 및 유전자 변형 라인의 세대에 대 한 사용 하 여 한 셀 단계 배아를 수확, 한 남자와 두 여성 물고기 (2.1와 같은.) 번 식 탱크를 설정 합니다.
    2. 2 일 전에 배아 컬렉션, 개별 탱크에서 남성 분리 하 고 성인 여성와 남성 시각적 접촉에서 유지.
    3. 컬렉션의 날, 사육 탱크에 남성과 모래 상자를 추가 하 고 2 시간에 대 한 산란 그들.

3. 배아 축산

  1. 배아 컬렉션
    참고: 배아 컬렉션 체질 및 모래 상자에서 배아를 수확 하 여 수행 됩니다. 정상적인 조건 하에서 각 모래 상자 30에서 200 배아에 있어야 합니다.
    1. 컬렉션의 날, 번 식 탱크에서 모래 상자를 제거 합니다. 스 트레이너 (~0.9 m m 변형 크기)으로 모래 상자를 비어와 시스템 물으로 린스. 이것은 압력가 마로 소독에 대 한 모래를 수집 하는 큰 탱크를 통해 행 해질 수 있다.
    2. 부분적으로 시스템 물에서 여과기 잠수함 그리고 부드럽게, 배아는 센터에서 그룹화 시키는 소용돌이.
    3. 10 mL 피 펫 파스퇴르와 배아를 수집 합니다.
    4. 90 mm 페 트리 접시 시스템 물 40 mL에 배아를 전송 합니다.
    5. 빛 stereomicroscope에서 페 트리 접시에 배아를 검사 하 고 그 파열된 chorion 및 손상의 징후를 제거.
    6. 배아 표백직접 진행 합니다.
      참고: 항상 잠재적인 크로스-스트레인 배아 오염을 방지 하기 위하여 물고기 스트레인 당 한 여과기를 사용 합니다.
  2. 표백 하는 태아
    참고: 배아 표백 미생물 오염 부 화 미디어에서 물고기 탱크에 존재를 방지할 수 있습니다.
    1. 표백, 이전 일회용 파스퇴르 피 펫을 사용 하 여 수집 된 배아를 포함 하는 배양 접시에서 시스템 물 제거.
    2. 방지 하려면 원치 않는 곰 팡이 및 세균 성장, 수집 된 배아를 갓된 H2O2 (압력가 마로 소독 시스템 물에 1 %v / v) 50 mL를 추가 합니다.
    3. 50 mL 해결책에 90 mm 페 트리 접시에서 낮은 속도로 5 분에 대 한 배아를 흔들어.
    4. H2O2 솔루션 일회용 파스퇴르 피 펫을 제거 하 고 세 번의 메 틸 렌 블루 솔루션 50 mL와 함께 5 분 대 한 배아를 씻어. 메 틸 렌 블루 솔루션을 제거 합니다.
    5. 배아를 H2O2 (압력가 마로 소독 시스템 물에 1 %v / v) 50 mL를 추가 하 고 5 분 동안 흔들어.
    6. H2O2 솔루션을 제거 하 고 세 번 50 mL 메 틸 렌 블루 솔루션 5 분 동안 세척.
    7. 동기 배아 개발, 90 mm 페 트리 접시에 메 틸 렌 블루 용액 40 mL 당 100 배아의 최대 밀도 증가에 28 ° C에 태아를 품 어.
      참고: 표백 솔루션에서 태아 외피를 확장 하지 않습니다. 이 계란 chorion에 손상을 하 고 태아 사망률을 증가 시킬 수 있습니다. 배아 표백 변경된 chorion 생리학 및 부 화 성공 귀 착될 수 있는 계란 chorion에 주요 물리 화학 변화를 일으킬 수 있습니다.
  3. Methylene 청색에서 태아 외피
    참고: 메 틸 렌 블루 용액에 액체 화 기생충의 성장을 방지 하 고 죽은 태아 및 unfertilized 계란의 탐지를 가능 하 게.
    1. 라이브 건강 한 배아의 생존에 영향을 주는 곰 팡이 및 세균 오염을 방지 하기 위해 페 트리 접시에서 (메 틸 렌 블루 블루 스테인드) 모든 죽은 태아를 제거 incubated 배아를 검사 합니다.
    2. 오래 된 메 틸 렌 블루 솔루션을 제거 하 고 신선한 솔루션으로 대체.
    3. 28 ° C 인큐베이터 (그림 1A)를 페 트리 접시를 반환 합니다. 7-10 일 안에, 개발된 배아 보이는 검은 눈을 보여 확인 하십시오. 코코넛 섬유 또는 필터 종이 고체 기판 매체 (그림 1B)에 이러한 배아를 전송.
    4. Methylene 청색에 미 개발된 태아를 유지, 매일 모니터링 하 고 일단 검은 눈을 개발 고체 기판 매체에 전송.
    5. 반복 단계 3.3.1-3.3.3 매일 배아 검은 눈을 볼 수 있다.
      참고: 메 틸 렌 블루에 배아의 지속적인 노출 성인 물고기 생리학에 장기적인 변화 유도 수 있습니다.
  4. 필터 종이 배아 전송
    참고: 청록색 송사리 배아는 자연 조건 업과 건조 기판에 개발할 수 있습니다. 또한, 건조 태아 외피 배아를 동기화 하 여 같은 날에 그들을 해치는 연구 가능 합니다.
    1. 개발된 태아 7-10 일 이내 검은 눈을 볼 수 있을 것 이다로 이전 준비 필터 종이 접시에 메 틸 렌 블루 솔루션에서 배아를 전송 일회용 파스퇴르 피 펫 또는 정밀한 곡선된 핀셋을 사용 합니다.
    2. 집게, 최대 90 m m 플레이트 (그림 1B) 당 100 배아와 태아 ~ 5 m m 떨어져 확산.
    3. 페 트리 접시 parafilm으로 밀봉.
    4. 2-3 주, 그들은 완전히 황금 홍 채를 개발 하 고 (그림 1C)을 부 화에 대 한 준비가 될 때까지 28 ° C에 태아를 품 어.
      참고:로 그들의 생존 능력을 극적으로 감소 될 것 이다 2 주에 이상에 대 한 준비-해치 배아의 부 화를 연장 하지 않습니다.
  5. 코코넛 섬유를 배아 전송
    참고: 압력가 마로 소독, 살 균 코코넛 섬유 (또는 유기 물 이끼) 사용할 수 있습니다 유효한 대안 매체로 서 고체 기판 부 화에 대 한.
    1. 준비-사용 코코넛 섬유 접시에 메 틸 렌 블루 솔루션에서 배아를 전송 하는 일회용 파스퇴르 피 펫 또는 정밀한 곡선된 핀셋을 사용 합니다.
    2. 태아 ~ 5 m m 간격, 90 m m 플레이트 (그림 1B) 당 100 배아까지 확산.
    3. 페 트리 접시 parafilm으로 밀봉.
    4. 2-3 주, 그들은 완전히 황금 홍 채 ( 그림 1C)에 예를 들면 개발 될 때까지 28 ° C에 태아를 품 어.
      참고: 장기 저장 (최대 1 년)에 대 한 전송 3 일 게시물 컬렉션에서 배아 메 틸 렌 블루 솔루션에서 17 ° c.에 고체 기판 접시에 그들은 검은 눈을 개발할 때까지 태아를 품 어.

4. 부 화 청록색 송사리

참고: 청록색 송사리 배아 수 수 성공적으로 부 화 humic 산 성 솔루션14에.

  1. 정밀한 곡선된 핀셋을 사용 하 여, 전송 신중 하 게 50-100 4 ° c.에 humic 산 성 솔루션으로 가득 부 화 상자에 배아 개발 시스템 물에 1 g/L humic 산 humic 산 성 해결책에 의하여 이루어져 있다. 오토 클레이 브 그리고 최대 10 주 동안 4 ° C에서 저장소. 모든 배아 완전히 몰입 하는 것을 확인 하십시오. Humic 산 성 솔루션은 얕은, 하지 2cm 보다 깊은 해야 합니다.
    참고: humic 산 성 솔루션의 낮은 온도 향상 부 화 하며 솔루션에 배아의 완전 한 침수 동기화 된 해칭
  2. 28 ° C 해칭 부 화기로 부 화 상자를 놓습니다. 커버 뚜껑 부 화 상자. 공급 하기 위해 충분 한 통 기 통풍, 공기 공급 배관에 의해 부 화 상자를 연결 합니다.
    참고:는 인큐베이션 기간 동안 충분 한 통 기 통풍 가스 방광을 채울 수 없는 튀김의 높은 비율에 있는 결과 ("배꼽-슬라이더" 표현 형, 섹션 5.1에서에서 참고)
  3. 해칭, 후 일에서 부 화 상자에서 적절 한 수 질을 유지 하기 위해 추가 압력가 시스템 물 1: 1의 비율에 하루에 한 번 2 cm의 최종 깊이 유지.
  4. 단단한 기판에 다시 깐된 배아를 전송 하 고 일주일 후 부 화 시도.
    참고: 해칭, 청록색 송사리는 쉽게 이해 하 고 살아있는 음식을 섭취. 최적의 성장에 대 한 초과 갓 부 화 소금물 새우 (Artemia 살 리 나) 하루에 두번 튀김 먹이. 전체 포만의 표시는 각 먹이의 10-15 분 후 프라이의 오렌지 색 인체를 이다. 초과, 먹지 고 분해 소금물 새우 매일 파스퇴르 피 펫을 사용 하 여 밖으로 사이 펀.

5. 청소년 및 성인 물고기를 양육

  1. 5 일 후 부 화, 청소년 물 재순환 시스템으로 이동 합니다. 일회용 플라스틱 펫 (또는 플라스틱 숟가락), 신중 하 게 사용 하 여 0.8 L 탱크 400 µ m 프라이 스크린 (그림 2) 당 전송 5 청소년.
    참고: 그것은 그 청소년 송사리의 일부 것입니다 없습니다 가득 가스 방광, 결과 전형적인 "배꼽-슬라이더" 표현 형, 물고기 하지 적절 한 부 력 도달, 지속적으로 수영, 강제에 의해 특징에 심한 기형 발생에 성인 물고기입니다. 이 물고기 생존 분석 실험 또는 효율적인 번 식에 대 한 사용할 수 없습니다 하 고 검열 될 필요가 있다.
  2. 14 일 후 부 화까지 하루에 두 번 청소년 초과에서 갓 부 화 소금물 새우 먹이. 매일 파편 각 탱크의 바닥에서 밖으로 사이 펀.
  3. 나이의 14 일, 2.8 L 탱크 전송 청소년 물고기는 850 µ m 프라이 화면을 갖추고 있습니다. 이 시점에서 앞으로, 각 탱크 물고기 id 레이블, 날짜, 스트레인, 물고기 성별 정보와 물고기 식별 번호 (그림 3) 해치를 나타내는. 생존 분석, 이후이 시점에서 단일 탱크에서 각 물고기를 집 개별적으로.
  4. 다음 7 일 동안 하루에 두 번 청소년 ~ 2 mL 당 물고기 소금물 새우의 먹이. 이 단계에서 물고기 1-3 라이브 혈액 벌레로 보완 될 수 있습니다 (혈액 벌레 애벌레는 물고기에 대 한 너무 큰 경우에, 빨리 그들을 면도날으로 작은 조각으로). 수 질 악화를 방지 하기 위해, 먹지 않는 음식 및 주 당 두번 추가 낭비 밖으로 사이 펀.
  5. 3 주 후 부 화에서 탱크의 뒤쪽에서 프라이 화면을 제거 하 고 두 번 1 ~ 2 mL 혈액 벌레의 0.5 mL 및 소금물 새우의 각 물고기에 게 먹이를 시작. 이 단계에서 청소년 신체 크기에 1 cm에 도달 한다 고 전체 크기 혈액 벌레를 섭취 할 수 있어야.
  6. 나이의 4 주 ~ 2 mL 소금물 새우 그리고 혈액 벌레의 1 mL와 함께 하루에 두 번 각 물고기를 먹이. 여성 공동 2.8 L 탱크 당 최대 3 암컷의 밀도에서 지 내게 될 수 있습니다.
  7. 이 단계에서 물고기 완전 한 성적 성숙에 도달 하는지 확인 합니다. 남성에서 착 색의 징후와 큰 항문 지 느 러 미, 꼬리 지 느 러 미의 존재에 대 한 확인 하 고 인체 전체 여성에서 계란의 라운드.
    참고: 생존 코 호트 연구에 대 한 개별 탱크에 성인 물고기를 제기 수 있습니다 부정적인 영향을 물고기 동작 및 건강. 그러나, 생존 코 호트 연구 그룹 주택 엄격한 사회 계층으로 이어지는 사회 지배와 남성 영토의 설립으로 인해 상당한 혼란 요소를 추가 합니다.

6. 먹이

참고: 실험실 청록색 송사리 아기 소금물 새우 (Artemia 살 nauplii)와 혈액 벌레 (Chironomus 종 애벌레) 먹이 수 있습니다. 청록색 송사리 프라이 아기 소금물 새우 독점적으로 먹인 다. 청소년 및 성인 물고기는 하루에 두 번 먹인 다 소금물 새우와 피 웜 (그림 2). 이상적으로,이 프로토콜에 표시 2 feedings를 초과 물고기 하루에도 여러 번 먹 일 수 있다.

  1. 소금물 새우 경작
    1. 소금물 새우 hatcher를 역삼 투 (RO) 물과 홍 해 소금의 350 g 10 L을 추가 하 고 통 기 통풍 관을 가진 폭 기에 의해 해산.
    2. 고도의 불포화 지방산 (HUFA)의 5 mL와 함께 문화를 풍요롭게.
    3. 해칭 솔루션에 소금물 새우 낭종의 20 g을 추가 합니다. 소금물 새우 낭종 물 표면에 플 로트 및 적절 한 산소와 문화의 보장 하지 않는 검사 합니다.
      참고: 건조 소금물 새우 낭종의 매일 aliquots은 4 ° c.에 저장 될 수 있다
    4. 다음 날 오후에 HUFA의 5 mL의 다른 약 수와 문화를 제공 합니다.
  2. 빗금된 소금물 새우 수확
    참고: 시작 문화에서 ~ 36 h, 후 소금물 새우 (탈피 II 단계) 수확 준비 되어 있다.
    1. 문화는 hatcher의 하단에 탭을 사용 하 여 컨테이너에서 5 패를 수집 하 고 10 분 동안 앉아 보자.
    2. 10 분 후 5 L 컨테이너의 상단에서 소금물 새우 껍질 (갈색)을 제거 하 고 필터 메쉬를 통해 부 화 소금물 새우 (오렌지 색상). 비 부 화 계란과 소금물 새우 죽은 포함 된 컨테이너의 하단에서 발견 하는 앙금을 제외에 주의.
    3. 린스로 물과 소금물 새우 2 L 용기에 부 화 하 고 10 분 동안 앉아 보자.
    4. 10 분 후 소금물 새우는 메쉬를 통해 다시 필터링 하 고로 물 2 L에 수집 합니다.
    5. 이전 3 단계를 반복 하 여 소금물 새우 솔루션 비 부 화 cysts 및 소금물 새우 껍질에서 자유롭다.
    6. 먹이 대 한 짜기 병에 소금물 새우 2 L 컨테이너에서 전송.
      상당히 강력 하 고 신뢰할 수 있는 참고:는 소금물 새우 경작입니다. 그러나, 실패 해칭 경우 소금물 새우의 부족을 피하기 위해, 더 작은 (500 mL) 백업 hatchers 사용할 수 있습니다.
  3. 백업 hatcher를 설정
    1. 폭 기에 의해 홍 해로 물 500ml에 소금의 17.5 g을 분해.
    2. 500 µ L HUFA의 문화를 풍요롭게.
    3. 소금물 새우 낭종의 2 세대를 추가 합니다.
    4. 후 18-24 h, HUFA의 500 µ L로 한 번 더 문화를 제공 합니다.
      참고: 소금물 새우 ~ 24 h 후 수확 준비가 되어 있다.
  4. 라이브 혈액 벌레의 준비
    1. 수 유 직전로 물을 사용 하 여 거르는 통해 혈액 벌레의 적절 한 금액을 필터링 합니다.
      참고: 라이브 혈액 벌레 저장할 수 있습니다 4 ° C에서 7-10 일.
    2. 혈액 벌레로 물의 소량으로 플라스틱 용기에 씻어.
    3. 플라스틱 파스퇴르와 함께 피 펫 (좁은 팁 제거), 먹이 대 한 혈액 벌레 혼합물을 차지 합니다.
      참고: 취소 제어 소스에서 라이브 음식 식민지 실험실 송사리를 먹이 기생충과 잠재적으로 병원 성 미생물 지역 사회에서 외부 오염에 대 한 위험을 추가 합니다. 미래에 ad hoc 메 마른 물고기 피드 개발 되어야 한다.

7. 송사리 실험실 긴장 유전형

참고: 뿐만 각 변형 내에서 섹스를 결정 하기 위해 청록색 송사리 긴장 사이 구별을 특정 유전자 (microsatellite) 마커 사용된9 (표 1)를 하실 수 있습니다.

  1. 샘플링
    1. 젖은 스폰지 위에 그물에 물고기를 안전 하 게 잡으십시오.
    2. 면봉 면봉을 사용 하 여 꼬리 지 느 러 미에는 operculum에서 물고기 시체에서 2-3 비늘.
    3. 면봉에서 비늘을 선택 하 고 2-3 척도 NaOH 솔루션을 포함 하는 1 mL 튜브에 전송 (200 µ L 0.5 mol/L NaOH, 1% β-Mercaptoethanol, 및 0.5% 폴 리 비닐 pyrrolidone).
    4. 15에 대 한 PCR 튜브를 회전 척도 NaOH 솔루션에 완전히 몰입 하는 것을 확인 하는 s.
  2. 게놈 DNA 분리
    1. 95 ° c.에 20 분에 대 한 샘플을 품 어
    2. RT에서 쿨, 1의 1/10 볼륨 샘플 중화 M Tris HCl, pH 8.0.
    3. 최고 속도로 5 분에 대 한 샘플 원심

8. 물 매개 변수

참고: 유기 체 그 용도 성인 형질의 축산 대상 종의 수명에 걸쳐 매우 안정적인 축산 조건을 필요 합니다. 따라서, 청록색 송사리 같은 물 유기 체를 경작 물 매개 변수의 엄격한 관리를 필요로 합니다. 물 재순환, 추가 4 단계 여과 물, 물 매개 변수, 모든 탱크를 제공 하는 시간이 지남에 같은 물 조건 제어를 달성 하기 위해 강력한 기초를 보장 합니다. 시스템 물 역 삼 투 (RO) 물, 상업 해양 소금, 중 탄산 나트륨 추가에서 다시 구성 하는 것이 좋습니다.

  1. 물 순환 시스템 체계: 첫째, 물고기에서 폐수를 모든 유엔 먹는 음식 파편 및 큰 입자는 고체 입자 금속 필터를 통해 흐름 탱크. 금속 필터는 일주일에 세 번; 씻어 서 둘째, 다음 첫 번째 기계적 여과, 물 큰 집 수에서 전달 이며 다음 펌핑 바이오 필터, 어디 박테리아 변환할 암모니아 아 질산염과 질산염; 셋째, 바이오 필터에서 물 25 µ m 필터 슬리브, 미세한 크기 입자 트랩에 양수 된다. 마지막으로, 물 박테리아 및 바이러스 로부터 물을 소독 하는 자외선 (UV) 램프를 통해 흐른다. 다음 4 단계, 필터링 된 물 물고기 탱크를 반환합니다.
  2. 탱크에서 미생물 성장을 감소, 질산염의 축적을 방지 하 고 감소를 전반적으로 염 분, 시스템의 10-20%는 매일 삭제 됩니다.
  3. 28 ° C, 7.0-7.5 범위 내 물 pH 상수에서 물 온도 상수를 유지 합니다.
  4. 송사리는 다양 일 분을 용납, 비록을 피하기 위해 oodinosis, 전도도 범위 650-710 마이크로 지멘스 내에서 유지 합니다. 1 년 동안 12 h 명암 주기 식민지 건강과 생산성을 보장합니다.
    참고: 송사리 물 전도도 1500 마이크로-지멘스까지 허용할 수 있습니다.

Representative Results

청록색 송사리 적절 한 농업 메디아 생존 GRZ 변형 (예: 그림 4A)에 12-18 주 사이에 발생 합니다. 메디아 생존의 다이어트, 주파수, 수 유 및 주택 온도 조건에 따라 달라 집니다. 불 쌍 한 축산 결과 제시 하는 생존 곡선에서 초기 사망률 및 반복, 갑자기 여러 굴절 포인트 (그림 4B) 특징, 시간에 걸쳐 생존의 증가.

Figure 1
그림 1: 각 인큐베이션 기판 대표 배아 발달 단계. (A) 갓 배아, 28 ° c.에 인큐베이터에서 메 틸 렌 블루 솔루션에서 incubated 수집 (B) 고체 매체를 전송할 준비가 배아 중 종이 또는 코코넛 섬유 필터. (C) 배아 준비가 해치 할 일반적인 황금 홍 채를 표시 합니다. 눈금 막대는 1 mm.에 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: 청록색 송사리 후 부 화 개발의 단계. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3: 3 단계 이후에서 물고기에 대 한 대표적인 물고기 ID 태그. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4: 70 남성 청록색 송사리에 대 한 대표적인 생존 곡선. (A) 실험실 제기 청록색 송사리에 대 한 일반적인 생존 곡선. (B) 생존 곡선의 비교는 최적의 농업 조건 (블랙)에서 발생 하는 물고기에서 얻은 고 가난한 농업 (빨간색과 파란색). 수평 빨간색 파선 50% 생존, 평균 수명 (x 축에 표시)에 교차 생존 곡선을 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

ID 앞으로 뇌관 반전 뇌관 크기 범위 (bp)
* NfuSU0007 GGCTAAGCCTTGCTGACAGA CAGGGAGCTGAAAACCTCAG 166-214
* NfuSU0010 CGCAGTCTGATCAAATCGTGT TGTTTGAAGGTTCACATTCATTATC 220-272
NfuSU0016 CATGGCTAAACCGTGATGAA GAAGGACGCCAGCTATGAAG 209-240
NfuSU0022 AACACAGCTCTCGTAAGGAGGTA TTCAGACTTGTCTTACTACCATGTTT 198-238
NfuSU0027 TCCAGCTGAATCGGTAATGA AAACTCGAGGGTGCAATCTG 164-226
NfuSU0049 CTGGACAAAGTGCCAATCAC CTCCCACAGTCCCAAAACAT 196-197
NfuSU0050 CCAGAATGAACAATACTCAGATCAA GCAGCTTAGTTTAATGATATCACAATG 252-295
NfuSU0060 CTAGCCACTCCCCTGGTTTA CCGTCACGATGTGCTGATAC 216-248
NfuFLI0030 CAGAAGCTAAAGGCCAGACG GGGAAACAATAGGGAACCAC 174-205
* NfuFLI0091 ACGCTGACTCTACCCAGTC CTGCCTGCTACTGACAATG 355-373
*-섹스 결정 마커

표 1: 스트레인 식별 유전형 뇌관입니다.

Discussion

우리 실험실 청록색 송사리, 성인 물고기 주택 뿐만 아니라 태아 컬렉션, 부 화, 등의 재배에 대 한 프로토콜을 설명, 사육 및 먹이. 우리의 프로토콜 노화와 수명에 대 한 실험 연구에 대 한 특히 성인 물고기에 초점을 맞춘 연구 실험실을 구체적으로 타겟팅 됩니다. 청록색 송사리 표준 zebrafish 시설;에 올려질 수 있다 그러나, 송사리 농업의 중요 한 측면에서 표준 zebrafish 케어16다. 이러한 배아 부 화, 액체와 건조 부 화 단계 구성의 특정 단계 뿐 아니라 단백질이 풍부한 혈액 벌레, 보충 다이어트 소금물 새우만 다이어트에서 초기 전환 포함 됩니다.

프로토콜 내에서 중요 한 단계 8-30 ° C의 온도 범위 내에서 운송 배아를 포함합니다. 번 식, 경우 통치 주파수 및 식품 품질; 먹이에 따라 달라 집니다. 따라서, 배아 수율 (참조 섹션 5.6.) 인상 탱크 사육 당 하루 두 개 이상 feedings를 좋습니다. 태아는 표백, 동안 표백 솔루션에서 태아 외피를 확장 하지 않습니다. 이 계란 chorion 및 증가 태아 사망률에 손상을 일으킬 수 있습니다. 메 틸 렌 블루와 배아를 배양 할 때로 그들의 생존 능력을 극적으로 감소 될 것 이다 2 주에 이상에 대 한 준비-해치 배아의 부 화를 연장 하지 마십시오. 청록색 송사리를 부 화, 대 한 humic 산 성 솔루션의 낮은 온도 향상 부 화 하며 솔루션에 배아의 완전 한 침수 동기화 된 해칭 가스 방광을 채울 수 없는 튀김의 높은 가격에 부 화 결과 동안 충분 한 통 기 통풍 ("배꼽-슬라이더" 표현 형, 섹션 5.1 참조 하십시오).

번 식에 대 한 프로토콜의 한계는 포즈에 여과 시스템을 중앙 집중식 도전과 미래에 다른 방법으로 대체 한다 모래 기판의 사용을 포함. 가능한 대안 zebrafish 사육 탱크의 사용 될 수 있습니다. 배아 표백 변경된 chorion 생리학 및 부 화 성공 귀 착될 수 있는 계란 chorion에 주요 물리 화학 변화를 일으킬 수 있습니다. Methylene 청색에 배아의 지속적인 노출 성인 물고기 생리학에 장기적인 변화 유도 수 있습니다. 성인 물고기 생존 코 호트 연구에 대 한 개별 탱크에서 높이 생선 행동과 건강을 부정적인 영향을 수 있습니다. 그러나, 생존 코 호트 연구 그룹 주택 엄격한 사회 계층으로 이어지는 사회 지배와 남성 영토의 설립으로 인해 상당한 혼란 요소를 추가 합니다. 따라서, 우리는 생존 연구에 대 한 남성 생선의 절연은 합리적인 타협 판단. 취소 제어 소스에서 라이브 음식 먹이 실험실 송사리 식민지는 기생충과 잠재적으로 병원 성 미생물 지역 사회에서 외부 오염에 대 한 위험을 추가합니다. 미래에 ad hoc 메 마른 물고기 피드 개발 되어야 한다.

이 프로토콜에 미래 개선 여전히 3-4 주 이내 성적 성숙 완료 리드 제어, 비-라이브 다이어트에 집중할 것 이다. 요약 하자면, 우리의 프로토콜 넓은 과학계에 청록색 송사리 실험실 경작에 대 한 접근을 제공 합니다.

Disclosures

모든 저자는 아무 경쟁 금융 및 비 금융 관심사를 선언합니다.

Acknowledgments

우리 감사 Alessandro Cellerino, 타이론 Genade, 앤 검은 머리, 사 브리 나 샤 프, 미키 파월, 시몬 Keil, 김 유미, 패트릭 스미스, 카이 Mathar 및 Valenzano 연구소의 모든 구성원 막스 플랑크 연구소에서 노화의 생물학에 대 한 다양 한 측면에 기여 년 동안 현재 송사리 축산 프로토콜.

Materials

Name Company Catalog Number Comments
Probe calibration buffer solution pH=7.0 Roth A518.1 1L buffer solution pH=7.0 to calibrate water system pH-electrode
Probe calibration buffer solution pH=4.0 Roth P712.1 1L buffer solution pH=4.0 to calibrate water system pH-electrode
Conductivity standard VWR 83607.260 500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode
Easy Strips Test 6in1 JBL 2533900 Test strips for determination chlorine values of system water
Ammonia Test JBL 2536500 Test to determine ammonia content of system water
Red Sea Salt Red Sea 22 kg bucket
Sodium hydrogen carbonate VWR 27780.360
Humic acid Sigma- Aldrich 53680-50G
New HUFA Artemia enrichment ZM Systems UK 75g bottle
Methylene blue Roth AE64.1
Hydrogen peroxide solution Sigma- Aldrich 31642-1L 30% (w/w)
Coconut fiber Dragon ZCS010
Whatman paper GE healthcare 3030-690
Ethanol pure VWR 20821.467 100%
Silica sand local pet shop
Artemia Eggs Premium Grade Sanders
Bloodworm local distributor Poseidon Aquakultur Germany
dNTPs solution mix Biolabs N04472 10mM
Taq DNA polymerase Invitrogen 18038-042 5U/uL
PCR 10x Buffer Invitrogen 18038-042
MgCl2 Invitrogen 18038-042 50mM
NaOH Sigma- Aldrich S8045-500g 50mM
Tris-HCl, pH=8.0 solution Sigma- Aldrich T2694-1L 1M
HCl 37% Sigma- Aldrich H1758-500mL
Fish tanks Aquaneering volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids
Orbital shaker VWR 89032-100 model 5000
Microbiological incubator Thermo Scientific, Heratherm 50125882 model IMC18; for storage embryos in the liquid phase, set to t=27-28°C
Cooling Incubator Binder 9020-0209 model KT115; for storage embryos in the solid phase, set to t=27-28°C
Hatching incubator Thermo Scientific, Heratherm 51028114 model OGS180; for embryos hatching, set to t=27-28°C
Stereomicroscope Leica model M80
Breeding sand/hatching boxes Roth 1598.1 1000mL
Petri dish Sarstedt 82.1473 92x16mm
50 mL Conical tube Sarstedt 62.547.254
15 mL Conical tube Sarstedt 62.554.002
Disposable Plastic Pasteur pipette Roth EA71.1 2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter
Serological pipette Sarstedt 86.1689.001 50mL
Syringe Henke Sass Wolf 4100-000V0 10mL
Metal strainer fineness <1mm; for embryos collection
Tweezers Dumont 0508-5/45-PO type5/45; for embryos transfer
25 L Brine shrimp hatcher Aquaneering ZHBS25 main hatcher
500 mL Brine shrimp hatcher JBL 6106100 model Artemio 1; backup hatcher
Narrow-mesh fish nets JBL
Sand beaker VWR BURK7102-5000 5000mL
Brine shrimp separation beaker VWR BURK7102-2000 2000mL
Plastic zipper bag Roth P279.2 for dead fish storage
Pipetboy Integra 155000 model Pipetboy acu2
Parafilm P-Lab P701605
Air tubing www.zajac.de AQ380 4-6 mm diameter
1 L Glass bottle VWR 215-1595
2 L Glass bottle VWR 215-1596
500 mL Squeeze bottle Roth K665.1 for fish feeding with brine shrimp
120-μm brine shrimp strainer Florida Aqua Farms BB-PC2 for brine shrimp/bloodworm collection
Finish filter socks Aquaneering MFVB025C 25-μm
Central filtration fish housing system Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz

DOWNLOAD MATERIALS LIST

References

  1. Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. Non-canonical aging model systems and why we need them. EMBO J. 36, (8), 959-963 (2017).
  2. Harel, I., Brunet, A. The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane. Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).
  3. Smith, P., et al. Regulation of life span by the gut microbiota in the short-lived African turquoise killifish. Elife. 6, (2017).
  4. Cellerino, A., Valenzano, D. R., Reichard, M. From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology. Biol Rev Camb Philos Soc. 91, (2), 511-533 (2016).
  5. Kim, Y., Nam, H. G., Valenzano, D. R. The short-lived African turquoise killifish: an emerging experimental model for ageing. Dis Model Mech. 9, (2), 115-129 (2016).
  6. Blazek, R., et al. Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient. Evolution. 71, (2), 386-402 (2017).
  7. Terzibasi, E., et al. Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri. PLoS One. 3, (12), e3866 (2008).
  8. Kirschner, J., et al. Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research. Aging Cell. 11, (2), 252-261 (2012).
  9. Valenzano, D. R., et al. Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri. Genetics. 183, (4), 1385-1395 (2009).
  10. Reichwald, K., et al. Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish. Cell. 163, (6), 1527-1538 (2015).
  11. Valenzano, D. R., et al. The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan. Cell. 163, (6), 1539-1554 (2015).
  12. Harel, I., et al. A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate. Cell. 160, (5), 1013-1026 (2015).
  13. Valenzano, D. R., Sharp, S., Brunet, A. Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging. G3. 1, (7), Bethesda. 531-538 (2011).
  14. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nat Protoc. 11, (10), 2010-2028 (2016).
  15. Polacik, M., Blazek, R., Reichard, M. Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri. Nat Protoc. 11, (8), 1396-1413 (2016).
  16. Avdesh, A., et al. Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction. J Vis Exp. (69), e4196 (2012).
실험실 주택의 청록색 송사리 (<em>Nothobranchius furzeri</em>)에 대 한 프로토콜
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).More

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter