Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

En protokoll for laboratoriet bolig av turkis Killifish (Nothobranchius furzeri)

doi: 10.3791/57073 Published: April 11, 2018

Summary

Laboratoriet bolig av turkis killifish kan skaleres opp til huset og effektivt heve tusenvis av fisk i en sentralisert vann filtreringssystem, ansette de samme infrastrukturen brukes for standard sebrafisk fasiliteter. Her detalj vi en liste over standardisert prosedyrer som tillater effektiv killifish vedlikehold.

Abstract

Utviklingen av dyrehold praksis i ikke-modellen laboratorium fisk for eksperimentelt bruk har stor nytte fra etablering av referanse fisk modellsystemer, som sebrafisk og medaka. De siste årene, har en voksende fisk-turkis killifish (Nothobranchius furzeri)-blitt adoptert av et økende antall forskningsgrupper innen biologi av aldring og økologi. Med en fange levetid 4-8 måneder, denne arten er shortest-lived virveldyr i fangenskap og lar det vitenskapelige samfunnet til test-på kort tid-eksperimentelle tiltak som kan føre til endringer av aldring rate og levealder. Gitt den unike biologien av denne arten, preget av embryonale diapause, merket eksplosive kjønnsmodning, morfologiske og atferdsmessige kjønnsdimorfisme- og deres relativt kort voksen levetid - adhoc dyrehold praksis er inne inntrengende etterspørselen. Denne protokollen rapporterer en rekke viktige dyrehold tiltak som tillater optimal turkis killifish laboratorium omsorg, slik vitenskapssamfunnet å vedta denne arten som kraftig laboratorium dyr modell.

Introduction

Gitt sin korte levetid og rask livssyklus, er turkis killifish raskt økende som en lovende ny modell organisme i biologi1,2,3. Denne arten er preget av en unik livssyklus for en teleoster, bestående av embryonale diapause, rask kjønnsmodning og en utvidet post-reproductive liv stadium4,5. Nyere arbeid har bidratt til Klargjørende biologi av denne arten i fangenskap og i vill6,7. Turkis killifish bor i sesongens friske vann skjemaet under regntiden i den afrikanske savannen i Zimbabwe og Mosambik. I den tørre årstiden overleve embryo i tørr gjørma i fravær av vann i kraft av en stress-resistent livet scene kalt diapause.

Genetisk kart for denne arten vært generert8,9, og nylig sine genom er sekvensert og samlet10,11. Flere innavlet laboratorium fisk stammer har blitt utviklet, og transgenesis og genom redigering via CRISPR/Cas9 har blitt tilgjengelig i denne arten, de facto fremme turkis killifish som en konkurransedyktig laboratorium virveldyr modell organisme 12,13,14.

Selv om en laboratorium protokoll allerede er publisert i denne arten15, i stede protokollen utvikle vi en omfattende liste over eksperimentell laboratorium retningslinjer som er spesielt rettet mot studier som undersøker aldring og overlevelse. Nåværende protokollen gjør at forskere allerede kjent med sebrafisk og medaka rettsgrunnlag å bli kjent med turkis killifish dyrehold ved å vedta et minimum antall viktige justeringer. Samtidig gir denne protokollen forskere uten tidligere erfaring i fisk dyrehold med de grunnleggende verktøyene for å heve en blomstrende turkis killifish koloni.

Protocol

Fisk er oppvokst på 28 ° C i en vann-resirkuleringssystemet (se Vannverdiene), med 10-20% daglig vann disposisjon. Tre forskjellige tanken størrelser anbefales: 0,8 liter, 2,8 L og 9,5 L. Hvert kar mottar en konstant vannføring 2 mL/s.

1. reagenser forberedelse (ikke inkludert i materialer)

Merk: Afrikanske turkis killifish (Nothobranchius furzeri) kan skaffes fra en etablert laboratorium lager. De årlige killifish uttørking-resistente embryoene kan sendes per post. Det er viktig å sende embryo innenfor 8-30 ° C temperatur.

  1. Forberede humic syre (klekking) løsning smelte 1 g/L humic syre i systemet vann. Autoclave og butikk på 4 ° C i opptil 10 uker.
  2. For å forberede HUFA Artemia berikelse, legge til HUFA berikelse saltlake reker hatcher daglig på en konsentrasjon 500 µL finans saltlake reker løsning.
  3. Klargjør methylene blåfarge løsning ved oppløsning 100 µL/L methylene blåfarge lager løsning i tidligere autoklaveres system vann. Siden methylene blåfarge er lys-sensitive, holde løsningen i mørke flasker eller dekk med aluminiumsfolie. Butikken på RT.
  4. Forberede kokos fiber som en solid substrat embryoet inkubasjon. Også bruke et filter papir (se avsnitt 1.5).
    1. Presoak kokos fiber med destillert vann. Autoclave og butikk på 4 ° C 5 uker.
    2. På dagen for embryoer, forberede Petriskål med fuktig kokos fiber.
    3. Fyll en 90 mm diameter Petriskål med kokos fiber under avtrekksvifte- og en flamme, redusere forurensning av gjær og bakterier.
    4. Kompakt kokos fiber til en høyde på 1 cm, med sterilt vev. Fjerne det meste av fuktigheten fra kokos fiber ved å trykke et papirhåndkle på platen, slik at papiret å absorbere overflødig vann. Varm en metall skje over flammen, og trykk ned hele overflaten av kokos fiber. Dette hindrer kokos fiber fungal/bakteriell forurensning.
  5. Forberede filter papir som en solid substrat embryoet inkubasjon.
    1. På dagen for embryoer overføring, sett 3 lag av filter papir disker som passer Petriskål 90 mm. Legge til 5 mL av humic sur løsning å holde fuktighet.

2. avl

  1. Avl turkis killifish belastning vedlikehold
    Merk: Etter denne protokollen, seksuell modenhet nås på ~ 4 uker etter klekking og fruktbarhet toppene mellom 7-9 uker. Det er viktig å merke seg at fruktbarhet avhenger av fôring frekvens og matkvalitet; Derfor anbefales minst to feedings pr. dag per avl tanken å øke embryo kapasitet (se avsnitt 5.6.)
    1. Oppsett en 9,5 L avl tank. Fyll med system vann og legge til en hann og to kvinnelige fisk.
    2. Som mannlig afrikanske turkis killifish vise dominans under parring, som kan føre til trakassering av kvinner, velge en mann med en litt mindre kroppsstørrelse enn den kvinnelige å redusere parring stress og øke reproduktive utgang. Angi 5-uke-gamle menn med 6/7-uke-gamle kvinner.
    3. Fyll en plastbeholder (10 x 10 x 5 cm) med autoklaveres sand nå en siste dybdeskarphet ~ 2-3 cm og plassere boksen sand i midten av avl tanken.
    4. La turkis killifish rase kontinuerlig og høste embryo ukentlig for fosteret inkubasjon.
      Merk: Bruk av sand substrat gir utfordringer til sentralisert filtreringssystemer og bør erstattes av alternative metoder i fremtiden. Mulige alternativer kan være bruk av sebrafisk avl tanker.
  2. Avl for transgenesis
    Merk: Embryo bruke injeksjoner må synkroniseres på ett-celle-scenen, og dette krever at de er samlet inn umiddelbart etter befruktning.
    1. For å høste en-celle-scene embryo for injeksjon og generasjon av transgene linjer, kan du definere en avl tank med en hann og to kvinnelige fisk (samme som 2.1.).
    2. To dager før embryoet samling, isolere mannlige i en individuell tank og holde mannlige visuell kontakt med voksne kvinner.
    3. På dagen for samlingen, legge mannlige og en sandkasse til avl tanken og la dem gyte for 2T.

3. embryo dyrehold

  1. Fosteret samling
    Merk: Embryo samling utføres av sikting og høsting embryoer fra boksen sand. Under normale forhold, bør hver sandkasse inneholde fra 30 til 200 embryoer.
    1. På dagen for samlingen, fjerne sandkasse fra avl tanken. Tomme boksen sand i en sil (~0.9 mm belastning størrelse) og skyll med system vann. Dette kan gjøres over en stor tank å samle sand for autoklavering.
    2. Delvis dukke silen i system vann og virvel forsiktig, la embryoene til å gruppere i midten.
    3. Samle embryo med en 10 mL Pasteur pipette.
    4. Overføre embryo til en 90 mm Petriskål i ~ 40 mL system vann.
    5. Kontroller embryo i Petriskål under en lys stereomicroscope og fjerne disse sprukket plasmocitara og tegn på skader.
    6. Gå direkte til fosteret bleking.
      Merk: Bruk alltid en sil per fisk belastning for å hindre potensielle kryss-belastning embryoet forurensing.
  2. Fosteret bleking
    Merk: Embryo bleking hindrer mikroorganismer stede i akvarier fra forurensende inkubasjon media.
    1. Før bleking, bruk en engangs Pasteur pipette fjerne system vann fra Petriskål inneholder samlet embryoer.
    2. For å unngå uønskede sopp og bakteriell vekst, Legg 50 mL av nylagde H2O2 (1% v/v i autoklaveres system vann) samlet embryoer.
    3. Riste embryo for 5 min på en lav hastighet i 90 mm Petri retter i 50 mL løsning.
    4. Fjerne H2O2 løsning med disponibel Pasteur pipette og vask embryo tre ganger i 5 min med 50 mL methylene blåfarge løsning. Fjerne methylene blåfarge løsning.
    5. Legge til 50 mL av H2O2 (1% v/v i autoklaveres system vann) embryoer og riste i 5 min.
    6. Fjerne H2O2 løsning og vask tre ganger i 5 min med 50 mL methylene blåfarge løsning.
    7. Inkuber embryoer på 28 ° C å øke synkron Embryo utvikling, på en maksimal tetthet av 100 embryo per 90 mm Petriskål i 40 mL methylene blåfarge løsning.
      Merk: Går ikke utover embryoet inkubasjon i bleking løsningen. Dette kan forårsake skade på det egg plasmocitara og øke embryoet dødelighet. Fosteret bleking kan forårsake store fysiske-kjemiske endringer i den egg plasmocitara som kunne føre til endrede plasmocitara fysiologi og klekking suksess.
  3. Fosteret inkubasjon i methylene blåfarge
    Merk: Flytende inkubasjon i methylene blåfarge løsningen hindrer parasitten vekst og gjør oppdagelse av døde embryoer og 5mas egg.
    1. Inspisere inkubert embryoer, fjerne alle døde embryo (farget blå av methylene blåfarge) fra Petriskål å hindre sopp og bakteriell forurensning som påvirker overlevelse av live sunn embryoer.
    2. Fjerne gamle methylene blåfarge løsning og erstatte med fersk løsning.
    3. Tilbake Petriskål til 28 ° C inkubator (figur 1A). Innen 7-10 dager, sikre at de utviklede embryoene Vis synlige sorte øyne. Overføre disse Foster kokos fiber eller filter papir solid substrat medium (figur 1B).
    4. Beholde uutviklet embryo i methylene blåfarge, overvåke daglig og overføre til solid substrat medium når svarte øyne har utviklet.
    5. Gjenta trinn 3.3.1-3.3.3 daglig til embryoer har synlige sorte øyne.
      Merk: Konstant eksponering for embryoer methylene blåfarge kan indusere langsiktige endringer i voksen fisk fysiologi.
  4. Embryoer filter papir
    Merk: Turkis killifish embryo kan utvikle på et tørt substrat recapitulating naturgitte forhold. I tillegg kan tørr embryoet inkubasjon forskere å synkronisere embryoer og klekkes dem samme dag.
    1. Som utviklet embryo vil ha synlige sorte øyne innen 7-10 dager, bruk en engangs Pasteur pipette eller fin buet pinsett overføre embryoer fra methylene blåfarge løsningen på en tidligere utarbeidet filter papir plate.
    2. Spre embryo ~ 5 mm fra hverandre med tang, opptil 100 embryo per 90 mm plate (figur 1B).
    3. Forsegle Petriskål med parafilm.
    4. Inkuber embryoer på 28 ° C i 2-3 uker, før de har fullt utviklet golden iriser og er klar for klekking (figur 1 c).
      Merk: Ikke forlenge inkubering av klar-å-Luke embryo lenger enn 2 uker som sin levedyktighet reduseres dramatisk.
  5. Embryoer til kokos fiber
    Merk: Autoklaveres, sterile kokos fiber (eller organiske torv moss) kan brukes som et gyldig alternativ medium for solid substrat inkubasjon.
    1. Bruk en engangs Pasteur pipette eller fin buet pinsett overføre embryoer fra methylene blåfarge løsningen på en klar-å-bruke kokos fiber tallerken.
    2. Spre embryo ~ 5 mm fra hverandre, opptil 100 embryo per 90 mm plate (figur 1B).
    3. Forsegle Petriskål med parafilm.
    4. Inkuber embryoer på 28 ° C i 2-3 uker, før de har fullt utviklet golden iriser (f.eks. i figur 1 c).
      Merk: For langtidslagring (opp til ett år), overføre embryoer på 3-dager innlegget samling fra methylene blåfarge løsninger til en solid-underlaget plate på 17 ° C. Inkuber embryo før de utvikler sorte øyne.

4. klekking turkis Killifish

Merk: Turkis killifish embryo kan være vellykket luke i en humic sur løsning14.

  1. Bruke fine buet pinsett, utviklet overføring nøye 50-100 embryo i boksen klekking fylt med humic syre løsningen på 4 ° C. Humic syre løsningen består av 1 g/L humic syre i system vann. Autoclave og butikk på 4 ° C i opptil 10 uker. Kontroller at alle embryoer er helt nedsenket. Humic syre løsningen må grunne, ikke dypere enn 2 cm.
    Merk: Lav temperatur på humic sur løsning forbedrer klekking og komplett nedsenking av embryo i løsningen lar synkroniserte klekking.
  2. Plass boksen klekking i 28 ° C klekking inkubator. Dekk boksen klekking med lokk. Angi tilstrekkelig lufting, koble klekking boksen av rør med lufttilførsel.
    Merk: Ikke tilstrekkelig lufting under incubation resulterer i høy forekomst av fry ikke kunne fylle gass blæren ("magen-slider" fenotype, se merknad i pkt. 5.1)
  3. Fra dagen etter klekking, for å opprettholde tilstrekkelig vannkvaliteten i boksen klekking, legge til autoklaveres system vann en gang om dagen i forhold til 1:1, holde en siste dybde på 2 cm.
  4. Overføre unhatched embryo tilbake til solid underlaget, og prøv klekking en uke senere.
    Merk: Ved klekking turkis killifish har lett opptak og spiser levende mat. For optimal vekst, mate fry to ganger per dag med overflødig fersk skravert saltlake reker (Artemia salina). Tegn på full satiation er oransje-farget sklerotisert av fry etter 10-15 min av hver fôring. Sug ut overflødig, oppspore og inndelte saltlake reker med en Pasteur pipette daglig.

5. øke unge og voksne fisk

  1. På fem dager etter klekking, flytte yngel re sirkulasjon vannsystemet. Bruke engangs plast Pipetter (eller en plast skje), nøye overføring fem barn per 0,8 liter tank utstyrt med 400 µm fry skjermen (figur 2).
    Merk: Det er mulig at en del av juvenile killifish ikke vil ha fylt gass blæren, noe som resulterer i en typisk "magen-slider" fenotype, preget av fisk ikke nå riktig oppdrift, tvinge dem til å kontinuerlig svømme, forårsaker alvorlig misdannelser i voksen fisk. Disse fiskene kan ikke brukes for overlevelse analyser eller effektiv avl og trenger å bli sensurert.
  2. Mate yngel to ganger daglig med ferske skravert saltlake reker i overkant inntil 14 dager etter klekking. Sug opp rusk fra bunnen av hver tank daglig.
  3. Etter 14 dager gammel, overføring juvenile fisk til 2,8 L tank utstyrt med en 850 µm fry skjermen. Fra dette punktet og utover, kan du merke hver tank med fisk-ID, som angir Luke dato, varianten, fisk kjønn og fisk identifikasjonsnummer (Figur 3). For overlevelse analyser, individuelt huset hver fisk i enkelt tanker fra dette punktet og fremover.
  4. For følgende 7 dager, mate yngel to ganger per dag med ~ 2 mL saltlake reker per fisk. På dette stadiet fisk kan suppleres med 1-3 bo blod ormer (i tilfelle blod orm Larvene er for stor for fisken, hogge dem i mindre biter med et barberblad). For å hindre forverring av vannkvalitet, Hevert oppspore næringen og mer avfall to ganger per uke.
  5. Etter 3 uker etter klekking, fjerne fry skjermen på baksiden av tanken og begynner å mate hver fisk to ganger per dag ~ 2mL av saltlake reker og 0,5 mL blod orm. På dette stadiet, yngel bør ha nådd 1 cm kroppsstørrelse og bør være i stand til inntak full-size blod orm.
  6. Feed hver fisk to ganger per dag med ~ 2mL av saltlake reker og 1 mL blod orm på 4 uker gamle. Kvinner kan co huset på en tetthet opptil 3 kvinner per 2,8 L tanken.
  7. På dette stadiet kan du sikre at fisk nå komplett kjønnsmodning. Se etter store dorsal, anal og caudal finnene tegn til farge i menn og runde sklerotisert full av egg i kvinner.
    Merk: Heve voksne fisk i personlige tanker for overlevelse Kohortstudier kan negativt påvirke fisk atferd og helse. Gruppe bolig for overlevelse Kohortstudier legger imidlertid til betydelig forvirrende faktorer på grunn av etableringen av sosiale dominans og mannlige territorier, fører til strenge sosiale hierarkier.

6. fôring

Merk: Laboratorium turkis killifish kan matet en kombinasjon av baby saltlake reker (Artemia salina nauplii) og blod orm (Chironomus spp. Larvene). Turkis killifish yngelen blir foret utelukkende baby saltlake reker. Unge og voksne fisk fôres to ganger om dagen både saltlake reker og blod orm (figur 2). Ideelt sett angitt fisken kan mates flere ganger om dagen, overstiger det 2 feedings i denne protokollen.

  1. Dyrking saltlake reker
    1. Legge til 10 L omvendt osmose (RO) vann og 350 g Rødehavet salt i en saltlake reker hatcher og oppløses av lufting med et rør for lufting.
    2. Berike kulturen med 5 mL svært umettede fettsyrer (HUFA).
    3. Legge til 20 g saltlake reker cyster i klekking løsningen. Kontroller at saltlake reker cyster ikke flyter på overflaten av vannet og sikre riktig oksygenering og sirkulasjon av kulturen.
      Merk: Daglig dele tørr saltlake reker cyster kan lagres på 4 ° C.
    4. På ettermiddagen neste dag, levere kultur med en annen aliquot av 5 mL av HUFA.
  2. Høsting skravert saltlake reker
    Merk: Etter ~ 36 h fra Start kulturen, brine reker er klar til innhøsting (skikkelsen II fase).
    1. Samle 5 L av kulturen i en beholder med trykk på bunnen av hatcher og la sitte i 10 min.
    2. Etter 10 minutter, Fjern saltlake reker skjell (brun farge) fra toppen av beholderen 5 L og filtrere skravert saltlake reker (oransje) gjennom en maske. Ta hensyn til ekskludere sediment funnet på bunnen av beholderen som inneholder ikke-klekket egg og død saltlake reker.
    3. Skyll skravert saltlake reker med RO vann i en 2 L beholder og la sitte i 10 min.
    4. Etter 10 min, filtrere saltlake reker igjen gjennom en maske og samle i 2 L RO vann.
    5. Gjenta de tre foregående trinnene til saltlake reker løsning er gratis ikke-klekket cyster og saltlake reker skjell.
    6. Overføre saltlake reker fra beholderen 2 L i klem flasker for fôring.
      Merk: Dyrking saltlake reker er ganske robust og pålitelig. Men for å unngå mangel på saltlake reker ved mislykket klekking, kan mindre (500 mL) backup hatchers brukes.
  3. Sette opp sikkerhetskopiering hatcher
    1. Oppløse 17,5 g Rødehavet salt i 500 mL RO vann av lufting.
    2. Berike kulturen med 500 µL av HUFA.
    3. Legg 2 g saltlake reker cyster.
    4. Etter 18-24 h, levere kulturen igjen med 500 µL av HUFA.
      Merk: saltlake reker er klar til innhøsting etter ~ 24 h.
  4. Utarbeidelse av bo blod orm
    1. Umiddelbart før fôring, filtrere en passende mengde blod orm gjennom en sil med RO vann.
      Merk: Live blod orm kan lagres på 4 ° C for 7-10 dager.
    2. Skyll blod orm med litt RO vann i en plastbeholder.
    3. Med en plast Pasteur Pipetter (smal tips fjernet), ta blod orm blandingen for fôring.
      Merk: Fôring laboratorium killifish kolonier med live mat fra FN-kontrollerte kilder legger en risiko for eksterne forurensing fra parasitter og potensielt patogene mikrobielle samfunn. I fremtiden, bør en ad hoc sterilt fiskefôr utvikles.

7. killifish laboratorium belastning genotyperingteknologi

Merk: For å skille mellom turkis killifish stammer, samt å finne sex i hver stamme, bestemt genetisk (mikrosatellittmarkør) indikatorer kan være brukt9 (tabell 1).

  1. Prøvetaking
    1. Hold fisken sikkert på nettet på våt.
    2. Vattpinne 2-3 skalerer fra fisk kroppen fra bløtdyr til halefinnen bruker bomull vattpinner.
    3. Plukke skalerer fra vattpinnen og overføre 2-3 skalaer i en 1 mL tube med NaOH løsning (200 µL 0,5 mol/L NaOH, 1% β-Mercaptoethanol og 0,5% polyvinylacetat pyrrolidone).
    4. Spin PCR rør for 15 s å sikre at skalaer er helt oppslukt i NaOH løsningen.
  2. Genomic DNA isolasjon
    1. Inkuber utvalget for 20 min på 95 ° C.
    2. Cool på RT, nøytralisere utvalg med 1/10 volum 1 M Tris-HCl, pH 8.0.
    3. Sentrifuge utvalget for 5 min i full fart.

8. vann parametere

Merk: Dyrehold organismer som bruksområde er voksen phenotyping krever svært stabil dyrehold forhold gjennom hele levetiden av målet artene. Derfor nødvendiggjør dyrking vann organismer, som turkis killifish, streng kontroll av vann parametere. Vannet resirkulering, med fire-forholdsregler vann filtrering, sikrer et solid grunnlag for å oppnå kontroll over Vannverdiene, gir alle tankene med samme vannforhold over tid. Det anbefales å gjeninnføre system vann fra omvendt osmose (RO) vann, lagt med kommersielle marine salt og natrium bikarbonat.

  1. Vann sirkulasjon system ordningen: først avfall vann fra fisk tank flyter gjennom faste partikler metall filter som fanger alle un spist matrester og større partikler. Metall filtre er skylt tre ganger i uken. Andre, etter den første mekanisk filtration, vannet er formidles i store sumps og deretter pumpes til en biofilter, hvor bakterier konvertere ammoniakk til nitrites og nitrates; Tredje, fra biofilter, vann pumpes til 25-µm filter ermer, som felle finere størrelse partikler. Til slutt, vann renner gjennom ultrafiolett (UV)-lamper som Steriliser vann mot bakterier og virus. Etter disse fire trinnene, filtrert vann tilbake til fisken tank.
  2. For å redusere microorganism vekst i tanker, forhindre ansamling av nitrater og redusere samlet kastes saltholdighet, 10-20% av systemet vannet på daglig basis.
  3. Opprettholde vann temperatur konstant på 28 ° C, vann pH konstant innen 7.0 til 7.5.
  4. Selv om killifish tolerere rekke saltholdighet, for å unngå oodinosis, opprettholde ledningsevne innen rekkevidde 650-710 mikro-Siemens. En Ettåring 12t lys/mørke syklus sikrer kolonien helse og produktivitet.
    Merk: Killifish tåler vann ledningsevne opptil 1500 mikro-Siemens.

Representative Results

Turkis killifish forsvarlig dyrehold resultater i median overlevelse varierer mellom 12-18 uker i GRZ belastningen (f.eks figur 4A). Varianter av median overlevelse avhenger av kosthold, fôring frekvens og bolig temperaturer. Dårlig dyrehold resultater i overlevelse vil presentere økt tidlig dødelighet og repeterende, plutselig dråper overlevelse hele tiden, preget av flere Bøyning poeng (figur 4B).

Figure 1
Figur 1: representant embryonale utviklingsstadier med respektive incubation underlag. (A) fersk samlet embryoer, ruges i methylene blåfarge løsning i kuvøse på 28 ° C. (B) embryo klar til å overføres til solid medium, enten filter papir eller kokos fiber. (C) embryo klar til å bli klekket ut, viser typisk golden iriser. Baren skala er lik til 1 mm. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: stadier av turkis killifish etter klekking utvikling. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: representant fisk ID-koden for fisk fra scenen utover 3. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: representant overlevelse kurve for 70 mannlige turkis killifish. (A) typisk survival kurve for laboratorium-høynet turkis killifish. (B) sammenligning av overlevelse kurver innhentet fra fisk hevet under optimale dyrehold forhold (svart) og dårlig røkting (rød og blå). Stiplede røde vannrette linjen angir 50% overlevelse, kryssende overlevelse kurven ved median levetid (angitt på x-aksen). Klikk her for å se en større versjon av dette tallet.

ID Fremover primer Omvendt primer Størrelse utvalg (bp)
* NfuSU0007 GGCTAAGCCTTGCTGACAGA CAGGGAGCTGAAAACCTCAG 166 - 214
* NfuSU0010 CGCAGTCTGATCAAATCGTGT TGTTTGAAGGTTCACATTCATTATC 220 - 272
NfuSU0016 CATGGCTAAACCGTGATGAA GAAGGACGCCAGCTATGAAG 209 - 240
NfuSU0022 AACACAGCTCTCGTAAGGAGGTA TTCAGACTTGTCTTACTACCATGTTT 198 - 238
NfuSU0027 TCCAGCTGAATCGGTAATGA AAACTCGAGGGTGCAATCTG 164 - 226
NfuSU0049 CTGGACAAAGTGCCAATCAC CTCCCACAGTCCCAAAACAT 196 - 197
NfuSU0050 CCAGAATGAACAATACTCAGATCAA GCAGCTTAGTTTAATGATATCACAATG 252 - 295
NfuSU0060 CTAGCCACTCCCCTGGTTTA CCGTCACGATGTGCTGATAC 216 - 248
NfuFLI0030 CAGAAGCTAAAGGCCAGACG GGGAAACAATAGGGAACCAC 174 - 205
* NfuFLI0091 ACGCTGACTCTACCCAGTC CTGCCTGCTACTGACAATG 355 - 373
* - sex besluttsomhet markører

Tabell 1: Genotyperingteknologi primere for belastning identifikasjon.

Discussion

Vi beskriver en protokoll for laboratoriet dyrking av turkis killifish, inkludert embryoet samling, inkubering, så vel som voksne fisk boliger, avl og fôring. Våre protokollen er spesielt rettet mot laboratorier som forske fokusert på voksen fisk, spesielt for eksperimentelle studier på aldring og levetid. Turkis killifish kan heves på en standard sebrafisk fasilitet; men avvike viktige aspekter killifish rettsgrunnlag fra standard sebrafisk omsorg16. Disse innstillingene inkluderer tidlig overgangen fra en saltlake reker eneste dietten til en diett med proteinrik blod orm, samt bestemte trinn i fosteret inkubasjonstiden, som består av en væske og tørr inkubasjon scene.

Avgjørende skritt i protokollen inkludere frakt embryo innenfor 8-30 ° C temperatur. Ved oppdrett avhenger fruktbarhet fôring frekvens og matkvalitet; Vi anbefaler derfor minst to feedings pr. dag per avl tanken å øke embryo kapasitet (se avsnitt 5.6.). Under embryoet bleking, går ikke utover embryoet inkubasjon i bleking løsningen. Dette kan forårsake skade på egg plasmocitara og økt embryoet dødelighet. Når rugende embryo med methylene blåfarge, ikke forlenge inkubering av klar-å-Luke embryo lenger enn 2 uker som sin levedyktighet reduseres dramatisk. Klekking turkis killifish, lav temperatur på humic sur løsning forbedrer klekking og komplett nedsenking av embryo i løsningen lar synkroniserte klekking. Ikke tilstrekkelig lufting under inkubasjon resultatene i høy forekomst av fry ikke kunne fylle gass blæren ("magen-slider" fenotype, se notater i pkt. 5.1).

Begrensning av protokollen for avl inkluderer bruk av sand underlaget som utgjør utfordringer til sentralisert filtreringssystemer og bør erstattes av alternative metoder i fremtiden. Mulige alternativer kan være bruk av sebrafisk avl tanker. Fosteret bleking kan forårsake store fysiske-kjemiske endringer i den egg plasmocitara som kunne føre til endrede plasmocitara fysiologi og klekking suksess. Konstant eksponering for embryoer methylene blåfarge kan indusere langsiktige endringer i voksen fisk fysiologi. Heve voksne fisk i personlige tanker for overlevelse Kohortstudier kan negativt påvirke fisk atferd og helse. Gruppe bolig for overlevelse Kohortstudier legger imidlertid til betydelig forvirrende faktorer på grunn av etableringen av sosiale dominans og mannlige territorier, fører til strenge sosiale hierarkier. Derfor dømme vi isolering av mannlige fisk for overlevelse studier som et rettferdig kompromiss. Fôring laboratorium killifish kolonier live mat fra FN-kontrollerte kilder legge en risiko for eksterne forurensing fra parasitter og potensielt patogene mikrobielle samfunn. I fremtiden, bør en ad hoc sterilt fiskefôr utvikles.

Fremtidige forbedringer til denne protokollen vil fokusere på en kontrollert, ikke-live diett, som fortsatt leder å fullføre kjønnsmodning innen 3-4 uker. Oppsummert tilbyr våre protokollen tilgjengelighet til turkis killifish laboratorium dyrking til et bredt vitenskapelige samfunn.

Disclosures

Alle forfatterne erklærer ingen konkurrerende økonomiske og ikke-finansielle interesser.

Acknowledgments

Vi takker Alessandro Cellerino, Tyrone Genade, Anne Brunet, Sabrina Sharp, Mickie Powell, Simone Keil, Yumi Kim, Patrick Smith, Kai Mathar og alle medlemmer av Siezenheim laboratoriet ved Max Planck Institutt for biologi av aldring for å bidra til forskjellige aspekter gjeldende killifish dyrehold protokollen gjennom årene.

Materials

Name Company Catalog Number Comments
Probe calibration buffer solution pH=7.0 Roth A518.1 1L buffer solution pH=7.0 to calibrate water system pH-electrode
Probe calibration buffer solution pH=4.0 Roth P712.1 1L buffer solution pH=4.0 to calibrate water system pH-electrode
Conductivity standard VWR 83607.260 500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode
Easy Strips Test 6in1 JBL 2533900 Test strips for determination chlorine values of system water
Ammonia Test JBL 2536500 Test to determine ammonia content of system water
Red Sea Salt Red Sea 22 kg bucket
Sodium hydrogen carbonate VWR 27780.360
Humic acid Sigma- Aldrich 53680-50G
New HUFA Artemia enrichment ZM Systems UK 75g bottle
Methylene blue Roth AE64.1
Hydrogen peroxide solution Sigma- Aldrich 31642-1L 30% (w/w)
Coconut fiber Dragon ZCS010
Whatman paper GE healthcare 3030-690
Ethanol pure VWR 20821.467 100%
Silica sand local pet shop
Artemia Eggs Premium Grade Sanders
Bloodworm local distributor Poseidon Aquakultur Germany
dNTPs solution mix Biolabs N04472 10mM
Taq DNA polymerase Invitrogen 18038-042 5U/uL
PCR 10x Buffer Invitrogen 18038-042
MgCl2 Invitrogen 18038-042 50mM
NaOH Sigma- Aldrich S8045-500g 50mM
Tris-HCl, pH=8.0 solution Sigma- Aldrich T2694-1L 1M
HCl 37% Sigma- Aldrich H1758-500mL
Fish tanks Aquaneering volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids
Orbital shaker VWR 89032-100 model 5000
Microbiological incubator Thermo Scientific, Heratherm 50125882 model IMC18; for storage embryos in the liquid phase, set to t=27-28°C
Cooling Incubator Binder 9020-0209 model KT115; for storage embryos in the solid phase, set to t=27-28°C
Hatching incubator Thermo Scientific, Heratherm 51028114 model OGS180; for embryos hatching, set to t=27-28°C
Stereomicroscope Leica model M80
Breeding sand/hatching boxes Roth 1598.1 1000mL
Petri dish Sarstedt 82.1473 92x16mm
50 mL Conical tube Sarstedt 62.547.254
15 mL Conical tube Sarstedt 62.554.002
Disposable Plastic Pasteur pipette Roth EA71.1 2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter
Serological pipette Sarstedt 86.1689.001 50mL
Syringe Henke Sass Wolf 4100-000V0 10mL
Metal strainer fineness <1mm; for embryos collection
Tweezers Dumont 0508-5/45-PO type5/45; for embryos transfer
25 L Brine shrimp hatcher Aquaneering ZHBS25 main hatcher
500 mL Brine shrimp hatcher JBL 6106100 model Artemio 1; backup hatcher
Narrow-mesh fish nets JBL
Sand beaker VWR BURK7102-5000 5000mL
Brine shrimp separation beaker VWR BURK7102-2000 2000mL
Plastic zipper bag Roth P279.2 for dead fish storage
Pipetboy Integra 155000 model Pipetboy acu2
Parafilm P-Lab P701605
Air tubing www.zajac.de AQ380 4-6 mm diameter
1 L Glass bottle VWR 215-1595
2 L Glass bottle VWR 215-1596
500 mL Squeeze bottle Roth K665.1 for fish feeding with brine shrimp
120-μm brine shrimp strainer Florida Aqua Farms BB-PC2 for brine shrimp/bloodworm collection
Finish filter socks Aquaneering MFVB025C 25-μm
Central filtration fish housing system Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz

DOWNLOAD MATERIALS LIST

References

  1. Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. Non-canonical aging model systems and why we need them. EMBO J. 36, (8), 959-963 (2017).
  2. Harel, I., Brunet, A. The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane. Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).
  3. Smith, P., et al. Regulation of life span by the gut microbiota in the short-lived African turquoise killifish. Elife. 6, (2017).
  4. Cellerino, A., Valenzano, D. R., Reichard, M. From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology. Biol Rev Camb Philos Soc. 91, (2), 511-533 (2016).
  5. Kim, Y., Nam, H. G., Valenzano, D. R. The short-lived African turquoise killifish: an emerging experimental model for ageing. Dis Model Mech. 9, (2), 115-129 (2016).
  6. Blazek, R., et al. Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient. Evolution. 71, (2), 386-402 (2017).
  7. Terzibasi, E., et al. Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri. PLoS One. 3, (12), e3866 (2008).
  8. Kirschner, J., et al. Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research. Aging Cell. 11, (2), 252-261 (2012).
  9. Valenzano, D. R., et al. Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri. Genetics. 183, (4), 1385-1395 (2009).
  10. Reichwald, K., et al. Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish. Cell. 163, (6), 1527-1538 (2015).
  11. Valenzano, D. R., et al. The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan. Cell. 163, (6), 1539-1554 (2015).
  12. Harel, I., et al. A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate. Cell. 160, (5), 1013-1026 (2015).
  13. Valenzano, D. R., Sharp, S., Brunet, A. Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging. G3. 1, (7), Bethesda. 531-538 (2011).
  14. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nat Protoc. 11, (10), 2010-2028 (2016).
  15. Polacik, M., Blazek, R., Reichard, M. Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri. Nat Protoc. 11, (8), 1396-1413 (2016).
  16. Avdesh, A., et al. Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction. J Vis Exp. (69), e4196 (2012).
En protokoll for laboratoriet bolig av turkis Killifish (<em>Nothobranchius furzeri</em>)
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).More

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter