Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Ett protokoll för laboratoriet bostäder av turkos Killifish (Nothobranchius furzeri)

doi: 10.3791/57073 Published: April 11, 2018

Summary

Laboratoriet bostäder av turkos killifish kan skalas upp till huset och effektivt höja tusentals enskilda fiskar i ett centraliserat vattenfiltreringssystem, anställa den samma infrastruktur som används för standard zebrafiskar faciliteter. Här detalj vi en lista över standardiserade förfaranden som tillåter effektiv killifish underhåll.

Abstract

Utvecklingen av djurhållningspraxis i icke-modell laboratorium fisk som används för försöksändamål har vunnit stort från etableringen av referens fisk modellsystem, såsom zebrafisk och medaka. Under de senaste åren, har en framväxande fisk – den turkosa killifish (Nothobranchius furzeri) – antagits av ett växande antal forskargrupper inom biologi av åldrande och ekologi. Med en fångenskap livslängd på 4-8 månader, denna art är den shortest-lived ryggradsdjur upp i fångenskap och tillåter forskarsamhället att test – på kort tid – experimentell interventioner som kan leda till förändringar av den åldrande och livslängd. Ges unika biologi av denna art, kännetecknas av embryonala diapause, märkt explosiva sexuell mognad, morfologiska och beteendemässiga könsdimorfism- och deras relativt kort vuxen livslängd - ad hoc- djurhållning praxis är brådskande efterfrågan. Detta protokoll rapporterar en uppsättning viktiga djurhållning åtgärder som tillåter optimal turkos killifish laboratorium vård, aktivera forskarsamhället att anta denna art som en kraftfull laboratorium djurmodell.

Introduction

Med tanke på deras kort livslängd och snabba livscykel, är turkos killifish snabbt växande som lovande nya modellorganism i biologi1,2,3. Arten kännetecknas av en unik livscykel för en benfisk, bestående av embryonala diapause, snabb pubertetsutveckling och en utökad post-reproductive liv steg4,5. Senaste arbete har bidragit till att belysa biologin av denna art både i fångenskap och i vilda6,7. Turkos killifiskar lever i säsongens färska vattenförekomster som bildar under regnperioden i den afrikanska savannen i Zimbabwe och Moçambique. Under den torra säsongen överleva embryon i torra leran i avsaknad av vatten enligt en stress-resistant levnadsstadier som kallas diapause.

Genetiska kartor för denna art har varit genererade8,9, och nyligen sin arvsmassa har sekvenserade och monteras10,11. Flera inavlade laboratorium fisk stammar har utvecklats, och genmodifiering och arvsmassan redigering via CRISPR/Cas9 har blivit tillgängliga i denna art, de facto främja turkos äggläggande tandkarpar som konkurrenskraftiga laboratorium ryggradsdjur modellorganism 12,13,14.

Även om ett laboratorium protokoll har redan publicerats för denna art15, i detta protokoll utvecklar vi en omfattande lista över experimentell laboratorium riktlinjer som särskilt syftar till studier som undersöker åldrande och överlevnad. Detta protokoll kan forskare redan bekant med zebrafiskar och medaka djurhållning att bli insatt i turkos killifish djurhållning genom att anta ett minsta antal viktiga justeringar. På samma gång ger det här protokollet forskare utan tidigare erfarenhet i fisk djurhållning med nödvändiga verktyg för att höja en blomstrande turkos killifish koloni.

Protocol

Fisk är uppvuxen vid 28 ° C i ett recirkulerande system (se vattenvärdena), med 10-20% dagliga bevattnar förfogande. Tre olika tank storlekar rekommenderas: 0,8 L, 2,8 L och 9,5 L. Varje tank får ett konstant vattenflöde av 2 mL/s.

1. reagenser förberedelse (ingår ej i material)

Obs: Afrikansk turkos killifish (Nothobranchius furzeri) kan ges från en etablerad laboratorium lager. De årliga killifish uttorkning-resistenta embryona kan sändas per post. Det är viktigt att fartyget embryon inom 8-30 ° C temperaturområde.

  1. Förbereda humussyra (kläckning) lösning av upplösning 1 g/L humussyra i systemet vatten. Autoklav och förvaras vid 4 ° C i upp till 10 veckor.
  2. För att förbereda HUFA Artemia anrikning, lägga till HUFA anrikning Artemia hatcher dagligen vid en koncentration 500 µL/L Artemia lösning.
  3. Förbereda lösning av metylenblått genom upplösning 100 µL/L lösning av metylenblått lager i tidigare Ånghärdad system vatten. Eftersom metylenblått är ljuskänsliga, förvara lösningen i mörka flaskor eller Täck med folie. Butiken på RT.
  4. Förbereda kokos fiber som ett fast substrat för embryo inkubation. Alternativt använd ett filterpapper (avsnitt 1.5).
    1. Presoak kokos fiber med destillerat vatten. Autoklav och förvaras vid 4 ° C i upp till 5 veckor.
    2. På dagen för embryoöverföring, förbereda petriskål med fuktig kokos fiber.
    3. Fyll en 90 mm diameter petriskål med kokos fiber under dragskåp- och bredvid en flamma, att minska förorening av jäst och bakterier.
    4. Kompakt kokos fiber till en höjd av 1 cm, med steril vävnad. Ta bort de flesta av fukten från kokos fiber genom att trycka på en pappershandduk ovanpå plattan, att låta pappret för att absorbera överflödigt vatten. Värm en metall sked över lågan och tryck ned på hela ytan av kokosfibrer. Detta förhindrar kokos fiber svamp/bakteriell kontamination.
  5. Förbereda pappersfiltret som ett fast substrat för embryo inkubation.
    1. På dagen för embryon överföring, placera 3 lager av filterpapper diskar som passar 90-mm petriskål. Tillsätt 5 mL av humus acid lösningen för att hålla fukt.

2. avel

  1. Avel turkos killifish för stam underhåll
    Obs: Efter detta protokoll, Könsmognad nås vid ~ 4 veckor efter kläckning och fruktsamhet toppar mellan 7-9 veckor. Det är viktigt att Observera att fruktsamhet beror på utfodring frekvens och livsmedelskvalitet; Därför rekommenderas minst två utfodringar per formeringen tank dag att höja embryon avkastning (se avsnitt 5.6).
    1. Setup en 9,5 L avel tank. Fyll med system vatten och tillsätt en hane och två kvinnliga fisk.
    2. Som manlig afrikansk turkos killifish Visa dominans under parning, vilket kan leda till trakasserier av kvinnor, välja en hane med en något mindre kroppsstorlek än honan att minska parning stress och öka reproduktionskapaciteten. Ställa in 5 veckor gamla hanar med 6/7 veckor gamla Honor.
    3. Fyll en plastbehållare (10 x 10 x 5 cm) med Ånghärdad sand att nå ett slutgiltigt djup av ~ 2-3 cm och placera sandlåda i mitten av avel tanken.
    4. Låt turkos killifish ras kontinuerligt och skörda embryon en gång i veckan för embryo inkubering.
      Obs: Användningen av sand substrat innebär utmaningar till centraliserad filtreringssystem och bör ersättas med alternativa metoder i framtiden. Möjliga alternativ kunde vara att använda zebrafiskar avel tankar.
  2. Avel för genmodifiering
    Obs: Embryon ska användas för injektioner behöver synkroniseras på en-cell-scenen, och detta kräver att de samlas direkt efter befruktning.
    1. För att skörda cell-enstegs embryon för injektion och generering av transgena linjerna, ställa in en avel tank med en hane och två kvinnliga fiskar (samma som 2.1.).
    2. Två dagar före embryosamlingen, isolera manlign i en enskild tank och hålla hanen i visuell kontakt med vuxna honor.
    3. Lägg till hanen och en sandlåda till avel tank på dagen för samling, och låt dem leka för 2 h.

3. embryot djurhållning

  1. Embryosamlingsgruppen
    Obs: Embryosamlingsgruppen utförs av siktning och skörd embryon från sandlåda. Under normala förhållanden, bör varje sanden boxas innehåller från 30 till 200 embryon.
    1. Ta bort sanden boxas från avel tanken på dag då uppsamlingen. Töm sandlåda i en sil (~0.9 mm stam storlek) och skölj med vatten i systemet. Detta kan göras över en stor tank att samla sand för autoklavering.
    2. Delvis doppa silen i systemets vatten och snurra försiktigt, att låta embryona som gruppera i centrum.
    3. Samla in embryon med en 10 mL Pasteur-pipett.
    4. Överföra embryon till en 90 mm petriskål i ~ 40 mL system vatten.
    5. Inspektera embryon i petriskål under en ljus stereomikroskopet och ta bort de där brusten chorion och tecken på skada.
    6. Gå direkt till Embryo blekning.
      Obs: Använd alltid en sil per fisk stam för att förhindra potentiella cross-stam embryo föroreningar.
  2. Embryo blekning
    Obs: Embryo blekning förhindrar att mikroorganismer förekommer i fisk tank från att förorena inkubation media.
    1. Före blekning, använda en disponibel Pasteur-pipett ta bort systemets vatten från petriskål som innehåller insamlade embryon.
    2. För att förhindra oönskade svamp och bakteriella tillväxt, tillsätt 50 mL nyberedd H2O2 (1% v/v i Ånghärdad system vatten) de insamlade embryon.
    3. Skaka embryon för 5 min med en låg hastighet i 90 mm petriskålar i 50 mL lösning.
    4. Ta bort H2O2 lösning med disponibla Pasteur-pipett och tvätta embryon tre gånger för 5 min med 50 mL lösning av metylenblått. Ta bort lösning av metylenblått.
    5. Tillsätt 50 mL H2O2 (1% v/v i Ånghärdad system vatten) till embryon och skaka i 5 min.
    6. Ta bort H2O2 lösningen och tvätta tre gånger för 5 min med 50 mL lösning av metylenblått.
    7. Inkubera embryon vid 28 ° C att öka synkron embryon utveckling, med en maximal täthet 100 embryon per 90 mm petriskål i 40 mL lösning av metylenblått.
      Obs: Inte utökar embryo inkubation i blekning lösningen. Detta kan orsaka skador på ägg chorion och öka embryo dödlighet. Embryo blekning kan orsaka stora fysikalisk-kemiska förändringar i ägg chorion som kan leda till förändrad chorion fysiologi och kläckning framgång.
  3. Embryo inkubation i metylenblått
    Obs: Flytande inkubation i lösning av metylenblått förhindrar parasit tillväxt och möjliggör detektering av döda embryon och Obefruktade ägg.
    1. Inspektera ruvade embryon, ta bort alla döda embryon (färgas blå av metylenblått) från petriskål att förhindra svamp- och bakteriella föroreningar som påverkar överlevnaden av levande friska embryon.
    2. Ta bort gamla lösning av metylenblått och ersätta med färsk lösning.
    3. Returnera petriskål till 28 ° C inkubator (figur 1A). Inom 7-10 dagar, se till att de utveckla embryona visar synliga svarta ögon. Överföra dessa embryon till coconut fiber eller filterpapper fasta substrat medium (figur 1B).
    4. Behålla outvecklade embryon i metylenblått, dagligen övervaka och överföra till fasta substrat medium när svarta ögon har utvecklat.
    5. Upprepa steg 3.3.1-3.3.3 dagligen tills embryon har synliga svarta ögon.
      Obs: Konstant exponering av embryon för metylenblått kan inducera långsiktiga förändringar i vuxen fisk fysiologi.
  4. Embryotransfer till filterpapper
    Obs: Turkos killifish embryon kan utvecklas på ett torrt substrat, går igenom naturliga förhållanden. Dessutom möjliggör torr embryo inkubation forskare att synkronisera embryon och kläcker dem samma dag.
    1. Som utvecklade embryon har synliga svarta ögon inom 7-10 dagar, Använd en disponibel Pasteur-pipett eller fina böjd pincett för att överföra embryon från metylenblåttlösningen på tidigare beredda filterpapper plåt.
    2. Sprida embryon ~ 5 mm mellanrum med pincett, upp till 100 embryon per 90 mm platta (figur 1B).
    3. Försegla petriskål med parafilm.
    4. Inkubera embryon vid 28 ° C i 2-3 veckor, tills de har fullt utvecklad gyllene iris och är klara för kläckning (figur 1 c).
      Obs: Inte förlänga inkubation av redo-till-lucka embryon längre än 2 veckor som deras bärkraft minskar dramatiskt.
  5. Embryotransfer till coconut fiber
    Obs: Autoklaveras, sterila kokos fiber (eller organiskt torv) kan användas som en giltig alternativt medium för fasta substrat inkubering.
    1. Använd en disponibel Pasteur-pipett eller fina böjd pincett för att överföra embryon från metylenblåttlösningen på en ready-to-use kokos fiber tallrik.
    2. Sprida embryon ~ 5 mm mellanrum, upp till 100 embryon per 90 mm platta (figur 1B).
    3. Försegla petriskål med parafilm.
    4. Inkubera embryon vid 28 ° C i 2-3 veckor, tills de har fullt utvecklat gyllene Iris (t.ex. i figur 1 c).
      Obs: För långsiktig lagring (upp till ett år), överföra embryon på 3-dagars inlägg collection från metylenblått lösningar till en solid-substrat platta på 17 ° C. Inkubera embryon tills de utvecklar svarta ögon.

4. kläckning turkos Killifish

Obs: Turkos killifish embryon kan framgångsrikt kläckas i en humus syralösning14.

  1. Med fina böjd pincett, utvecklas överföring noggrant 50-100 embryon till kläckning rutan fylld med humus acid lösningen vid 4 ° C. Humus acid lösningen består av 1 g/L humussyra i systemets vatten. Autoklav och förvaras vid 4 ° C i upp till 10 veckor. Kontrollera att alla embryon är helt nedsänkt. Humus acid lösningen måste vara grunt, inte djupare än 2 cm.
    Obs: Låg temperatur av humus acid lösning förbättrar kläckning och fullständig nedsänkning av embryon i lösningen tillåter synkroniserad kläckning.
  2. Placera rutan kläckning i 28 ° C kläckning inkubatorn. Täcka kläckning rutan med locket. För att leverera tillräcklig luftning, ansluta kläckning rutan slangar med lufttillförsel.
    Obs: Inte tillräcklig luftning under ruvningen resulterar i höga andelen stek inte kunna fylla gas urinblåsan (”belly-reglaget” fenotyp, se anmärkning i avsnitt 5.1)
  3. Från dagen efter kläckningen, för att bibehålla adekvat vattenkvaliteten i rutan kläckning, tillsätt Ånghärdad system vatten en gång om dagen i förhållandet 1:1, att hålla ett sista djup av 2 cm.
  4. Överföra okläckta embryon tillbaka till det fasta underlagsmaterialet och försök kläckning en vecka senare.
    Obs: Efter kläckningen turkos killifish klarar lätt att upptag och konsumera levande föda. För optimal tillväxt, mata yngel två gånger per dag med överskott nymalen kläckt Artemia (Artemia salina). Tecknet för full mättnad är de orange-färgade magar av yngel efter 10-15 min var utfodringen. Suga ut det överskjutande, överblivet och nedbrutet Artemia använder en Pasteur-pipett på en daglig basis.

5. öka juvenil och Adult fisk

  1. Fem dagar efter kläckningen, flytta ungfisk i vattensystemet re-cirkulation. Med disponibel plast pipetter (eller en plastsked), noggrant överföring fem exemplar per 0,8 L tank utrustad med 400 µm fry skärm (figur 2).
    Obs: Det är möjligt att en del av juvenil killifish inte kommer har fyllt gas urinblåsan, vilket resulterar i en typisk ”belly-reglaget” fenotyp, kännetecknas av fisk inte når riktigt bärighet, tvingar dem att kontinuerligt bada, orsakar svåra missbildningar i vuxna fiskar. Dessa fiskar kan inte användas för överlevnad analyser eller för effektiv avel och behöver censureras.
  2. Mata ungfåglar två gånger per dag med nymalen kläckt Artemia i överskott fram till 14 dagar efter kläckningen. Suga ut skräp från botten av varje tank dagligen.
  3. Vid 14 dagars ålder, överföring ungfisk till 2,8 L tank utrustad med en 850 µm fry skärm. Från denna punkt framåt, etikett varje tank med fish ID, angivande av hatch, stam information, fisk kön och fisk identifikationsnummer (figur 3). För överlevnad analyser, individuellt hus varje fisk i inre tankar från denna punkt och framåt.
  4. Under de följande 7 dagarna, mata ungfåglar två gånger per dag med ~ 2 mL Artemia per fisk. I detta skede fisk kan kompletteras med 1-3 levande blod maskar (om blod masken larverna är för stor för fisken, hacka dem i mindre bitar med ett rakblad). För att förebygga en försämring av vattenkvaliteten, suga ut matrester och ytterligare avfall två gånger per vecka.
  5. Efter 3 veckor från kläckning bort fry skärmen på baksidan av tanken och börjar mata varje fisk två gånger per dag ~ 2mL Artemia och 0,5 mL av blod mask. I detta skede ungfisk bör ha nått 1 cm i kroppsstorlek och bör kunna intag av full-size blod mask.
  6. Vid 4 veckors ålder, mata varje fisk två gånger per dag med ~ 2mL av Artemia och 1 mL blod mask. Honor kan hållas tillsammans på en densitet på upp till 3 honor per 2,8 L tank.
  7. Se till att fisk når fullständig sexuell mognad i detta skede. Kontrollera förekomsten av stora dorsal-, anal- och stjärtfenan fenor med tecken på färgning hos hanar och runda magar full av ägg i honor.
    Obs: Att höja vuxen fisk i individuella tankar för överlevnad kohortstudier kan inverka negativt fisk beteende och hälsa. Gruppboende för överlevnad kohortstudier lägger dock betydande störfaktorer på grund av inrättandet av social dominans och manliga territorier, vilket leder till stränga sociala hierarkier.

6. utfodring

Obs: Laboratorium turkos killifish kan matas en kombination av baby Artemia (Artemia salina följande) och blood worm (Chironomus spp. larver). Turkos killifish Ynglen utfodras uteslutande baby Artemia. Juvenil och adult fisk utfodras dagligen både Artemia och blod mask (figur 2). Fisk kan matas flera gånger om dagen, överstiger de 2 utfodringarna idealiskt, som anges i detta protokoll.

  1. Odla Artemia
    1. Lägga till 10 L av omvänd osmos (RO) och 350 g Röda havet salt till en Artemia hatcher och lös upp genom luftning med en luftning röret.
    2. Berika kulturen med 5 mL mycket omättade fettsyror (HUFA).
    3. Tillsätt 20 g Artemia cystor i kläckning lösning. Inspektera att Artemia cystor inte flyta på ytan av vattnet och säkerställa ordentlig syresättning och cirkulation av kulturen.
      Obs: Dagliga portioner av torr Artemia cystor kan lagras vid 4 ° C.
    4. På eftermiddagen nästa dag, leverera kulturen med en annan alikvot av 5 mL HUFA.
  2. Skörda kläckt Artemia
    Obs: Efter ~ 36 h från start kultur, Artemia är färdiga för skörd (instar II fas).
    1. Samla 5 L av kultur i en behållare med kranen på undersidan av hatcher och låt sitta i 10 min.
    2. Efter 10 min, ta bort Artemia beskjuter (brun färg) från toppen av behållaren 5 L och filtrera de kläckt Artemia (orange färg) genom en maska. Betala uppmärksamhet att utesluta det sediment som hittade på botten av behållaren som innehåller icke-kläckt ägg och döda Artemia.
    3. Skölj kläckt Artemia med RO vatten i en 2 L behållare och låt sitta i 10 min.
    4. Efter 10 min, filtrera Artemia igen genom en maska och samla i 2 L av RO vatten.
    5. Upprepa föregående tre steg tills Artemia lösning är fritt från icke-hatched cystor och Artemia skal.
    6. Överföra Artemia 2 L behållare i squeeze flaskor för utfodring.
      Obs: Odla Artemia är ganska robust och pålitlig. För att undvika brist på Artemia vid misslyckade kläckning, dock användas mindre (500 mL) backup kläckningsmaskiner.
  3. Ställa in den backup hatcher
    1. Lös upp 17,5 g Röda havet salt i 500 mL RO vatten genom luftning.
    2. Berika kulturen med 500 µL av HUFA.
    3. Tillsätt 2 g Artemia cystor.
    4. Efter 18-24 h, leverera kulturen gång med 500 µL av HUFA.
      Obs: Artemia är redo att skörda efter ~ 24 h.
  4. Beredning av levande blod mask
    1. Omedelbart före utfodring, filtrera en lämplig mängd blod masken genom en sil med RO vatten.
      Obs: Levande blod mask kan lagras vid 4 ° C i 7-10 dagar.
    2. Skölj blod mask med en liten mängd RO vatten in i en plastbehållare.
    3. Med en plast Pasteur pipett (smal spets bort), ta upp blod mask blandningen för utfodring.
      Anmärkning: Utfodring laboratorium killifish kolonier med levande föda från FN-kontrollerade källor lägger till en risk för externa föroreningar från parasiter och potentiellt patogena mikrobiella samhällen. I framtiden, bör en ad hoc-sterila fiskfoder utarbetas.

7. killifish laboratorium stam genotypning

Obs: För att skilja mellan turkos killifish stammar, samt att avgöra kön inom varje stam, specifika genetiska (mikrosatellit) markörer kan användas9 (tabell 1).

  1. Provtagning
    1. Håll fisken ordentligt i ett netto på toppen av våt svamp.
    2. Svabba 2-3 skalor från fisk kroppen från operculum till den stjärtfenan som använder bomullspinnar.
    3. Plocka skalor från pinnen och överföra 2-3 skalorna i en 1 mL tub som innehåller NaOH-lösning (200 µL 0,5 mol/L NaOH, 1% β-merkaptoetanol och 0,5% polyvinyl-pyrrolidon).
    4. Snurra de PCR-rören för 15 s Kontrollera att skalorna är helt nedsänkt i NaOH-lösningen.
  2. Genomiskt DNA isolering
    1. Inkubera provet för 20 min vid 95 ° C.
    2. Cool på RT, neutralisera provet med 1/10 volym 1 M Tris-HCl, pH 8,0.
    3. Centrifugera provet för 5 min i full fart.

8. vatten parametrar

Obs: Djurhållning av organismer vars avsedd användning är vuxen fenotypning kräver mycket stabil djurhållning villkor under hela livslängden målarter. Därför kräver odlingsskålar vatten organismer, såsom turkos killifish, strikt kontroll av vattenvärdena. Vatten cirkulation, med ytterligare fyra-steg vatten filtrering, säkerställer en stabil grund för att uppnå kontroll över vatten parametrar, som ger alla tankar med samma vatten villkor över tid. Det rekommenderas att rekonstruera systemets vatten från omvänd-osmos (RO) vatten, läggas med kommersiell Marina salt och bikarbonat.

  1. Vatten penningcirkulationen system system: först, avloppsvatten från fisk tankar flödar genom fasta partiklar metall filter som fångar alla un-ätit mat skräp och större partiklar. Metall filter sköljs tre gånger i veckan; För det andra, efter första mekanisk filtrering, vatten är förmedlas i stora sumps och sedan pumpas till ett biofilter, där bakterierna omvandlar ammoniak till nitriter och nitrater; Det tredje från biofiltret pumpas vattnet till 25 µm filter ärmar, som fångar finare storlek partiklar. Slutligen, vattnet strömmar genom ultraviolett (UV) lampor som sterilisera vatten från bakterier och virus. Efter dessa fyra steg, filtrerat vatten återvänder till fisketankar.
  2. För att minska mikroorganism tillväxt i tankarna, förhindra ansamling av nitrater och minska total avyttras salthalt, 10-20% av systemets vatten på en daglig basis.
  3. Bevara vatten temperatur konstant vid 28 ° C, vatten pH konstant inom intervallet 7.0 till 7.5.
  4. Även om killifiskar tolerera brett utbud av salthalt, för att undvika oodinosis, upprätthålla ledningsförmåga inom intervallet 650-710 mikro-Siemens. En årslång 12 h ljus/mörk cykel säkerställer kolonin hälsa och produktivitet.
    Obs: Killifish tål vatten ledningsförmåga upp till 1500 mikro-Siemens.

Representative Results

Turkos killifish korrekt djurhållning resulterar i median överlevnad mellan 12-18 veckor i GRZ stam (t.ex. figur 4A). Varianter av median överlevnad beror på diet, utfodring frekvens och temperatur boendeförhållanden. Dålig djurhållning resultat i överlevnadskurvor presenterar ökade tidig dödlighet och repetitiva, plötsliga droppar överlevnad hela tiden, som kännetecknas av flera Böjningar points (figur 4B).

Figure 1
Figur 1: representativa embryonala utvecklingsstadier med respektive inkubation substrat. (A) insamlade färska embryon, inkuberas i lösning av metylenblått i inkubatorn vid 28 ° C. (B) embryon redo att överföras till fast medium, antingen filtrera papper eller kokos fiber. (C) embryon är redo för att kläckas, visar typiska gyllene Iris. Skalstapeln uppgår till 1 mm. vänligen klicka här för att visa en större version av denna siffra.

Figure 2
Figur 2: stadier av turkos killifish efter kläckning utveckling. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: representativa fisk ID tag för fisk från steg 3 och framåt. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: representativa survival kurvan för 70 manliga turkos killifish. (A) typiska survival kurvan för laboratorium raised turkost killifish. (B) jämförelse av överlevnadskurvor erhållits från fisk som tas upp under optimala djurhållning förhållanden (svart) och dålig djurhållning (röd och blå). Den streckade röda horisontella linjen indikerar 50% överlevnad, korsande survival kurvan vid median livslängd (anges på x-axeln). Klicka här för att se en större version av denna siffra.

ID Forward primer Reverse primer Storlekar (bp)
* NfuSU0007 GGCTAAGCCTTGCTGACAGA CAGGGAGCTGAAAACCTCAG 166 - 214
* NfuSU0010 CGCAGTCTGATCAAATCGTGT TGTTTGAAGGTTCACATTCATTATC 220 - 272
NfuSU0016 CATGGCTAAACCGTGATGAA GAAGGACGCCAGCTATGAAG 209 - 240
NfuSU0022 AACACAGCTCTCGTAAGGAGGTA TTCAGACTTGTCTTACTACCATGTTT 198 - 238
NfuSU0027 TCCAGCTGAATCGGTAATGA AAACTCGAGGGTGCAATCTG 164 - 226
NfuSU0049 CTGGACAAAGTGCCAATCAC CTCCCACAGTCCCAAAACAT 196 - 197
NfuSU0050 CCAGAATGAACAATACTCAGATCAA GCAGCTTAGTTTAATGATATCACAATG 252 - 295
NfuSU0060 CTAGCCACTCCCCTGGTTTA CCGTCACGATGTGCTGATAC 216 - 248
NfuFLI0030 CAGAAGCTAAAGGCCAGACG GGGAAACAATAGGGAACCAC 174 - 205
* NfuFLI0091 ACGCTGACTCTACCCAGTC CTGCCTGCTACTGACAATG 355 - 373
* - sex bestämning markörer

Tabell 1: Genotypning primers för stam identifiering.

Discussion

Vi beskriver ett protokoll för laboratoriet odling av turkos killifish, inklusive embryosamlingen, inkubation, samt vuxna fiskar bostäder, avel och utfodring. Våra protokoll är specifikt riktad till laboratorier som bedriver forskning som fokuserar på vuxna fiskar, särskilt för experimentella studier på åldrande och livslängd. Turkos killifish kan höjas på en standard zebrafiskar anläggning; viktiga aspekter av killifish djurhållning skiljer sig dock från standard zebrafiskar vård16. Dessa justeringar innefattar tidig övergång från en Artemia enda kost till en kost kompletteras med proteinrika blod mask, liksom specifika steg i embryo inkubation, bestående av en flytande och torra inkubation scenen.

Kritiska steg inom protokollet omfatta frakt embryon inom 8-30 ° C temperaturområde. Vid avel beror fruktsamhet på utfodring frekvens och livsmedelskvalitet; Därför rekommenderar vi minst två utfodringar per formeringen tank för att höja embryon avkastning (se avsnitt 5.6) dag. Under embryo blekning, omfatta inte embryot inkubation i blekning lösningen. Detta kan orsaka skador på ägg chorion och ökad embryo dödlighet. När ruvning embryon med metylenblått, inte att förlänga inkubation av redo-till-lucka embryon längre än 2 veckor som deras bärkraft minskar dramatiskt. För kläckning turkos killifish, låg temperatur av humus acid lösning förbättrar kläckning och fullständig nedsänkning av embryon i lösningen tillåter synkroniserad kläckning. Inte tillräcklig luftning under inkubation resultaten i höga andelen stek inte kunna fylla gas urinblåsan (”belly-reglaget” fenotyp, se kommentarer i avsnitt 5.1).

Begränsning av protokollet för avel inkluderar användning av sand substrat som utgör utmaningar för centraliserad filtreringssystem och bör ersättas med alternativa metoder i framtiden. Möjliga alternativ kunde vara att använda zebrafiskar avel tankar. Embryo blekning kan orsaka stora fysikalisk-kemiska förändringar i ägg chorion som kan leda till förändrad chorion fysiologi och kläckning framgång. Konstant exponering av embryon för metylenblått kan medföra långsiktiga förändringar hos vuxna fiskar fysiologi. Att höja vuxen fisk i individuella tankar för överlevnad kohortstudier kan negativt påverka fisk beteende och hälsa. Gruppboende för överlevnad kohortstudier lägger dock betydande störfaktorer på grund av inrättandet av social dominans och manliga territorier, vilket leder till stränga sociala hierarkier. Vi bedömer därför att isolering av manliga fisk för överlevnad studier är en rimlig kompromiss. Utfodring laboratorium killifish kolonier med levande föda från FN-kontrollerade källor lägga till en risk för externa föroreningar från parasiter och potentiellt patogena mikrobiella samhällen. I framtiden, bör en ad hoc-sterila fiskfoder utarbetas.

Framtida förbättringar av detta protokoll kommer att fokusera på en kontrollerad, icke-levande diet, som fortfarande leder till att slutföra sexuell mognad inom 3-4 veckor. Sammanfattningsvis erbjuder våra protokoll tillgänglighet till turkos killifish laboratorium odling till en bred vetenskaplig gemenskap.

Disclosures

Alla författarna förklarar inget konkurrerande finansiella och icke-finansiella intressen.

Acknowledgments

Vi tacka Alessandro Cellerino, Tyrone Genade, Anne Brunet, Sabrina Sharp, Mickie Powell, Simone Keil, Yumi Kim, Patrick Smith, Kai Mathar och alla medlemmar av Valenzano labbet vid Max Planck-institutet för biologi för åldrande för att bidra till olika aspekter av det nuvarande killifish djurhållning protokollet under åren.

Materials

Name Company Catalog Number Comments
Probe calibration buffer solution pH=7.0 Roth A518.1 1L buffer solution pH=7.0 to calibrate water system pH-electrode
Probe calibration buffer solution pH=4.0 Roth P712.1 1L buffer solution pH=4.0 to calibrate water system pH-electrode
Conductivity standard VWR 83607.260 500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode
Easy Strips Test 6in1 JBL 2533900 Test strips for determination chlorine values of system water
Ammonia Test JBL 2536500 Test to determine ammonia content of system water
Red Sea Salt Red Sea 22 kg bucket
Sodium hydrogen carbonate VWR 27780.360
Humic acid Sigma- Aldrich 53680-50G
New HUFA Artemia enrichment ZM Systems UK 75g bottle
Methylene blue Roth AE64.1
Hydrogen peroxide solution Sigma- Aldrich 31642-1L 30% (w/w)
Coconut fiber Dragon ZCS010
Whatman paper GE healthcare 3030-690
Ethanol pure VWR 20821.467 100%
Silica sand local pet shop
Artemia Eggs Premium Grade Sanders
Bloodworm local distributor Poseidon Aquakultur Germany
dNTPs solution mix Biolabs N04472 10mM
Taq DNA polymerase Invitrogen 18038-042 5U/uL
PCR 10x Buffer Invitrogen 18038-042
MgCl2 Invitrogen 18038-042 50mM
NaOH Sigma- Aldrich S8045-500g 50mM
Tris-HCl, pH=8.0 solution Sigma- Aldrich T2694-1L 1M
HCl 37% Sigma- Aldrich H1758-500mL
Fish tanks Aquaneering volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids
Orbital shaker VWR 89032-100 model 5000
Microbiological incubator Thermo Scientific, Heratherm 50125882 model IMC18; for storage embryos in the liquid phase, set to t=27-28°C
Cooling Incubator Binder 9020-0209 model KT115; for storage embryos in the solid phase, set to t=27-28°C
Hatching incubator Thermo Scientific, Heratherm 51028114 model OGS180; for embryos hatching, set to t=27-28°C
Stereomicroscope Leica model M80
Breeding sand/hatching boxes Roth 1598.1 1000mL
Petri dish Sarstedt 82.1473 92x16mm
50 mL Conical tube Sarstedt 62.547.254
15 mL Conical tube Sarstedt 62.554.002
Disposable Plastic Pasteur pipette Roth EA71.1 2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter
Serological pipette Sarstedt 86.1689.001 50mL
Syringe Henke Sass Wolf 4100-000V0 10mL
Metal strainer fineness <1mm; for embryos collection
Tweezers Dumont 0508-5/45-PO type5/45; for embryos transfer
25 L Brine shrimp hatcher Aquaneering ZHBS25 main hatcher
500 mL Brine shrimp hatcher JBL 6106100 model Artemio 1; backup hatcher
Narrow-mesh fish nets JBL
Sand beaker VWR BURK7102-5000 5000mL
Brine shrimp separation beaker VWR BURK7102-2000 2000mL
Plastic zipper bag Roth P279.2 for dead fish storage
Pipetboy Integra 155000 model Pipetboy acu2
Parafilm P-Lab P701605
Air tubing www.zajac.de AQ380 4-6 mm diameter
1 L Glass bottle VWR 215-1595
2 L Glass bottle VWR 215-1596
500 mL Squeeze bottle Roth K665.1 for fish feeding with brine shrimp
120-μm brine shrimp strainer Florida Aqua Farms BB-PC2 for brine shrimp/bloodworm collection
Finish filter socks Aquaneering MFVB025C 25-μm
Central filtration fish housing system Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz

DOWNLOAD MATERIALS LIST

References

  1. Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. Non-canonical aging model systems and why we need them. EMBO J. 36, (8), 959-963 (2017).
  2. Harel, I., Brunet, A. The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane. Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).
  3. Smith, P., et al. Regulation of life span by the gut microbiota in the short-lived African turquoise killifish. Elife. 6, (2017).
  4. Cellerino, A., Valenzano, D. R., Reichard, M. From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology. Biol Rev Camb Philos Soc. 91, (2), 511-533 (2016).
  5. Kim, Y., Nam, H. G., Valenzano, D. R. The short-lived African turquoise killifish: an emerging experimental model for ageing. Dis Model Mech. 9, (2), 115-129 (2016).
  6. Blazek, R., et al. Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient. Evolution. 71, (2), 386-402 (2017).
  7. Terzibasi, E., et al. Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri. PLoS One. 3, (12), e3866 (2008).
  8. Kirschner, J., et al. Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research. Aging Cell. 11, (2), 252-261 (2012).
  9. Valenzano, D. R., et al. Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri. Genetics. 183, (4), 1385-1395 (2009).
  10. Reichwald, K., et al. Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish. Cell. 163, (6), 1527-1538 (2015).
  11. Valenzano, D. R., et al. The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan. Cell. 163, (6), 1539-1554 (2015).
  12. Harel, I., et al. A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate. Cell. 160, (5), 1013-1026 (2015).
  13. Valenzano, D. R., Sharp, S., Brunet, A. Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging. G3. 1, (7), Bethesda. 531-538 (2011).
  14. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nat Protoc. 11, (10), 2010-2028 (2016).
  15. Polacik, M., Blazek, R., Reichard, M. Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri. Nat Protoc. 11, (8), 1396-1413 (2016).
  16. Avdesh, A., et al. Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction. J Vis Exp. (69), e4196 (2012).
Ett protokoll för laboratoriet bostäder av turkos Killifish (<em>Nothobranchius furzeri</em>)
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).More

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter