Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Immunoprecipitazione della cromatina (ChIP) di modificazioni istoniche da Saccharomyces cerevisiae

doi: 10.3791/57080 Published: December 29, 2017

Summary

Qui, descriviamo un protocollo per immunoprecipitazione della cromatina degli istoni modificati dal lievito Saccharomyces cerevisiae. DNA immunoprecipitato viene successivamente utilizzato per PCR quantitativa per interrogare l'abbondanza e la localizzazione di modifiche post-traduzionali degli istoni in tutto il genoma.

Abstract

Modificazioni post-traduzionali degli istoni (PTM), quali acetilazione, metilazione e fosforilazione, sono regolate dinamicamente da una serie di enzimi che aggiungono o rimuovono questi segni in risposta ai segnali ricevuti dalla cellula. Questi PTMS sono contributori chiave per la regolazione di processi come controllo di espressione genica e di riparazione del DNA. Immunoprecipitazione della cromatina (chIP) è stato un approccio strumentale per l'abbondanza e la localizzazione di molti istone PTMs in tutto il genoma in risposta alle diverse perturbazioni alla cella di dissezione. Qui, un metodo versatile per l'esecuzione di chIP degli istoni traduzionalmente modificati dal lievito Saccharomyces cerevisiae (S. cerevisiae) è descritto. Questo metodo si basa sulla reticolazione delle proteine e del DNA tramite trattamento di formaldeide delle colture di lievito, generazione di lisati di lievito da perlina battendo, solubilizzazione dei frammenti di cromatina di nucleasi di micrococcal e l'immunoprecipitazione di istone-DNA complessi. DNA associato con il contrassegno dell'istone di interesse è purificato e sottoposti ad analisi quantitativa di PCR per valutare il suo arricchimento a più luoghi in tutto il genoma. Rappresentante esperimenti sondando la localizzazione dei contrassegni dell'istone H3K4me2 e H4K16ac nel wildtype e lievito mutante sono discussi per dimostrare l'interpretazione e l'analisi dei dati. Questo metodo è adatto per una varietà di istone PTMs e può essere eseguito con diversi ceppi mutanti o in presenza di diversi stress ambientali, che lo rende un ottimo strumento per indagare i cambiamenti nella dinamica della cromatina in condizioni diverse.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La modificazione post-traduzionale dinamico (PTM) degli istoni è un meccanismo normativo fondamentale per molti processi basati su modelli del DNA, compreso trascrizione, replicazione e riparazione del DNA1,2. La capacità di determinare l'abbondanza e la localizzazione precisa degli istoni modificati concomitanti con questi processi è quindi fondamentale per comprendere la loro regolazione in condizioni diverse nella cella. Lo sviluppo di immunoprecipitazione della cromatina (chIP) come metodo derivavano in gran parte da studi biochimici delle interazioni delle proteine con DNA, particolarmente in vitro metodi utilizzando reticolanti chimici, accoppiato con la necessità di valutare la natura dinamica delle interazioni proteina-DNA in vivo e in regioni specifiche del genoma3,4,5. L'avanzamento della PCR quantitativa (qPCR) e tecnologie di sequenziamento ha inoltre ampliato la possibilità di eseguire esperimenti di chIP con confronti quantitativi e attraverso interi genomi, che lo rende un potente strumento per dissezione interazioni della DNA-proteina a livelli multipli.

Attualmente, il chIP è un metodo richiesto per qualsiasi gruppo di ricerca interessato a regolazione della cromatina-mediata del genoma come non esistono metodi comparabili per interrogare direttamente il collegamento fisico tra un istone modificato e un locus genomico specifico in vivo. Anche se le varianti di questo metodo utilizzando il sequenziamento di nuova generazione per mappare le modifiche dell'istone in tutto il genoma6,7 sono disponibili, questi approcci possono riguardare diversi quesiti scientifici e loro scala, costo e risorse tecniche possono essere limitante per alcuni gruppi di ricerca. Inoltre, è necessario completare questi mirati chIP-qPCR approcci fornendo metodi ad entrambi ottimizzano il protocollo chIP prima del sequenziamento e per convalidare i risultati dei set di dati epigenomic. Spettrometria di massa basato su approcci per identificare la serie completa di istone marchi associati a regioni genomiche hanno anche emerso8,9,10,11, tuttavia, questi gli approcci hanno alcune limitazioni per quanto riguarda cui regioni del genoma possono essere sondate e richiedono competenze tecniche e la strumentazione che non sarà disponibile per tutti i gruppi di ricerca. Di conseguenza, chIP rimane un metodo fondamentale per analizzare l'abbondanza e la distribuzione delle modifiche dell'istone in condizioni diverse per tutti i gruppi di ricerca interessati a epigenetics, cromatina e regolazione delle funzioni genomiche.

Qui, descriviamo un metodo per modello chIP usando il lievito gemmante Saccharomyces cerevisiae (S. cerevisiae) per studiare la distribuzione delle istone PTMs a cromatina. Questo approccio si basa su una serie di componenti di base dei protocolli di chIP sviluppato in lievito e applicato anche al modello diversi sistemi12,13. Interazioni tra modificate gli istoni e il DNA nella cella sono conservate di reticolazione con formaldeide. Dopo la preparazione del lysate, frammenti di cromatina sono solubilizzati in frammenti di dimensioni medie uniformemente tramite digestione con nucleasi di micrococcal. Immunoprecipitazione degli istoni modificati è effettuato con gli anticorpi commerciali o laboratorio-generato e qualsiasi DNA associato è isolato e analizzato per arricchimento alle regioni genomiche particolare utilizzando qPCR (Figura 1). Per molte modificazioni istoniche, la quantità di DNA ottenuto da questo protocollo è sufficiente per il test più di 25 differenti loci genomici qPCR.

Questo metodo di chIP è altamente versatile per monitorare la distribuzione di una modifica dell'istone singolo attraverso diversi ceppi mutanti o condizioni ambientali, o per le prove multiple modificazioni istoniche in wildtype cellule in un certo numero di loci genomici. Inoltre, numerosi componenti del protocollo sono facilmente regolabili per ottimizzare il rilevamento di entrambi altamente - o umili-abbondante contrassegni dell'istone. Infine, esecuzione di chIP degli istoni modificati nel lievito gemmante offre l'opportunità di utilizzare controlli essenziali per la specificità dell'anticorpo in gran parte non disponibili in altri sistemi. Vale a dire, ceppi di lievito possono essere generati che portano mutazioni puntiformi nei residui di istone che sono mirati per la modifica, e, in alcuni casi, c'è solo un singolo enzima che catalizza la seguente modifica su un residuo di istone particolare (ad es. lisina dell'istone methyltransferases). Di conseguenza, chIP può essere eseguita in entrambi l'istone mutante o enzima eliminazione ceppi di saggiare la misura in cui legame non specifico dell'anticorpo può essere che si verificano e generare falsi positivi. Questo controllo è particolarmente prezioso per gli anticorpi di nuova concezione e può anche essere utilizzato per convalidare la specificità dell'anticorpo per le modifiche dell'istone conservati prima del loro utilizzo in altri sistemi. Questo approccio si integra con altri metodi per verificare la specificità dell'anticorpo che distinguono tra Stati di diverse modifiche (ad esempio mono-, di - e tri-metilazione), tra cui matrici di peptidi modificati di sondaggio e l'esecuzione di western blot degli istoni o nucleosomi con modifiche definite. Nel complesso, il chIP nel lievito gemmante è un potente metodo per valutare le dinamiche dell'istone PTMs in tutto il genoma e meccanismi che governano il loro regolamento di dissezione.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. pre-legano anticorpi biglie magnetiche

  1. Mescolare bene i branelli magnetici di proteina A/G e trasferire 20 µ l di biglie magnetiche per una immunoprecipitazione (IP) campione in una provetta da 1,5 mL.
    Nota: Quando si pipetta perline, utilizzare wide-bore, bassa ritenzione suggerimenti.
  2. Collocare la provetta con perline in un supporto magnetico e consentire perline raccogliere sul lato del tubo. Eliminare il surnatante.
  3. Lavare le perle 3 volte con 1 mL di soluzione fisiologica tamponata freddo (TBS) (50 mM Tris-HCl pH 7.5, 150 mM NaCl).
  4. Aggiungere 200 µ l di TBS a perline e appropriata quantità di anticorpo. Ruotare a 8 giri durante la notte a 4 ° C.
    Nota: Per molti anticorpi PTM istone, 1-3 µ g di anticorpo a IP è sufficiente. Tuttavia, esperimenti di titolazione sono raccomandati per determinare concentrazioni appropriate. Le concentrazioni consigliate per anticorpi anti-istone ben caratterizzati, commerciale PTM sono spesso accurate e possono essere trovate in rapporti pubblicati o documentazione del prodotto.
  5. Posizionare le perline in un supporto magnetico e rimuovere il surnatante. Lavare con 1 mL di TBS.
  6. Risospendere le sfere in 20 µ l di TBS per campione IP più un ulteriore 5 µ l (in caso di errore di pipettaggio) di TBS.
    Nota: Le perle possono essere memorizzate a breve termine a 4 ° C fino all'utilizzo.

2. crescere cellule di lievito

  1. Inoculare 10 mL di YPD (Estratto di lievito 10%, 20% peptone e 20% destrosio) con una singola Colonia del ceppo appropriato e crescere a 30 ° C durante la notte in un incubatore d'agitazione a 220 giri/min.
  2. Misurare la densità ottica a 600 nm (OD600) della cultura lievito utilizzando uno spettrofotometro. Diluire la cultura a un OD600 = 0.2 in 100 mL di YPD in un fiasco di nuovo.
  3. Crescere le cellule a 30 ° C in un incubatore d'agitazione a 220 giri/min fino a quando non raggiungono la fase di Mid-registro (OD600 = 0.6-0.8).

3. in Vivo reticolazione delle proteine a DNA

  1. Quando culture raggiungono la fase di Mid-registro, aggiungere 2,7 mL di formaldeide al 37% direttamente al mezzo, per una concentrazione finale di 1% di formaldeide. Trasferire il pallone a un agitatore a 25 ° C (o a temperatura ambiente) e scuoterlo a 50 rpm per 15 min.
  2. Aggiungere 5 mL di 2,5 M glicina al medium e continuare ad agitare a 50 giri/min a temperatura ambiente per 5 min placare la formaldeide.
  3. Trasferire le cellule per centrifugare bottiglie e far girare le cellule a 5800 x g per 5 min a 4 ° C. Decantare il supernatante.
    1. Lavare le cellule da loro risospendere in 45 mL di TBS freddo e trasferire la sospensione in una provetta conica da 50 mL. Girare il tubo a 2800 x g per 3 min a 4 ° C. Eliminare il surnatante.
    2. Lavare che le cellule in 10 mL di freddo chIP di tampone di lisi (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 millimetro di acido etilendiamminotetraacetico (EDTA), 1% nonidet octyl phenoxypolyethoxylethanol (NP-40), conservato a 4 ° C).
    3. Girare le cellule a 2800 x g per 3 min a 4 ° C. Eliminare il surnatante.
      Nota: Le cellule possono essere congelate con azoto liquido e conservate a-80 ° C fino a ulteriore elaborazione.

4. rendere lisati di lievito

  1. Risospendere le cellule in 1 mL di tampone di lisi ChIP freddo con fluoruro di 1 mM phenylmethylsulfonyl (PMSF) e 1:1,000 diluizione dell'inibitore di proteasi di lievito cocktail. Trasferire la sospensione in una provetta di 2,0 mL tappo a vite contenente 200 µ l di perline di vetro.
  2. Trasferire le cellule una perlina battendo apparato per agitazione ad alta velocità a 4 ° C e tallone battere 6 volte per 30 s ciascuno. Mantenere le cellule sul ghiaccio per almeno 1 minuto tra ogni branello battendo.
  3. Trasferire il lisato una provetta da 1,5 mL utilizzando punte di caricamento del gel. Centrifugare il lisato a 15.500 x g per 20 min a 4 ° C.
  4. Eliminare il supernatante e risospendere il pellet in 250 µ l di tampone di digestione di MNase (10 mM Tris-HCl a pH 7.5, 10 millimetri di NaCl, 3 mM MgCl2, 21 mM CaCl2, 1% NP-40, conservato a 4 ° C) pipettando delicatamente su e giù.
  5. Aggiungere 2,5 µ l di MNase per le reazioni. Mescolarle delicatamente capovolgendo 4 - 6 volte e immediatamente viene quindi incubato in bagnomaria a 37 ° C per 20 min.
    Nota: Condizioni di Digest dovrebbero essere ottimizzate quando viene utilizzato un nuovo stock di MNase. Vedere il passaggio 10 per il protocollo.
  6. Posizionare immediatamente i tubi sul ghiaccio per fermare la reazione e aggiungere 5 µ l di EDTA 0.5 M per una concentrazione finale di 10 mM EDTA. Mescolare delicatamente per inversione.
  7. Centrifugare la reazione a 15.500 x g per 15 min a 4 ° C e trasferire il surnatante in una nuova provetta da 1,5 mL.
    Nota: Solubile della cromatina (digerita) sarà nel surnatante. Il pellet contiene detriti cellulari nulla non digerito e insolubile.

5. Immunoprecipitate (IP) per volta istoni

  1. Determinare la concentrazione di proteina di ogni frazione di cromatina MNase-rilasciato utilizzando un'analisi di Bradford. Aggiungere 1 mL di reattivo di Bradford a ciascuno dei 8 cuvette monouso più ulteriore 1 provetta per ciascun campione di proteina per essere testato.
    1. Preparare una soluzione stock di 2 mg/mL albumina di siero bovino (BSA).
    2. Aggiungere il volume appropriato per ottenere le seguenti concentrazioni di BSA in 1 mL di reagente di Bradford: 0 μg/mL, 0,5 μg/mL, 1 µ g/mL, 2 μg/mL, 4 μg/mL, 6 μg/mL, 8 μg/mL e 10 μg/mL. Aggiungere 2 μL della frazione della cromatina MNase-rilasciato la cuvette aggiuntive.
    3. Coprire la parte superiore di ogni provetta con un piccolo pezzo di parafilm e invertire la cuvette 4 - 6 volte per mescolare bene la soluzione. Incubare le provette a temperatura ambiente per 15 min.
    4. Utilizzando uno spettrofotometro visibile luce, misurare l'assorbanza a 595 nm per la curva standard ed i campioni sperimentali.
      Nota: Utilizzare la cuvetta senza BSA (0 μg/mL) a vuoto lo spettrofotometro prima di prendere la prima misurazione.
    5. Tracciare una curva standard utilizzando i valori di assorbanza per le diverse concentrazioni di BSA su software foglio di calcolo o software associato con lo spettrofotometro. Sulla base della curva standard e il fattore di diluizione utilizzato (1: 500), utilizzare i valori di assorbanza per calcolare la concentrazione di proteina per ciascuno dei campioni di frazione della cromatina.
  2. Per ogni IP, aggiungere 50 µ g di proteina totale dalla frazione della cromatina MNase-rilasciato al Buffer di lisi di ChIP per raggiungere un volume finale di 1 mL.
    Nota: Se si imposta più di un indirizzo IP al lisato, fare un mix master del lisato e ChIP Buffer di lisi e aliquota 1 mL provette individuali per l'IP.
  3. Rimuovere 100 µ l dal mix IP da elaborare come l'esempio di input. Congelare il campione a-20 ° C fino al punto 7.1.
    Nota: Qualsiasi campione di cromatina rimanente può anche essere congelato a-20 ° C e se si desidera utilizzare per un IP successivo.
  4. Aggiungere 20 µ l di biglie magnetiche A/G di proteine pre-legato con anticorpo per ogni campione IP.
Ruotare il campione a 8 giri per 3 h (standard) o durante la notte (se si preferisce) a 4 ° C.

6. lavare IPs ed eluire complessi DNA-istone

  1. Disporre le provette in un supporto magnetico e lasciate perline raccogliere sul lato del tubo. Rimuovere il surnatante con una pipetta. Lavare le perle successivamente con 1 mL di ciascuno dei buffer sottostante.
    1. Eseguire ogni lavaggio rotante a 8 rpm per 5 min a 4 ° C, posizionando perline in un supporto magnetico, rimuovere il surnatante e aggiunta di buffer successivo: 2x - tampone di lisi di ChIP, 2x - sale alta di tampone di lavaggio (50 mM Tris-HCl a pH 7.5, 500 mM NaCl, 1 mM EDTA 1% NP-40, conservato a 4 ° C), 1 x - LiCl/detergente Wash Buffer (10 mM Tris-HCl pH 8.0, 250mm LiCl, 1 mM EDTA, 1% NP-40, 1% sodio desossicolato, conservato a 4 ° C), 1 x - TE (10 mM Tris-HCl a pH 8.0, 1 mM EDTA, conservato a 4 ° C) e 1 x - TE.
    2. Con ultimo lavaggio TE, trasferire perline ad un nuovo tubo con 0,5 mL di TE per trasferire la maggior parte delle perle, poi un altro 0,5 mL di TE per lavare il tubo e il trasferimento di perline restanti.
  2. Aggiungere 250 µ l di tampone di eluizione di ChIP appena fatte (1% SDS, 1 mM NaHCO3). Vortice brevemente la soluzione. Ruotare i campioni a 8 giri per 15 min a temperatura ambiente.
  3. Collocare la provetta in un supporto magnetico e raccogliere le perle. Attentamente trasferire il surnatante in una provetta nuova ed evitare le perline.
    Nota: L'eluato contiene immunoprecipitati proteine e DNA associato.
  4. Aggiungere un altro 250 µ l di tampone di eluizione di ChIP a perline. Ruotare i campioni a 8 giri per 15 min a temperatura ambiente.
  5. Trasferire con cautela il surnatante nella provetta contenente il primo eluizione. Se necessario, è possibile rimuovere un volume più piccolo (240 µ l) per tutti gli indirizzi IP per non disturbare le perline.

7. invertire le reticolazioni proteina-DNA

  1. Scongelare i campioni di input e aggiungere 400 µ l di tampone di eluizione di ChIP per ogni ingresso.
  2. Input sia campioni IP, aggiungere 20 µ l di 5 M NaCl, 5 µ l di glicogeno 20 mg/mL e 12,5 µ l di proteinasi K. Mix 20 mg/mL bene tramite inversione oppure sfogliando i tubi. Incubare i campioni in un bagno di acqua di 65 ° C per una notte.

8. purificare e concentrare il DNA

  1. Aggiungere 10 µ l di 10mg/mL RNasi A ingresso e ai campioni IP. Incubare i campioni in bagnomaria a 37 ° C per 30 min.
  2. Aggiungere 600 µ l di fenolo: chlorofrom:isoamyl alcol (25:24:1 PCI) nella soluzione acquosa e mescolare bene. Spin loro a 15.500 x g per 5 min a temperatura ambiente.
    1. Rimuovere lo strato acquoso ad un nuovo tubo. Aggiungere 600 µ l di PCI e mescolare bene. Girare il tubo a 15.500 x g per 5 min a temperatura ambiente. Trasferire lo strato acquoso in una nuova provetta.
      Attenzione: Lavorare nella cappa e indossare adeguati dispositivi di protezione personali quando si lavora con PCI. Smaltire i rifiuti liquidi e solidi come indicato dalle linee guida istituzionali.
  3. Aggiungere 0,1 x volume di acetato di sodio 3M e 1 mL di etanolo al 100% freddo per precipitare il DNA. Capovolgere la provetta 4 - 6 volte per mescolare bene la soluzione. Incubare a-20 ° C durante la notte.
    1. Girare il tubo a 15.500 x g per 20 min a 4 ° C. Rimuovere con cautela il surnatante con una pipetta.
    2. Lavare il pellet in 1 mL di etanolo 70% freddo. Spin a 15.500 x g per 10 min a 4 ° C. Rimuovere con cautela il surnatante con una pipetta.
    3. Asciugare il pellet nella cappa per circa 20 minuti (finché non è completamente asciutto). Risospendere i campioni IP in 50 µ l di acqua priva di nucleasi e risospendere ingresso campioni in 100 µ l di acqua priva di nucleasi. Conservare i campioni di DNA a-20 ° C fino alla esecuzione di qPCR.

9. quantitative PCR (qPCR) per rilevare il arricchita di regioni genomiche

  1. Fare un mix di qPCR master per ogni set di primers. Uno reazione contiene 5 µ l di 2 x qPCR mix, 0,25 µ l di primer in avanti di 20 µM e 0,25 µ l di primer inverso di 20 µM.
    Nota: Primer corretta progettazione e collaudo per qPCR esperimenti sono descritti altrove14,15,16.
  2. Rendere il mix master DNA per ciascun campione di DNA. Uno reazione contiene 0,5 µ l di DNA e 4,0 µ l di acqua priva di nucleasi.
  3. Aggiungere 5,5 µ l di master mix primer appropriato e 4,5 µ l di mix master DNA appropriato a ciascun pozzetto su una piastra 384 pozzetti qPCR.
    Nota: Iniziare con l'aggiunta di 5,5 µ l della miscela primer in ciascun pozzetto. Girare la piastra a 200 x g per 1 min a temperatura ambiente prima di aggiungere 4,5 µ l della miscela del DNA.
  4. Aderire il sigillo alla piastra e rotazione a 200 x g per 1 min a temperatura ambiente.
  5. Eseguire qPCR utilizzando un sistema qPCR in tempo reale con le seguenti condizioni: 95 ° C per 3 min; 40 cicli di 95 ° C per 10 s, 55 ° C per 30 s; curva di fusione 65 ° C a 95 ° C con incrementi di 0,5 ° C, 5 s.
  6. Per ogni coppia di primer, calcolare l'input per cento del campione rispetto al campione di ingresso di 5% utilizzato nella qPCR IP. Utilizzare i mezzi per la tecnica PCR triplici copie per eseguire i calcoli.
    Nota: Se una variazione sostanziale è osservata in triplici copie la PCR, si consiglia di ripetere la qPCR con attenzione alla composizione del mix master, pipettaggio errori e la contaminazione incrociata tra pozzetti della piastra 384 pozzetti.
    1. Regolare i valori di Cq per l'ingresso al 100% sottraendo il numero di cicli che rappresentano il fattore di diluizione dai valori di Cq crudi.
      Nota: Il cinque per cento input rappresenta un fattore di diluizione di 20 volte, che equivale a 4,32 cicli (registro2 20 = 4,32).
    2. Calcolare la percentuale di input come 2 ^ (Cqingresso - CqIP) moltiplicato per 100.

10. determinare le condizioni di Digest MNase (consigliato prima al primo completo chIP esperimento)

  1. Seguire i passaggi 2.1 attraverso 4.4 del protocollo precedente. Scalare il protocollo per generare abbastanza lisato per campioni multipli di MNase digestione del pellet contenenti della cromatina. Al punto 4.4, risospendere il pellet in 1,25 mL di tampone di digestione di MNase. I campioni per 5 tubi in modo che ogni aliquota contiene 250 µ l del pellet cromatina risospesi in MNase digestione Buffer.
  2. Aggiungere 0, 1,5, 2,5 o 5 µ l di MNase in ogni provetta. Mescolarle delicatamente capovolgendo 4 - 6 volte e immediatamente Incubare le provette in bagnomaria a 37 ° C per 20 min.
  3. Interrompere le reazioni immediatamente immissione tubi sul ghiaccio e aggiungendo 5 µ l di EDTA 0.5 M per una concentrazione finale di 10 mM.
Mescolare delicatamente la soluzione di inversione.
  • Centrifugare le provette a 15.500 x g per 15 min a 4 ° C e trasferire il surnatante in una nuova provetta da 1,5 mL.
  • Aggiungere SDS 1% di concentrazione finale (25 µ l di soluzione di riserva del 10%) e NaHCO3 a concentrazione finale 0,1 M (25 µ l di soluzione madre 1 M) per i campioni nelle provette da 1,5 mL.
  • Aggiungere 20 µ l di 5M NaCl, 5 µ l di glicogeno e 12,5 µ l di proteinasi K di 20mg/mL per i campioni nelle provette da 1,5 mL. Li Incubare a 65 ° C durante la notte.
  • Aggiungere 10 µ l di 10 mg/mL RNaseA. Incubare a 37 ° C per 30 min.
  • Aggiungere 300 µ l del PCI in soluzione acquosa e mescolare bene. Spin a 15.500 x g per 5 min a temperatura ambiente.
    1. Rimuovere lo strato acquoso ad un nuovo tubo. Aggiungere 300 µ l di PCI e mescolare bene. Spin a 15.500 x g per 5 min a temperatura ambiente. Trasferimento strato acquoso ad un nuovo tubo.
  • Aggiungere 0,1 x volume di 3M sodio acetato (solitamente ~ 30 µ l) e 1 mL di etanolo 100% freddo per precipitare il DNA. Capovolgere la provetta 4 - 6 volte per mescolare bene. Incubare la provetta a-80 ° C per 1 h o a-20 ° C durante la notte.
    1. Girare il tubo a 15.500 x g per 20 min a 4° C. Rimuovere con cautela il surnatante con una pipetta.
    2. Lavare il pellet in 1 mL di etanolo 70% freddo. Spin a 15.500 x g per 10 min a 4 ° C.
    3. Lasciare che il pellet asciugare all'aria nella cappa circa 20 minuti (o fino a quando è completamente asciutto). Risospendere il pellet in 30 µ l di acqua priva di nucleasi.
  • Aggiungere il DNA della tintura di caricamento ed eseguire 20 µ l in un agarosio al 2% gel per visualizzare digerito il DNA.
  • Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Una componente chiave di questo protocollo è ottimizzare la concentrazione di nucleasi di micrococcal (MNase) usata per digerire la cromatina in frammenti solubili, come descritto nel passaggio 10. Questo è fondamentale per l'ottenimento di dati ad alta risoluzione per quanto riguarda la distribuzione delle modificazioni istoniche alle regioni genomiche di interesse. Una titolazione di MNase deve essere eseguita per determinare la concentrazione più adatta per raggiungere principalmente mono-nucleosomi con una minore quantità di-nucleosomi nella frazione solubile della cromatina. Questo può essere visualizzato estraendo il DNA seguendo MNase digestione del pellet contenenti della cromatina ed esecuzione di agarosio gel elettroforesi (Figura 2). Nella preparazione del MNase usato qui, 2,5 µ l di enzima a 20 unità / µ l prodotto prevalentemente mono-nucleosomi e pertanto tale importo è stato utilizzato per il chIP.

    Due set di risultati rappresentativi sono indicati per questa procedura di chIP (Figura 3). Nel primo esempio, un contrassegno di metile dell'istone viene valutato in cellule wildtype o le cellule che mancano la metiltransferasi che catalizza questo marchio. In particolare, il chIP è stato effettuato con un anticorpo contro H3K4me2, così come contro istone H3 come controllo, in cellule Δ wildtype e set1. H3K4me2 si localizza principalmente appena a valle della trascrizione avvia sito all'estremità 5' di regioni codificanti e, in assenza di Set1, H3K4me2 non può essere rilevato in cellule17,18,19. Il ceppo Δ set1pertanto funge da un controllo per indicare la quantità di segnale di fondo che può essere attribuita al legame non specifico di altri marchi di istone o DNA all'anticorpo. In questo caso, il ceppo di wildtype ha mostrato chiaro arricchimento per H3K4me2 all'estremità 5' di due geni noti per essere obiettivi diretti di Set1, PMA1 ed ERG1120,21, mentre nessun segnale è stato osservato in set1Δ cellule (Figura 3A). Come previsto, non c'è nessun arricchimento del marchio H3K4me2 del telomero (TEL) 07 L. L'espressione del gene di sporulazione middle SPR3 inoltre è stato segnalato per essere regolata da Set122,23, tuttavia l'arricchimento di H3K4me2 all'estremità 5' del SPR3 ORF è più simile ai livelli osservati a TEL07L, rispetto a PMA1 o a ERG11. Valutare la localizzazione di questo marchio di metile indica che la regolazione Set1-mediata di SPR3 è probabile che si verificano da un meccanismo diverso rispetto alle PMA1 o ERG11, come precedentemente osservato22.

    Nel secondo esempio, chIP di H4K16 acetilato è mostrato rispetto istone H4 in wildtype cellule e le cellule che mancano le istone deacetilasi Sir2, che rimuove i segni di H4K16ac. H4K16ac è impoverito nella cromatina heterochromatic-come vicino il telomero e arricchita in euchromatin più distale dal telomero24,25, come dimostrato per TEL07L e TEL15L (Figura 3B). Inoltre, la perdita di Sir2 provoca un aumento della H4K16ac alle regioni telomeriche e subtelomeric specifiche, anche se nessun cambiamento è osservato al gene di controllo PMA1, dove Sir2 non è noto per la localizzazione. Mentre questi dati mostrano un chiaro aumento nei livelli di H4K16ac in cellule Δ sir2, il cambiamento rilevato in H4K16ac, che non dovrebbe essere come la sostanza come il cambiamento in H3K4me2 nel wildtype contro le cellule Δ set1, potrebbe essere oscurato se sono parametri di chIP non correttamente ottimizzato. Consigli per l'ottimizzazione sono descritti nella discussione.

    Figure 1
    Figura 1: Diario di procedura chIP. Il programma tipico per il protocollo del chIP è mostrato. Eventuali variazioni sono indicate nel testo. Clicca qui per visualizzare una versione più grande di questa figura.

    Figure 2
    Figura 2: Test MNase digestione per solubilizzazione di mono-nucleosomi. Elettroforesi del gel dell'agarosi di DNA isolata a seguito di digestione del pellet della cromatina con diverse quantità di MNase (20 unità / µ l). DNA da mononucleosomes migra a circa 150 bp, passando da dinucleosomes a circa 300 bp e DNA da polynucleosomes si trova a sempre più alti pesi molecolari. Clicca qui per visualizzare una versione più grande di questa figura.

    Figure 3
    Figura 3 : Chip di H3K4me2 e H4K16ac in ceppi di lievito mutante e wildtype. (A) ChIP usando gli anticorpi contro H3K4me2 e H3 è stato effettuato in cellule Δ wildtype e set1. Ingresso percentuale è stata calcolata per ogni coppia di primer per il H3K4me2 e H3 IPs e il rapporto è rappresentato graficamente per indicare il relativo arricchimento di H3K4me2 ai luoghi indicati. I primer per PMA1, ERG11 e SPR3 generano sequenze amplificate all'estremità 5' di ogni ORF, considerando che la coppia di primer di TEL07L è adiacente al telomere sul braccio sinistro del cromosoma 7. La media dei tre replicati biologici è mostrata e le barre di errore rappresentano errore standard della media. (B) ChIP è stato effettuato con gli anticorpi riconoscendo H4K16ac e H4 in cellule Δ wildtype e sir2e tracciato come descritto per la Figura 3A. Coppie di primer amplificano sequenze adiacenti ai telomeri (TEL07L e TEL15L) e a valle all'interno di regioni eucromatiche di ogni subtelomeriche definito in precedenza (alle 21 e 5 kb distale dal telomero, rispettivamente).Clicca qui per visualizzare una versione più grande di questa figura.

    Numero di ceppo Genotipo Riferimento
    yEG230 MATα his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 23
    yEG223 MATα sir2Δ::NATMX Questo studio
    yEG232 MATa set1Δ::KANMX 23

    Tabella 1: Ceppi di lievito utilizzati in questo studio.

    Numero di oligo Posizione Sequenza
    oEG141 TELVIIL F AGCCCGAGCCTGTACTAAAT
    oEG142 TELVIIL R CAAAAGAAACTTTTCATGGCA
    oEG153 5' PMA1 F TCAGCTCATCAGCCAACTCAAG
    oEG154 5' PMA1 R CGTCGACACCGTGATTAGATTG
    oEG220 TELVIIL + F 21KB AAACAATGGGACCCTTCTGA
    oEG221 TELVIIL + R 21KB AACACCTTGCAAAACACAGG
    oEG280 TELXVL F ATCCTGCAATTGGGCCACTAT
    oEG281 TELXVL R AGCGGAAGGCATATTAACGT
    oEG282 TELXVL + F 5KB AGGCGATGTAATCTCACCAA
    oEG283 TELXVL + R 5KB CATTCACACATCCTGCTACCA
    oEG568 ERG11 F CCTCTTATTCCGTCGGTGAA
    oEG569 ERG11 R TGTGTCTACCACCACCGAAA
    oEG963 SPR3 F TCTGGATTCGCTGAGGAAGT
    oEG964 SPR3 R TTTCAGTTCAGGGCTTTTCG

    Tabella 2: Primer usati in questo studio.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    La procedura qui descritta consente il recupero efficiente di DNA associato a istoni modificati in cellule di lievito mediante immunoprecipitazione. Questa è seguita da qPCR utilizzando primers che amplificare regioni di interesse determinare arricchimento locale o esaurimento delle modificazioni istoniche specifici. Nonostante essere sviluppato come un metodo quasi 20 anni fa, chIP rimane la definizione per indagare lo stato di modifica dell'istone alle differenti regioni genomiche e in condizioni diverse. Anche se il chIP accoppiato alla prossima generazione di tecnologie di sequenziamento possono interrogare modificazioni istoniche su un genoma scala6,7, i costi e l'analisi di dati richiesti questi approcci possono limitare il loro uso in alcune impostazioni di laboratorio. Inoltre, questi esperimenti di epigenomic sono spesso seguiti da chIP accoppiati a qPCR per convalidare le osservazioni di stato di modifica dell'istone presso alcuni loci genomici. Ci sono pochi metodi comparabili che forniscono l'utilità di chIP fisicamente che collegano un contrassegno dell'istone (o altre proteine) a una posizione specifica all'interno del genoma e analizzare la dinamica di questa interazione nelle diverse condizioni ambientali o biologiche . Anche se c'è stato un recente successo nell'isolamento della cromatina da regioni genomiche definite e identificare i segni locali dell'istone usando spettrometria totale8,9,10,11, questi metodi di posa le sfide tecniche e della loro utilità attraverso tipi di laboratorio diversi può essere limitati da un accesso adeguato alle risorse di analisi dati e di strumentazione di spettrometria di massa. Il protocollo descritto qui è tecnicamente ed economicamente accessibile a impostazioni diverse lab, con il principale ostacolo possibile è l'accesso a una macchina di qPCR. ChIP resta il gold-standard per la definizione di localizzazione genomica degli istoni modificati in lievito ed in altri sistemi.

    Si tratta di un protocollo versatile con un numero di passaggi che possono essere ottimizzate per soddisfare diverse condizioni sperimentali, tra cui test contemporaneamente più mutanti o condizioni ambientali. In alternativa, sufficienti della cromatina è solitamente generata da uno di lisato per eseguire più indirizzi IP con fino a almeno quattro diversi anticorpi. Questo protocollo è utilizzabile anche per il chIP di proteine non istoniche della cromatina che sono epitopo-taggati, o per i quali sono stati generati gli anticorpi. Se questo protocollo deve essere adattato per il chIP di proteine non istoniche, parametri compreso il tempo di fissazione, concentrazione della cromatina nel PI e concentrazione di anticorpi sono spesso fondamentali per ottenere arricchimento della proteina mirata sopra priorità bassa. Più comunemente, è utile per aumentare il tempo di fissazione con formaldeide per tra 45 e 60 min e per aumentare la quantità di cromatina utilizzata nel PI (fino a 200 µ g di proteine totali).

    Ci sono un numero di potenziali variabili che contribuiscono alla qualità e riproducibilità di esperimenti di chIP di modifica dell'istone. Anche se un esperimento Sub-ottimo spesso può dare risultati positivi, quando si confrontano le nette differenze (ad esempio, i livelli di H3K4me2 in cellule Δ wildtype o set1, come mostrato in Figura 3A), altre sottili differenze rischiano di essere mascherato un esperimento non correttamente eseguita (ad esempio i livelli differenti di H4K16ac alle TEL07L in cellule Δ wildtype o sir2, come illustrato in Figura 3B). Parametri sperimentali da considerare includono la quantità di cellule di lievito utilizzate, tempo di fissazione, concentrazione della frazione della cromatina utilizzata nel periodo dell'inchiesta, la dimensione del frammento dei complessi DNA-proteine digeriti e la qualità dell'anticorpo e la concentrazione. Una limitazione di questo approccio è che l'ottimizzazione dei parametri sperimentali è generalmente richiesto per ogni modifica dell'istone in fase di test e i ceppi mutanti e/o condizioni sotto inchiesta. Ci possono essere lievi differenze nei livelli di contrassegno dell'istone o localizzazione in condizioni diverse, e la capacità di rilevare queste differenze dipenda i parametri descritti sopra. Discutiamo alcune delle considerazioni chiave per sviluppare gli approcci sperimentali più sensibili qui sotto.

    Come descritto nel protocollo, è consigliabile testare più concentrazioni di MNase per determinare la concentrazione ottima prima di eseguire un esperimento completo di chIP. Garantire che il DNA all'interno IP adeguatamente è frammentato è chiave per ottenere alta risoluzione chIP risultati. Anche se la dimensione amplicone dei prodotti qPCR può essere piccolo (generalmente meno di 100 bp), se la dimensione del frammento del DNA è sostanzialmente più grande, la qPCR potrebbe erroneamente indicare arricchimento in un locus specifico quando, in realtà, il contrassegno dell'istone può essere localizzato centinaia di basi di distanza. Mentre questo protocollo si basa su MNase di solubilizzare la cromatina in nucleosomi mono - e di-, altri protocolli di chIP utilizzano anche comunemente sonicazione per taglio della cromatina6,7. Anche la sonicazione è un metodo affidabile per solubilizzare frammenti di cromatina, anche se le dimensioni di taglio tendono ad essere meno uniforme e può essere più difficile da ottenere risultati coerenti tra esperimenti. Anche se sonicazione può essere preferibile per il chIP di alcune proteine non istoniche, l'uso di MNase per digerire la cromatina in primo luogo mono-nucleosomi può migliorare la risoluzione di esperimenti di chIP di modifica dell'istone.

    Un requisito per un esperimento riuscito chIP è un anticorpo che in modo univoco e con alta affinità riconosce la modifica dell'istone di interesse. Il limite principale del chIP come un metodo per il rilevamento di modifiche dell'istone è la sua dipendenza da un anticorpo di alta qualità, convalidato; senza un tale reagente, risultati ottenuti dal chIP non sono suscettibili di essere biologicamente rilevanti. Ci sono un numero di commercialmente disponibili anticorpi contro modifiche istoniche trovati in lievito, anche se la qualità e la validità degli anticorpi è variabile. Sforzi per convalidare questi anticorpi hanno prodotto risorse utili per la determinazione dell'anticorpo migliori disponibile per un determinato esperimento26. È consigliabile che gli anticorpi usati per chIP vengono convalidati con una varietà di metodi per la loro specificità, anche mediante sondaggio matrici di peptidi modificati e senza modifiche dell'istone, l'esecuzione di western blot di cellule intere estratti e purificati gli istoni e in esperimenti di chIP con controlli adeguati, come ceppi con un enzima modificando eliminato o portatrici di mutazioni di punto nel residuo dell'istone modificate. Per nuovi anticorpi che riconoscono marchi atipici o anticorpi generati dal laboratorio, questi esperimenti di specificità sono fondamentali per determinare se l'anticorpo può essere un valido reagente per chIP.Oltre a convalidare la specificità dell'anticorpo, esecuzione di una titolazione di anticorpi per l'IP da un ceppo di wildtype e un ceppo di controllo negativo spesso è utile per determinare la quantità di anticorpo richiesto (rispetto ad una concentrazione di cromatina set) per rilevare differenze precise di arricchimento tra ceppi o regioni del genoma. Inoltre, se alcuni dati relativi ai modelli di distribuzione genomica del marchio sono noti, positivi e negativi set di primer di controllo dovrebbe essere incluso in tutti gli esperimenti di qPCR per convalidare qualsiasi esperimento individuo e per semplificare il raffronto fra gli esperimenti.

    Nel complesso, questo lavoro descrive un metodo fondamentale per i ricercatori interessati a interrogare lo stato di modifica dell'istone in qualsiasi regione genomica nel lievito gemmante. La versatilità di questo protocollo e la sua applicabilità alle varie domande sperimentale lo rende uno strumento estremamente utile per la dissezione dinamica della cromatina a livello molecolare.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Gli autori non hanno nulla a rivelare.

    Acknowledgments

    Gli autori vorrei ringraziare i membri del laboratorio verde per utili discussioni. Questo lavoro è stato sostenuto in parte da sovvenzioni NIH R03AG052018 e R01GM124342 per E.M.G

    Materials

    Name Company Catalog Number Comments
    Yeast Extract Research Products International (RPI) Y20025-1000.0
    Peptone Research Products International (RPI) P20250-1000.0
    Dextrose ThermoScientific BP350-1
    Formaldehyde Sigma-Aldrich F8775
    Glycine Fisher Scientific AC12007-0050
    Tris Amresco 0497-5KG
    EDTA Sigma-Aldrich E6758-500G
    NaCl ThermoScientific BP358-10
    4-Nonylphenyl-polyethylene glycol Sigma-Aldrich 74385 Equivalent to NP-40
    MgCl ThermoScientific S25533
    CaCl2 Sigma-Aldrich 20899-25G-F
    LiCl ThermoScientific AC413271000
    Sodium Dodecyl Sulfate Amresco M107-1KG
    Sodium Deoxycholate Sigma-Aldrich 30970-100G
    Sodium Acetate Sigma-Aldrich S2889
    NaHCO3 ThermoScientific S25533
    PMSF Sigma-Aldrich P7626-5G
    Yeast protease inhibitor cocktail VWR 10190-076
    25 Phenol:24 Chloroform:1 Isoamyl Alcohol VWR Life Science 97064-824
    Ethanol Sigma-Aldrich E7023
    Nuclease-Free Water VWR 100720-992
    Micrococcal Nuclease Worthington Biochemical LS004797
    Glycogen ThermoScientific R0561
    Proteinase K Research Products International (RPI) P50220-0.1
    RNase A  Sigma-Aldrich R6513-50MG
     Bradford Assay Reagent ThermoScientific 23238
     BSA Standard 2 mg/mL ThermoScientific 23210
    α H4 EMD Millipore 04-858
    α H4K16ac EMD Millipore ABE532
    α H3 Abcam ab1791
    α H3K4me2 Active Motif 39142
     High Rox qPCR Mix Accuris qMax Green, Low Rox qPCR Mix ACC-PR2000-L-1000
    Protein A/G Magnetic Beads ThermoScientific 88803
    magnetic stand for 1.5mL tubes Fisher Scientific PI-21359
    Acid-Washed Glass Beads Sigma-Aldrich G8772
     Microtube Homogenizer Benchmark D1030
    2.0 mL screw-cap tubes with sealing rings Sigma-Aldrich Z763837-1000EA
    Gel loading tips Fisher Scientific 07-200-288
    Cuvettes Fisher Scientific 50-476-476
    Parafilm Fisher Scientific 13-374-10
    50 mL conical tubes Fisher Scientific 14-432-22
    384-Well PCR Plate Fisher Scientific AB-1384W
     Gyratory Floor Shaker New Brunswick Scientific Model G10
    Spectrophotometer ThermoScientific ND-2000c
     Real-Time PCR Detection System Bio-Rad 1855485

    DOWNLOAD MATERIALS LIST

    References

    1. Jaiswal, D., Turniansky, R., Green, E. M. Choose Your Own Adventure: The Role of Histone Modifications in Yeast Cell Fate. J Mol Biol. 429, (13), 1946-1957 (2017).
    2. Suganuma, T., Workman, J. L. Signals and combinatorial functions of histone modifications. Annu Rev Biochem. 80, 473-499 (2011).
    3. Solomon, M. J., Varshavsky, A. Formaldehyde-mediated DNA-protein crosslinking: a probe for in vivo chromatin structures. P Natl Acad Sci USA. 82, (19), 6470-6474 (1985).
    4. Solomon, M. J., Larsen, P. L., Varshavsky, A. Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene. Cell. 53, (6), 937-947 (1988).
    5. Gilmour, D. S., Lis, J. T. Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes. P Natl Acad Sci USA. 81, (14), 4275-4279 (1984).
    6. Lefrançois, P., et al. Efficient yeast ChIP-Seq using multiplex short-read DNA sequencing. BMC Genomics. 10, 37 (2009).
    7. Furey, T. S. ChIP-seq and beyond: new and improved methodologies to detect and characterize protein-DNA interactions. Nat Rev Genet. 13, (12), 840-852 (2012).
    8. Déjardin, J., Kingston, R. E. Purification of proteins associated with specific genomic Loci. Cell. 136, (1), 175-186 (2009).
    9. Byrum, S. D., Raman, A., Taverna, S. D., Tackett, A. J. ChAP-MS: a method for identification of proteins and histone posttranslational modifications at a single genomic locus. Cell Rep. 2, (1), 198-205 (2012).
    10. Soldi, M., Bremang, M., Bonaldi, T. Biochemical systems approaches for the analysis of histone modification readout. Biochim Biophys Acta. 1839, (8), 657-668 (2014).
    11. Soldi, M., Bonaldi, T. The ChroP approach combines ChIP and mass spectrometry to dissect locus-specific proteomic landscapes of chromatin. J Vis Exp. (86), (2014).
    12. Kuo, M. H., Allis, C. D. In vivo cross-linking and immunoprecipitation for studying dynamic Protein:DNA associations in a chromatin environment. Methods. 19, (3), 425-433 (1999).
    13. Meluh, P. B., Broach, J. R. Immunological analysis of yeast chromatin. Methods Enzymol. 304, 414-430 (1999).
    14. Rozen, S., Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 132, 365-386 (2000).
    15. Taylor, S., Wakem, M., Dijkman, G., Alsarraj, M., Nguyen, M. A practical approach to RT-qPCR-Publishing data that conform to the MIQE guidelines. Methods. 50, (4), S1-S5 (2010).
    16. Rodríguez, A., Rodríguez, M., Córdoba, J. J., Andrade, M. J. Design of primers and probes for quantitative real-time PCR methods. Methods Mol Biol. 1275, 31-56 (2015).
    17. Briggs, S. D., et al. Histone H3 lysine 4 methylation is mediated by Set1 and required for cell growth and rDNA silencing in Saccharomyces cerevisiae. Gene Dev. 15, (24), 3286-3295 (2001).
    18. Bernstein, B. E., et al. Methylation of histone H3 Lys 4 in coding regions of active genes. P Natl Acad Sci USA. 99, (13), 8695-8700 (2002).
    19. Pokholok, D. K., et al. Genome-wide map of nucleosome acetylation and methylation in yeast. Cell. 122, (4), 517-527 (2005).
    20. Krogan, N. J., et al. The Paf1 complex is required for histone H3 methylation by COMPASS and Dot1p: linking transcriptional elongation to histone methylation. Mol Cell. 11, (3), 721-729 (2003).
    21. South, P. F., Harmeyer, K. M., Serratore, N. D., Briggs, S. D. H3K4 methyltransferase Set1 is involved in maintenance of ergosterol homeostasis and resistance to Brefeldin A. P Natl Acad Sci USA. 110, (11), E1016-E1025 (2013).
    22. Margaritis, T., et al. Two distinct repressive mechanisms for histone 3 lysine 4 methylation through promoting 3'-end antisense transcription. PLoS Genet. 8, (9), e1002952 (2012).
    23. Jezek, M., et al. The histone methyltransferases Set5 and Set1 have overlapping functions in gene silencing and telomere maintenance. Epigenetics. 12, (2), 93-104 (2017).
    24. Suka, N., Luo, K., Grunstein, M. Sir2p and Sas2p opposingly regulate acetylation of yeast histone H4 lysine16 and spreading of heterochromatin. Nat Genet. 32, (3), 378-383 (2002).
    25. Kimura, A., Umehara, T., Horikoshi, M. Chromosomal gradient of histone acetylation established by Sas2p and Sir2p functions as a shield against gene silencing. Nat Genet. 32, (3), 370-377 (2002).
    26. Rothbart, S. B., et al. An Interactive Database for the Assessment of Histone Antibody Specificity. Mol Cell. 59, (3), 502-511 (2015).
    Immunoprecipitazione della cromatina (ChIP) di modificazioni istoniche da <em>Saccharomyces cerevisiae</em>
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Jezek, M., Jacques, A., Jaiswal, D., Green, E. M. Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae. J. Vis. Exp. (130), e57080, doi:10.3791/57080 (2017).More

    Jezek, M., Jacques, A., Jaiswal, D., Green, E. M. Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae. J. Vis. Exp. (130), e57080, doi:10.3791/57080 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    Simple Hit Counter