Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Inmunoprecipitación de cromatina (ChIP) de modificaciones de las histonas de Saccharomyces cerevisiae

doi: 10.3791/57080 Published: December 29, 2017

Summary

Aquí, describimos un protocolo para la inmunoprecipitación de cromatina de histonas modificadas de la levadura de florecimiento Saccharomyces cerevisiae. Immunoprecipitated ADN se utiliza posteriormente para PCR cuantitativa para interrogar la abundancia y localización de modificaciones post-traduccionales de las histonas por todo el genoma.

Abstract

Modificaciones post-traduccionales de las histonas (PTMs), como acetilación, metilación y fosforilación, dinámicamente son reguladas por una serie de enzimas que añadir o quitar estas marcas en respuesta a las señales recibidas por la célula. Estos MPa es principales contribuyentes a la regulación de procesos tales como control de expresión del gene y de reparación del ADN. Inmunoprecipitación de cromatina (chIP) ha sido un acercamiento instrumental para disección de la abundancia y la localización de muchos PTMs histonas por todo el genoma en respuesta a las diversas perturbaciones a la celda. Aquí, se describe un método versátil para la realización de chIP de modificación postraduccional histonas de la levadura de florecimiento Saccharomyces cerevisiae (S. cerevisiae) . Este método se basa en el entrecruzamiento de las proteínas y el ADN mediante tratamiento de formaldehído de las culturas de levadura, generación de lisados de levadura por cordón latiendo, solubilización de fragmentos de cromatina por nucleasa micrococcal e inmunoprecipitación de ADN histonas complejos. ADN asociado con la marca de la histona de interés es purificado y sometido a análisis PCR cuantitativo para evaluar su enriquecimiento en múltiples loci por todo el genoma. Experimentos representativos sondeo la localización de las marcas de histonas H3K4me2 y H4K16ac en wildtype y levadura mutada se discuten para demostrar la interpretación y análisis de datos. Este método es conveniente para una variedad de la histona PTMs y puede realizarse con diferentes cepas mutantes o en presencia de diversas presiones ambientales, lo que es una excelente herramienta para investigar cambios en la dinámica de la cromatina en condiciones diferentes.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La modificación poste-de translación dinámica (PTM) de las histonas es un mecanismo regulador fundamental para muchos procesos con plantilla de ADN, incluyendo transcripción, replicación y reparación de ADN1,2. La capacidad para determinar la abundancia y la localización precisa de las histonas modificadas concomitantes con estos procesos por lo tanto es fundamental para entender la regulación bajo diferentes condiciones en la célula. El desarrollo de inmunoprecipitación de cromatina (chIP) como un método en gran parte provino de los estudios bioquímicos de las interacciones de proteínas con el ADN, particularmente en vitro métodos reticulantes químicos, junto con la necesidad de evaluar la carácter dinámico de las interacciones DNA proteína en vivo y en regiones específicas del genoma3,4,5. El avance de las tecnologías de secuenciación y la PCR cuantitativa (qPCR) también ha ampliado la capacidad para realizar experimentos de chIP con comparaciones cuantitativas y a través de genomas enteros, lo que es una herramienta poderosa para disecar las interacciones DNA-proteína en múltiples niveles.

Actualmente, la viruta es un método necesario para cualquier grupo de investigación interesado en la regulación de cromatina mediada del genoma como no existen métodos comparables para interrogar directamente el enlace físico entre una histona modificado y un locus genómico específico en vivo. Aunque existen variaciones de este método con secuencia de la generación siguiente a modificaciones de las histonas a lo largo del genoma6,7 , estos enfoques pueden abordar diversas cuestiones científicas y su escala, costo y recursos técnicos pueden ser limitantes para algunos grupos de investigación. Además, chIP-qPCR específica es necesario para complementar estos enfoques proporcionando métodos tanto optimización el protocolo de la viruta antes de iniciar la secuencia y validar los resultados de los conjuntos de datos epigenómica. Espectrometría de masas basado en enfoques para identificar el complemento completo de la histona marcas asociadas con regiones genómicas también han surgido8,9,10,11, sin embargo, estos enfoques tienen algunas limitaciones con respecto a qué regiones del genoma pueden ser sondeadas y requieren conocimientos técnicos y la instrumentación que no estará disponible para todos los grupos de investigación. Por lo tanto, el chIP sigue siendo un método fundamental para el análisis de la abundancia y la distribución de modificaciones de las histonas bajo diversas condiciones para todos los grupos de investigación interesados en epigenética, la cromatina y la regulación de funciones genómicas.

Aquí, describimos un método para modelo de chIP con la levadura de florecimiento Saccharomyces cerevisiae (S. cerevisiae) para investigar la distribución de PTMs histonas en la cromatina. Este enfoque se basa en una serie de componentes de la base de protocolos chIP desarrollado en la levadura y también se aplica a modelo diversos sistemas12,13. Las interacciones entre las histonas modificadas y ADN en la célula se conservan por entrecruzamiento con formaldehído. Tras preparación lisada, fragmentos de cromatina son solubilizados en fragmentos de tamaño uniformemente por digestión con nucleasa micrococcal. Inmunoprecipitación de las histonas modificadas se realiza con anticuerpos comerciales o generados por el laboratorio y cualquier ADN asociado es aislado y analizado para el enriquecimiento en determinadas regiones genomic usando qPCR (figura 1). Para muchas modificaciones de las histonas, la cantidad de ADN obtenido de este protocolo es suficiente para probar más de 25 diferentes loci genómicos por qPCR.

Este método de chIP es muy versátil para el control de la distribución de una modificación de las histonas solo a través de múltiples cepas mutantes o las condiciones ambientales, o para probar múltiples modificaciones de las histonas en las células de tipo salvaje en un número de loci genómicos. Además, numerosos componentes del protocolo son fácilmente ajustables para optimizar la detección de cualquiera de los dos altamente o humildes-abundantes marcas de histona. Finalmente, realizar chIP de histonas modificadas en levadura de florecimiento ofrece la oportunidad de utilizar los controles claves para especificidad de anticuerpos que no están ampliamente disponibles en otros sistemas. Es decir, se pueden generar cepas de levadura que llevan las mutaciones de punto en los residuos de las histonas que son objeto de modificación y, en algunos casos, existe solamente una sola enzima que cataliza un residuo particular histona modificación (ej. lisina de las histonas metiltransferasas). Por lo tanto, chIP puede realizarse en cualquiera de los dos las histona mutante o enzima eliminación cepas analizar la medida en que Unión inespecífica del anticuerpo se puede que ocurre y generar falsos positivos. Este control es particularmente valioso para los anticuerpos del recién desarrollado y puede incluso ser utilizado para validar la especificidad del anticuerpo por modificaciones de las histonas conservados antes de su uso en otros sistemas. Este enfoque complementa otros métodos para probar la especificidad del anticuerpo que distinguen entre Estados de modificación diferentes (por ejemplo, mono-, di - y tri-metilación), incluyendo matrices de péptidos modificados de sondeo y realizar western blot de las histonas o nucleosomas con modificaciones definidas. En general, chIP en levadura de florecimiento es un método eficaz para evaluar la dinámica de la histona MPa por todo el genoma y los mecanismos que regulan su regulación de disección.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. atar los anticuerpos bolas magnéticas

  1. Mezcla bien las bolas magnéticas de proteína A/G y transferir 20 μl de granos magnéticos por una inmunoprecipitación (IP) muestra a un tubo de 1,5 mL.
    Nota: Cuando el pipeteo granos, utilizar puntas de ancha, baja retención.
  2. Coloque el tubo con los granos en un soporte magnético y permitir cuentas recoger en el lado del tubo. Eliminar el sobrenadante.
  3. Lavar los granos 3 veces con 1 mL de solución salina fría tamponada con Tris (TBS) (50 mM Tris-HCl de pH 7.5, 150 mM NaCl).
  4. Añadir 200 μL de TBS para granos y la cantidad adecuada de anticuerpos. Gire a 8 rpm durante la noche a 4 ° C.
    Nota: Para muchos anticuerpos PTM de las histonas, 1-3 μg de anticuerpo por IP es suficiente. Sin embargo, experimentos de titulación se recomiendan determinar las concentraciones adecuadas. Concentraciones recomendadas para los anticuerpos del PTM histona bien caracterizado, comerciales a menudo son precisas y pueden encontrarse en los informes publicados o literatura del producto.
  5. Colocar los granos en un soporte magnético y eliminar el sobrenadante. Lave con 1 mL de TBS.
  6. Resuspender los granos en 20 μl de TBS por muestra IP además de 5 μl adicionales (en caso de error de pipeteo) de TBS.
    Nota: Los granos pueden almacenarse a corto plazo a 4 ° C hasta su uso.

2. cultivar las células de levadura

  1. Inocular 10 mL de YPD (Extracto de levadura 10%, 20% peptona y dextrosa 20%) con una sola Colonia de la cepa adecuada y cultivarlo a 30 ° C durante la noche en un incubador de agitación a 220 rpm.
  2. Medir la densidad óptica a 600 nm (OD600) de la cultura de la levadura utilizando un espectrofotómetro. Diluir la cultura a un OD600 = 0.2 en YPD en un nuevo frasco de 100 mL.
  3. Crecer las células en 30 ° C en un incubador de agitación en rpm 220 hasta llegar a fase media logarítmica (OD600 = 0.6-0.8).

3. en Vivo reticulación de las proteínas al ADN

  1. Cuando las culturas llegan a fase logarítmica media, añadir 2,7 mL de formaldehído al 37% directamente al medio, para una concentración final de 1% de formaldehído. Transferir el matraz a un agitador a 25 ° C (o temperatura ambiente) y agitar a 50 rpm por 15 minutos.
  2. Añadir 5 mL de 2,5 M glicina al medio y continúe la agitación a 50 rpm a temperatura ambiente durante 5 minutos calmar el formaldehído.
  3. Transferencia de las células para botellas de centrífuga y centrifugar las células a 5800 x g durante 5 min a 4 ° C. Decantar el sobrenadante.
    1. Lavar las células a resuspender en 45 mL de TBS frío y transferir la suspensión a un tubo cónico de 50 mL. Girar el tubo a 2800 x g durante 3 min a 4 ° C. Eliminar el sobrenadante.
    2. Lavado de que las células en 10 mL de frío chIP tampón de lisis (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM ácido de etilendiaminotetracético (EDTA), 1% nonidet octil phenoxypolyethoxylethanol (NP-40), almacenado a 4 ° C).
    3. Girar las células a 2800 x g durante 3 min a 4 ° C. Eliminar el sobrenadante.
      Nota: Las células pueden ser congeladas con nitrógeno líquido y almacenadas a-80 ° C hasta el procesamiento posterior.

4. hacer lisados de levadura

  1. Resuspender las células en 1 mL de tampón de lisis ChIP frío con fluoruro (PMSF) del phenylmethylsulfonyl de 1 mM y 1:1,000 dilución del inhibidor de proteasa de levadura cóctel. Transferir la suspensión a un tubo de tapón de rosca 2.0 mL que contiene 200 μL de perlas de vidrio.
  2. Transferir las células a una tira a aparatos para la agitación de alta velocidad a 4 ° C y grano supera 6 veces para 30 s cada uno. Mantener las células en hielo para por lo menos 1 minuto entre cada grano superando.
  3. Transferir el lisado a un tubo de 1,5 mL gel de puntas de carga. Centrifugue el lisado a 15.500 x g por 20 min a 4 ° C.
  4. Deseche el sobrenadante y resuspender el precipitado en 250 μl de tampón de digestión MNase (pH de 10 mM Tris-HCl 7.5, 10 mM de NaCl, 3 mM MgCl2, 21 m m CaCl2, 1% NP-40, almacenados a 4 ° C) transfiriendo suavemente hacia arriba y hacia abajo.
  5. Añadir 2,5 μl de MNase a las reacciones. Mezclar suavemente por inversión 4 - 6 veces e inmediatamente lo Incube en un baño de agua de 37 ° C por 20 min.
    Nota: Condiciones de digerir deben ser optimizadas cuando se utiliza un nuevo stock de MNase. Consulte el paso 10 del protocolo.
  6. Inmediatamente Coloque los tubos en hielo para detener la reacción y añadir 5 μl de EDTA de 0,5 M para una concentración final de 10 mM, EDTA. Mezclar suavemente por inversión.
  7. Centrífuga de la reacción a 15.500 x g durante 15 min a 4 ° C y transferir el sobrenadante a un tubo nuevo de 1,5 mL.
    Nota: Será Soluble cromatina (digerida) en el sobrenadante. El precipitado contiene restos celulares cualquier cosa sin digerir e insoluble.

5. Immunoprecipitate (IP) modifica las histonas

  1. Determinar la concentración de proteínas de cada fracción de la cromatina MNase lanzado usando un análisis de Bradford. Añadir 1 mL de reactivo de Bradford a cada uno de 8 cubetas desechables plus 1 cubeta adicional para cada muestra de la proteína a probar.
    1. Prepare una solución de 2 mg/mL de albúmina sérica bovina (BSA).
    2. Añadir el volumen adecuado para conseguir las siguientes concentraciones de BSA en 1 mL de reactivo de Bradford: 0 μg/mL, 0.5 μg/mL, 1 μg/mL, 2 μg/mL, 4 μg/mL, 6 μg/mL, 8 μg/mL y 10 μg/mL. Añadir 2 μL de la fracción de la cromatina MNase lanzado a cubetas adicionales.
    3. Cubrir la parte superior de cada cubeta con un pequeño trozo de parafilm e invertir las cubetas de 4 a 6 veces para mezclar bien la solución. Incubar las cubetas a temperatura ambiente durante 15 minutos.
    4. Utilizando un espectrofotómetro de luz visible, medir la absorbancia a 595 nm para la curva estándar y las muestras experimentales.
      Nota: Utilice la cubeta sin BSA (0 μg/mL) y en blanco el espectrofotómetro antes de realizar la primera medición.
    5. Trazar una curva estándar utilizando los valores de absorbancia para las distintas concentraciones de BSA en software de hoja de cálculo o software asociado con el espectrofotómetro. Basado en la curva estándar y utilizadas el factor de dilución (1: 500), utilizar los valores de absorbancia para calcular la concentración de proteína de cada una de las muestras de la fracción de la cromatina.
  2. Para cada IP, añadir 50 μg de proteínas totales de la fracción de la cromatina MNase lanzado a tampón de lisis de ChIP para llegar a un volumen final de 1 mL.
    Nota: Si configurar más de una IP por lisado, hacer una mezcla maestra de lisado y ChIP de tampón de lisis y alícuota 1 mL a tubos individuales para la IP.
  3. Saque 100 μl de la mezcla IP al proceso como la muestra de entrada. Congelar la entrada muestra a-20 ° C hasta el paso 7.1.
    Nota: Cualquier muestra restante de la cromatina puede congelarse a-20 ° C y utilizar una IP posterior si se desea.
  4. Añadir 20 μl de granos magnéticos de A/G de proteína previamente atado con anticuerpo para cada muestra IP.
Girar la muestra a 8 rpm durante 3 h (estándar) o durante la noche (si se prefiere) a 4 ° C.

6. lavar las IPs y eluir complejos histona-ADN

  1. Colocar los tubos en un soporte magnético y dejar granos de recoger en el lado del tubo. Quite el sobrenadante con una pipeta. Lavar los granos con 1 mL de cada uno de los amortiguadores a continuación.
    1. Realizar cada lavado girando a 8 rpm por 5 min a 4 ° C, colocar los granos en un soporte magnético, retirar el sobrenadante y añadir tampón próximo: x 2 - ChIP de tampón de lisis, 2 x - alta sal tampón de lavado (50 mM Tris-HCl pH 7,5, 500 mM NaCl, 1 mM EDTA El 1% NP-40, almacenados a 4 ° C), 1 x - LiCl y detergente lavado Buffer (10 mM Tris-HCl pH 8.0, 250 mM LiCl, 1 mM EDTA, 1% NP-40, desoxicolato de sodio al 1%, almacenado a 4 ° C), 1 x - TE (10 mM Tris-HCl pH 8.0, 1 mM EDTA, almacenado a 4 ° C) y 1 x - TE.
    2. Con el último lavado TE, transferencia de cuentas a un nuevo tubo con 0,5 mL de TE para transferir la mayor parte de los granos, luego otro 0,5 mL de TE Lave el tubo y transferir los granos restantes.
  2. Añadir 250 μl de la fresca viruta tampón de elución (1% SDS, 1 mM NaHCO3). Vórtice la solución brevemente. Rotar las muestras a 8 rpm durante 15 min a temperatura ambiente.
  3. Coloque el tubo en un soporte magnético y recoger los granos. Cuidadosamente transfiera el sobrenadante a un tubo nuevo y evitar los granos.
    Nota: El efluente contiene immunoprecipitated proteínas y ADN asociado.
  4. Añadir otro 250 μl de tampón de elución de la viruta a los granos. Rotar las muestras a 8 rpm durante 15 min a temperatura ambiente.
  5. Cuidadosamente transfiera el sobrenadante a tubo que contiene la primera elución. Si es necesario, retire un volumen menor (240 μL) para que todas las IPs evitar molestar a los granos.

7. Invierta la proteína ADN reticulaciones

  1. Descongelar las muestras de entrada y añadir 400 μL de tampón de elución de ChIP a cada entrada.
  2. Entrada tanto muestras IP, añadir 20 μl de NaCl 5 M, 5 μl de glucógeno 20 mg/mL y μl 12.5 de 20 mg/mL de proteinasa K. mezcla bien invertir o agitando los tubos. Incubar las muestras en un baño de agua de 65 ° C durante la noche.

8. purificar y concentrar el ADN

  1. Añadir 10 μl de ARNasa A 10mg/mL a la entrada y las muestras de la IP. Incubar las muestras en un baño de agua de 37 ° C durante 30 minutos.
  2. Añadir 600 μl de fenol: chlorofrom:isoamyl alcohol (25:24:1 PCI) a la solución acuosa y mezclar bien. Los hace girar a 15.500 x g durante 5 min a temperatura ambiente.
    1. Retirar la capa acuosa a un tubo nuevo. Añadir 600 μl de PCI y mezclar bien. Girar el tubo a 15.500 x g durante 5 min a temperatura ambiente. Transferir la capa acuosa a un tubo nuevo.
      PRECAUCIÓN: En la campana y usar equipo de protección personal al trabajar con PCI. Disponer residuos líquidos y sólidos por las directrices.
  3. Agregar 0.1 volumen x de acetato de sodio de 3 M y 1 mL de etanol al 100% frío para precipitar el ADN. Invertir el tubo 4 - 6 veces para mezclar bien la solución. Incubar a-20 ° C durante la noche.
    1. Girar el tubo a 15.500 x g por 20 min a 4 ° C. Retire con cuidado el sobrenadante con una pipeta.
    2. Lavar el precipitado en 1 mL de etanol frío al 70%. Vuelta a 15.500 x g por 10 min a 4 ° C. Retire con cuidado el sobrenadante con una pipeta.
    3. Secar el pellet en la campana por aproximadamente 20 min (hasta totalmente seco). Resuspender las muestras IP en 50 μl de agua libre de nucleasas y resuspender entradas muestras en 100 μl de agua libre de nucleasa. Almacenar las muestras de ADN a-20 ° C hasta realizar qPCR.

9. cuantitativo PCR (qPCR) para detectar enriquecido regiones genómicas

  1. Hacer una mezcla maestra de qPCR para cada juego de iniciadores. Una reacción contiene 5 μl de la mezcla de x qPCR 2, 0.25 μl de cebador forward de 20 μm y 0.25 μl de cebador inverso de 20 μm.
    Nota: Primer apropiado diseño y pruebas para los experimentos de qPCR son describen en otros lugares14,15,16.
  2. Hacer mezclas principales de ADN para cada muestra de ADN. Una reacción contiene 0,5 μl de ADN y 4,0 μL de agua libre de nucleasa.
  3. Agregar 5.5 μl de la mezcla principal de imprimación adecuada y 4.5 μl de la mezcla principal de ADN apropiada a cada pocillo de una placa de 384 pozos qPCR.
    Nota: Comience con la adición de 5.5 μl de la mezcla de la cartilla a cada pocillo. Haga girar la placa a 200 x g durante 1 min a temperatura ambiente antes de agregar 4.5 μl de la mezcla de ADN.
  4. Adherir el sello de la placa y la vuelta a 200 x g durante 1 min a temperatura ambiente.
  5. Realizar qPCR utilizando un sistema qPCR en tiempo real con las siguientes condiciones: 95 ° C por 3 min; 40 ciclos de 95 ° C durante 10 s, 55 ° C por 30 s; curva fusión 65 º C a 95 ° C con incrementos de 0,5 ° C, 5 s.
  6. Para cada par de la cartilla, calcular la entrada por ciento de la muestra de la propiedad intelectual en relación con la muestra de entrada 5% usada en la qPCR. Utilizar los medios de las técnica PCR triplicados para realizar los cálculos.
    Nota: Si se observa una variación sustancial en el triplicado de la polimerización en cadena, es mejor repetir la qPCR con atención a la composición de la mezcla principal, pipeteo errores y contaminación cruzada entre pozos en la placa de 384 pozos.
    1. Ajuste los valores de Cq para la entrada al 100% restando el número de ciclos que representan el factor de dilución de los valores crudos de Cq.
      Nota: La entrada de cinco por ciento representa un factor de dilución de 20-fold, que equivale a 4,32 ciclos (sesión2 20 = 4.32).
    2. Calcular el porcentaje de entrada como 2 ^ (Cqentrada - CqIP) multiplicado por 100.

10. determinar las condiciones del MNase Digest (recomendado antes chIP completo primer experimento)

  1. Siga los pasos 2.1 por 4.4 del protocolo anterior. Ampliar el protocolo para generar suficiente lisado para muestras múltiples de la digestión MNase de la pelotilla que contiene la cromatina. En paso 4.4, Resuspender el pellet en 1,25 mL de tampón de digestión MNase. Alícuota de las muestras a 5 tubos hasta que cada uno contiene 250 μl de la pelotilla de cromatina que se resuspendió en Buffer de digestión MNase.
  2. Añadir 0, 1.5, 2.5 o 5 μl de MNase a cada tubo. Mezclar suavemente por inversión 4 - 6 veces e inmediatamente incubar los tubos en un baño de agua de 37 ° C por 20 min.
  3. Inmediatamente colocar los tubos en hielo y añadir 5 μl de EDTA de 0,5 M para una concentración final de 10 mM para detener las reacciones.
Mezcle la solución suavemente por inversión.
  • Centrifugar los tubos a 15.500 x g durante 15 min a 4 ° C y transferir el sobrenadante a un tubo nuevo de 1,5 mL.
  • Añadir SDS a concentración final de 1% (25 μl de solución stock de 10%) y NaHCO3 a concentración final de 0,1 M (25 μl de solución de 1 M) para las muestras en los tubos de 1,5 mL.
  • Añadir 20 μl de NaCl 5M, 5 μl de glucógeno y 12,5 μl de proteinasa K de 20mg/mL para las muestras en los tubos de 1,5 mL. Les incubar a 65 ° C durante la noche.
  • Añadir 10 μl de RNaseA 10 mg/mL. Incubar a 37 ° C durante 30 minutos.
  • Añadir 300 μL de PCI a la solución acuosa y mezclar bien. Vuelta a 15.500 x g durante 5 min a temperatura ambiente.
    1. Retire la capa acuosa a un tubo nuevo. Añadir 300 μL de PCI y mezclar bien. Vuelta a 15.500 x g durante 5 min a temperatura ambiente. Transferir la capa acuosa a un tubo nuevo.
  • Agregar 0.1 volumen x de 3 M acetato de sodio (generalmente 30 μL) y 1 mL de etanol al 100% frío para precipitar el ADN. Invertir el tubo 4 - 6 veces para mezclar bien. Incubar el tubo a-80 ° C por 1 h o -20 ° C durante la noche.
    1. Girar el tubo a 15.500 x g por 20 min a 4° C. Retire con cuidado el sobrenadante con una pipeta.
    2. Lavar el pellet en 1 mL de etanol frío al 70%. Vuelta a 15.500 x g por 10 min a 4 ° C.
    3. Deje que las pastillas deje secar al aire en el campana aproximadamente 20 minutos (o hasta totalmente seco). Resuspender el pellet en 30 μl de agua libre de nucleasa.
  • Añadir el ADN carga del tinte y ejecutar 20 μl en una agarosa 2% gel para visualizar digiere ADN.
  • Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Un componente clave de este protocolo es optimizar la concentración de nucleasa micrococcal (MNase) utilizada para digerir la cromatina en fragmentos solubles, como se indica en el paso 10. Esto es fundamental para la obtención de datos de alta resolución con respecto a la distribución de modificaciones de las histonas en regiones genómicas de interés. Debe realizarse una valoración de MNase para determinar la concentración más adecuada para lograr principalmente mono-nucleosomas con una menor cantidad de di-nucleosomas en la fracción soluble de la cromatina. Esto puede visualizarse mediante la extracción de la DNA MNase la digestión del precipitado que contiene la cromatina y la realización de agarosa gel de electroforesis (figura 2). En la preparación de MNase aquí, 2.5 μl de enzima a 20 unidades/μl producidos predominante mono-nucleosomas, y por lo tanto, esta cantidad fue utilizada para el chIP.

    Se muestran dos conjuntos de resultados representativos para este procedimiento de viruta (figura 3). En el primer ejemplo, una marca de histona metil se evalúa en las células de tipo salvaje o las células que carecían de la metiltransferasa que cataliza esta marca. Específicamente, chIP fue realizado con un anticuerpo contra la H3K4me2, así como contra las histonas H3 como control, en células de tipo salvaje y set1Δ. H3K4me2 principalmente se localiza justo aguas abajo de la transcripción empieza el sitio en el extremo 5' de las regiones de codificación y, en ausencia de conjunto1, H3K4me2 no puede detectarse en células17,18,19. La cepa Δ set1por lo tanto sirve como un control para indicar la cantidad de señal de fondo que puede ser atribuida a la Unión inespecífica de otras marcas de histonas o ADN al anticuerpo. En este caso, la cepa de tipo salvaje mostró claro enriquecimiento para H3K4me2 en el extremo 5' de dos genes conocidos objetivos directo de conjunto1, PMA1 y ERG1120,21, mientras que no hay señal se observó en conjunto1Δ células (Figura 3A). Como era de esperar, no hay ningún enriquecimiento de la marca H3K4me2 en el telómero (TEL) 07 L. La expresión del gen medio esporulación SPR3 también se ha divulgado para regularse por Set122,23, sin embargo el enriquecimiento de H3K4me2 en el extremo 5' de la SPR3 ORF es más similar a los niveles observados en TEL07L, en comparación con el ya sea PMA1 o ERG11. Evaluar la localización de esta marca de metilo indica que regulación mediada por Set1 de SPR3 es probable que se produzca por un mecanismo diferente que PMA1 o ERG11, como previamente observados22.

    En el segundo ejemplo, chIP de H4K16 acetilado se muestra en relación con la histona H4 en células de tipo salvaje y las células que carecían de la histona deacetilasa Sir2, que elimina marcas de H4K16ac. H4K16ac es empobrecido en la cromatina heterochromatic como cerca de los telómeros y enriquecidas en eucromatina más distal de los telómeros24,25, según lo demostrado por TEL07L y TEL15L (figura 3B). Además, la pérdida de Sir2 provoca un aumento de H4K16ac en regiones teloméricas y subtelomeric específicas, aunque no se observa ningún cambio en el gen de control PMA1, donde no se conoce Sir2 localizar. Si bien estos datos muestran un claro aumento en los niveles de H4K16ac en células Δ de sir2, el cambio detectado en H4K16ac, que no se espera que sea tan importante como el cambio de H3K4me2 en wildtype versus las células Δ de conjunto1, puede ser ocultado si chIP parámetros son no está correctamente optimizado. Recomendaciones para la optimización se describen en la discusión.

    Figure 1
    Figura 1: Cronología del procedimiento chIP. Se muestra el típico calendario con el protocolo chIP. Posibles variaciones se indican en el texto. Haga clic aquí para ver una versión más grande de esta figura.

    Figure 2
    Figura 2: MNase prueba de digestión para solubilización de mono-nucleosomas. Electroforesis en agarosa de la DNA aislado después de la digestión de la pelotilla de la cromatina con cantidades variables de MNase (20 unidades/μL). ADN de mononucleosomes migra a aproximadamente 150 bp, de dinucleosomes en aproximadamente 300 bp y de la DNA de polynucleosomes se encuentra en pesos moleculares cada vez más altas. Haga clic aquí para ver una versión más grande de esta figura.

    Figure 3
    Figura 3 : ChIPs de H3K4me2 y de H4K16ac de tipo salvaje y mutante levaduras. ChIP (A) usando los anticuerpos contra H3K4me2 y H3 fue realizado en células de tipo salvaje y set1Δ. Entrada por ciento fue calculado para cada par de cartilla para el H3K4me2 y el IPs de H3 y el cociente se graficaron para indicar que el enriquecimiento relativo de H3K4me2 en los lugares indicados. Los cebadores para PMA1, ERG11 y SPR3 generan amplicones en el extremo 5' de cada ORF, considerando que el par de la cartilla de TEL07L adyacente a los telómeros en el brazo izquierdo del cromosoma 7. Se muestra la media de tres réplicas biológicas y las barras de error representan el error estándar de la media. (B) ChIP fue realizado con anticuerpos reconocimiento de H4K16ac y H4 en células de tipo salvaje y sir2Δ y grafica como se describe para la Figura 3A. Pares de cartilla amplifican secuencias adyacentes a los telómeros (TEL07L y TEL15L) y aguas abajo en previamente definidas regiones euchromatic del cada subteloméricas (21 kb y 5 kb de distal de los telómeros, respectivamente).Haga clic aquí para ver una versión más grande de esta figura.

    Número de cepa Genotipo Referencia
    yEG230 MATα his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 23
    yEG223 MATα sir2Δ::NATMX Este estudio
    yEG232 Set1Δ::KANMX MATa 23

    Tabla 1: Cepas de levadura utilizadas en este estudio.

    Número de OLIGO Ubicación Secuencia de
    oEG141 TELVIIL F AGCCCGAGCCTGTACTAAAT
    oEG142 TELVIIL R CAAAAGAAACTTTTCATGGCA
    oEG153 5' PMA1 F TCAGCTCATCAGCCAACTCAAG
    oEG154 5' PMA1 R CGTCGACACCGTGATTAGATTG
    oEG220 TELVIIL + F DE 21 KB AAACAATGGGACCCTTCTGA
    oEG221 TELVIIL + R DE 21 KB AACACCTTGCAAAACACAGG
    oEG280 TELXVL F ATCCTGCAATTGGGCCACTAT
    oEG281 TELXVL R AGCGGAAGGCATATTAACGT
    oEG282 TELXVL + F DE 5 KB AGGCGATGTAATCTCACCAA
    oEG283 TELXVL + R DE 5 KB CATTCACACATCCTGCTACCA
    oEG568 ERG11 F CCTCTTATTCCGTCGGTGAA
    oEG569 ERG11 R TGTGTCTACCACCACCGAAA
    oEG963 F SPR3 TCTGGATTCGCTGAGGAAGT
    oEG964 R SPR3 TTTCAGTTCAGGGCTTTTCG

    Tabla 2: Cartillas utilizadas en este estudio.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    El procedimiento aquí descrito permite la eficiente recuperación de ADN asociada con histonas modificadas en las células de levadura por la inmunoprecipitación. Esto es seguido por qPCR utilizando cebadores que amplifican regiones de interés para determinar el enriquecimiento local o el agotamiento de las modificaciones específicas de histonas. A pesar de ser desarrollado como un método hace casi 20 años, chIP sigue siendo el ensayo definitorio para investigar el estado de modificación de las histonas en diferentes regiones genómicas y bajo diversas condiciones. Aunque el chIP junto a la siguiente generación de tecnologías de secuenciación pueden interrogar a modificaciones de las histonas en una escala genoma-ancha6,7, los costos y análisis de datos requiere de estos enfoques pueden limitar su uso en algunos entornos de laboratorio. Además, estos experimentos epigenómica a menudo son seguidos por chIP juntada a la qPCR para validar las observaciones del estado de modificación de las histonas en algunos lugares geométricos genomic. Hay pocos métodos comparables que proporcionan la utilidad del chIP físicamente enlazan a una marca de histona (o de otras proteínas) a una ubicación específica dentro del genoma y análisis de la dinámica de esta interacción en diferentes condiciones ambientales o biológicas . Aunque ha habido reciente éxito en aislar la cromatina de regiones genómicas definidas e identificación de las marcas locales de histonas mediante espectrometría de masas8,9,10,11, estos métodos plantean dificultades técnicas y su utilidad en tipos diversos de laboratorio pueden ser limitadas por un acceso adecuado a los recursos de análisis de instrumentación y datos de espectrometría de masas. El protocolo descrito aquí es técnicamente y económicamente accesible a la configuración de laboratorio diversas, con el principal obstáculo posible siendo acceso a una máquina de qPCR. ChIP sigue siendo el estándar de oro para definir la localización genómica de histonas modificadas en levadura y otros sistemas.

    Se trata de un protocolo versátil con una serie de pasos que pueden ser optimizados para adaptarse a diferentes condiciones experimentales, incluyendo la prueba simultáneamente varios mutantes o condiciones ambientales. Alternativamente, cromatina suficiente normalmente es generada de un lisado para realizar múltiples IPs con hasta por lo menos cuatro diversos anticuerpos. Este protocolo también puede utilizarse para chIP de proteínas no histonas de la cromatina que son etiquetadas del epítopo, o para los que se han generado anticuerpos. Si este protocolo debe ser adaptada para el chIP de proteínas no histonas, parámetros incluyendo el tiempo de fijación, concentración de cromatina en la IP y la concentración de anticuerpos suelen ser críticos para obtener el enriquecimiento de la proteína específica sobre fondo. Por lo general, es útil para aumentar el tiempo de fijación con formol a entre 45 y 60 min y a aumentar la cantidad de cromatina en el IP (hasta 200 μg de la proteína total).

    Hay un número de variables posibles que contribuyen a la calidad y reproducibilidad de los experimentos de chIP de modificación de histonas. Aunque un experimento óptimo a menudo puede producir resultados positivos cuando se comparan las diferencias clara (por ejemplo, los niveles de H3K4me2 en wildtype o set1Δ las células, como se muestra en la Figura 3A), más diferencias sutiles suelen ser enmascarados en un experimento mal realizado (por ejemplo, los diferentes niveles de H4K16ac en TEL07L en wildtype o sir2Δ las células, como se muestra en la figura 3B). Parámetros experimentales a considerar incluyen la cantidad de células de levadura utilizadas, tiempo de fijación, concentración de la fracción de la cromatina en la IP, tamaño de fragmento de los complejos DNA-proteína digeridos y la calidad de anticuerpos y la concentración. Una limitación de este enfoque es la optimización de parámetros experimentales generalmente se requiere para cada modificación de las histonas está probando y las cepas mutantes y/o condiciones bajo investigación. Puede haber diferencias sutiles en las histonas marca niveles o localización bajo diferentes condiciones, y depende de la capacidad para detectar estas diferencias en los parámetros descritos anteriormente. Se discuten algunas de las consideraciones claves para el desarrollo de los enfoques experimentales más sensibles más abajo.

    Como se describe en el protocolo, se recomienda probar varias concentraciones de MNase para determinar la concentración óptima, antes de realizar un experimento de chIP completo. Asegurar que el ADN dentro de la propiedad intelectual está fragmentado adecuadamente es clave para obtener alta resolución resultados de chIP. A pesar de que el tamaño del amplicón de los productos de qPCR puede ser pequeño (generalmente menos de 100 bp), si el tamaño del fragmento de la DNA es substancialmente más grande, la qPCR puede indicar falso enriquecimiento en un locus específico cuando, en realidad, se puede localizar la marca de la histona cientos de basepairs lejos. Mientras que este protocolo se basa en MNase para solubilizar la cromatina en mono - y di-nucleosomas, otros protocolos de chIP también suele utilizan sonicación para esquileo cromatina6,7. Sonicación es un método fiable para solubilizar fragmentos de cromatina, aunque los tamaños de corte tienden a ser menos uniformes y puede ser más difícil de lograr resultados consistentes entre experimentos. Aunque sonicación puede ser preferible para el chIP de algunas proteínas no histonas, el uso de MNase para digerir la cromatina en principalmente mono-nucleosomas puede mejorar la resolución de los experimentos de chIP de modificación de histonas.

    Un requisito para un experimento acertado chIP es un anticuerpo que única y con alta afinidad reconoce la modificación de la histona de interés. La limitación principal del chIP como un método para la detección de la modificación de las histonas es su dependencia de un anticuerpo de alta calidad, validado; sin tal reactivo, resultados de chIP no suelen ser biológicamente relevantes. Hay un número de anticuerpos comercialmente disponible contra modificaciones de las histonas encontradas levadura de florecimiento, aunque la calidad y validez de los anticuerpos es variable. Esfuerzos para validar estos anticuerpos han producido recursos útiles para determinar el mejor anticuerpo disponible para un experimento determinado26. Es aconsejable que anticuerpos utilizados para chIP son validados con una diversidad de métodos para su especificidad, incluyendo arreglos de disco de sondeo de péptidos histona modificado y sin modificar, realizar western blot de extractos de células enteras y purificada de las histonas y en experimentos con controles adecuados, tales como cepas con una enzima modifica elimina o llevar mutaciones puntuales en el residuo de histonas modificadas de la viruta. Nuevos anticuerpos que reconocen marcas no caracterizadas o anticuerpos generados por el laboratorio, estos experimentos de especificidad son críticos para determinar si el anticuerpo puede ser un reactivo válido para chIP.Además de validar la especificidad del anticuerpo, realizar una titulación de anticuerpos para la IP de una cepa de tipo salvaje y una cepa control negativo es a menudo útil para determinar la cantidad de anticuerpos requeridos (en relación con una concentración de cromatina set) a detectar diferencias precisas en enriquecimiento entre cepas o regiones del genoma. Además, si algunos datos con respecto a los patrones de distribución genómica de la marca están conocida, positivos y negativos control primer sets deberían incluirse en todos los experimentos de qPCR para validar cualquier experimento individual y para simplificar las comparaciones entre experimentos.

    En general, este trabajo describe un método fundamental para los investigadores interesados en interrogar el estado de modificación de las histonas en cualquier región genómica en levadura de florecimiento. La versatilidad de este protocolo y su aplicabilidad a diversas preguntas experimentales es una herramienta extremadamente útil para disección dinámica de la cromatina a nivel molecular.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Los autores no tienen nada que revelar.

    Acknowledgments

    Los autores desean agradecer a miembros del laboratorio verde para discusiones útiles. Este trabajo fue apoyado en parte por subvenciones de NIH R03AG052018 y R01GM124342 a E.M.G.

    Materials

    Name Company Catalog Number Comments
    Yeast Extract Research Products International (RPI) Y20025-1000.0
    Peptone Research Products International (RPI) P20250-1000.0
    Dextrose ThermoScientific BP350-1
    Formaldehyde Sigma-Aldrich F8775
    Glycine Fisher Scientific AC12007-0050
    Tris Amresco 0497-5KG
    EDTA Sigma-Aldrich E6758-500G
    NaCl ThermoScientific BP358-10
    4-Nonylphenyl-polyethylene glycol Sigma-Aldrich 74385 Equivalent to NP-40
    MgCl ThermoScientific S25533
    CaCl2 Sigma-Aldrich 20899-25G-F
    LiCl ThermoScientific AC413271000
    Sodium Dodecyl Sulfate Amresco M107-1KG
    Sodium Deoxycholate Sigma-Aldrich 30970-100G
    Sodium Acetate Sigma-Aldrich S2889
    NaHCO3 ThermoScientific S25533
    PMSF Sigma-Aldrich P7626-5G
    Yeast protease inhibitor cocktail VWR 10190-076
    25 Phenol:24 Chloroform:1 Isoamyl Alcohol VWR Life Science 97064-824
    Ethanol Sigma-Aldrich E7023
    Nuclease-Free Water VWR 100720-992
    Micrococcal Nuclease Worthington Biochemical LS004797
    Glycogen ThermoScientific R0561
    Proteinase K Research Products International (RPI) P50220-0.1
    RNase A  Sigma-Aldrich R6513-50MG
     Bradford Assay Reagent ThermoScientific 23238
     BSA Standard 2 mg/mL ThermoScientific 23210
    α H4 EMD Millipore 04-858
    α H4K16ac EMD Millipore ABE532
    α H3 Abcam ab1791
    α H3K4me2 Active Motif 39142
     High Rox qPCR Mix Accuris qMax Green, Low Rox qPCR Mix ACC-PR2000-L-1000
    Protein A/G Magnetic Beads ThermoScientific 88803
    magnetic stand for 1.5mL tubes Fisher Scientific PI-21359
    Acid-Washed Glass Beads Sigma-Aldrich G8772
     Microtube Homogenizer Benchmark D1030
    2.0 mL screw-cap tubes with sealing rings Sigma-Aldrich Z763837-1000EA
    Gel loading tips Fisher Scientific 07-200-288
    Cuvettes Fisher Scientific 50-476-476
    Parafilm Fisher Scientific 13-374-10
    50 mL conical tubes Fisher Scientific 14-432-22
    384-Well PCR Plate Fisher Scientific AB-1384W
     Gyratory Floor Shaker New Brunswick Scientific Model G10
    Spectrophotometer ThermoScientific ND-2000c
     Real-Time PCR Detection System Bio-Rad 1855485

    DOWNLOAD MATERIALS LIST

    References

    1. Jaiswal, D., Turniansky, R., Green, E. M. Choose Your Own Adventure: The Role of Histone Modifications in Yeast Cell Fate. J Mol Biol. 429, (13), 1946-1957 (2017).
    2. Suganuma, T., Workman, J. L. Signals and combinatorial functions of histone modifications. Annu Rev Biochem. 80, 473-499 (2011).
    3. Solomon, M. J., Varshavsky, A. Formaldehyde-mediated DNA-protein crosslinking: a probe for in vivo chromatin structures. P Natl Acad Sci USA. 82, (19), 6470-6474 (1985).
    4. Solomon, M. J., Larsen, P. L., Varshavsky, A. Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene. Cell. 53, (6), 937-947 (1988).
    5. Gilmour, D. S., Lis, J. T. Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes. P Natl Acad Sci USA. 81, (14), 4275-4279 (1984).
    6. Lefrançois, P., et al. Efficient yeast ChIP-Seq using multiplex short-read DNA sequencing. BMC Genomics. 10, 37 (2009).
    7. Furey, T. S. ChIP-seq and beyond: new and improved methodologies to detect and characterize protein-DNA interactions. Nat Rev Genet. 13, (12), 840-852 (2012).
    8. Déjardin, J., Kingston, R. E. Purification of proteins associated with specific genomic Loci. Cell. 136, (1), 175-186 (2009).
    9. Byrum, S. D., Raman, A., Taverna, S. D., Tackett, A. J. ChAP-MS: a method for identification of proteins and histone posttranslational modifications at a single genomic locus. Cell Rep. 2, (1), 198-205 (2012).
    10. Soldi, M., Bremang, M., Bonaldi, T. Biochemical systems approaches for the analysis of histone modification readout. Biochim Biophys Acta. 1839, (8), 657-668 (2014).
    11. Soldi, M., Bonaldi, T. The ChroP approach combines ChIP and mass spectrometry to dissect locus-specific proteomic landscapes of chromatin. J Vis Exp. (86), (2014).
    12. Kuo, M. H., Allis, C. D. In vivo cross-linking and immunoprecipitation for studying dynamic Protein:DNA associations in a chromatin environment. Methods. 19, (3), 425-433 (1999).
    13. Meluh, P. B., Broach, J. R. Immunological analysis of yeast chromatin. Methods Enzymol. 304, 414-430 (1999).
    14. Rozen, S., Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 132, 365-386 (2000).
    15. Taylor, S., Wakem, M., Dijkman, G., Alsarraj, M., Nguyen, M. A practical approach to RT-qPCR-Publishing data that conform to the MIQE guidelines. Methods. 50, (4), S1-S5 (2010).
    16. Rodríguez, A., Rodríguez, M., Córdoba, J. J., Andrade, M. J. Design of primers and probes for quantitative real-time PCR methods. Methods Mol Biol. 1275, 31-56 (2015).
    17. Briggs, S. D., et al. Histone H3 lysine 4 methylation is mediated by Set1 and required for cell growth and rDNA silencing in Saccharomyces cerevisiae. Gene Dev. 15, (24), 3286-3295 (2001).
    18. Bernstein, B. E., et al. Methylation of histone H3 Lys 4 in coding regions of active genes. P Natl Acad Sci USA. 99, (13), 8695-8700 (2002).
    19. Pokholok, D. K., et al. Genome-wide map of nucleosome acetylation and methylation in yeast. Cell. 122, (4), 517-527 (2005).
    20. Krogan, N. J., et al. The Paf1 complex is required for histone H3 methylation by COMPASS and Dot1p: linking transcriptional elongation to histone methylation. Mol Cell. 11, (3), 721-729 (2003).
    21. South, P. F., Harmeyer, K. M., Serratore, N. D., Briggs, S. D. H3K4 methyltransferase Set1 is involved in maintenance of ergosterol homeostasis and resistance to Brefeldin A. P Natl Acad Sci USA. 110, (11), E1016-E1025 (2013).
    22. Margaritis, T., et al. Two distinct repressive mechanisms for histone 3 lysine 4 methylation through promoting 3'-end antisense transcription. PLoS Genet. 8, (9), e1002952 (2012).
    23. Jezek, M., et al. The histone methyltransferases Set5 and Set1 have overlapping functions in gene silencing and telomere maintenance. Epigenetics. 12, (2), 93-104 (2017).
    24. Suka, N., Luo, K., Grunstein, M. Sir2p and Sas2p opposingly regulate acetylation of yeast histone H4 lysine16 and spreading of heterochromatin. Nat Genet. 32, (3), 378-383 (2002).
    25. Kimura, A., Umehara, T., Horikoshi, M. Chromosomal gradient of histone acetylation established by Sas2p and Sir2p functions as a shield against gene silencing. Nat Genet. 32, (3), 370-377 (2002).
    26. Rothbart, S. B., et al. An Interactive Database for the Assessment of Histone Antibody Specificity. Mol Cell. 59, (3), 502-511 (2015).
    Inmunoprecipitación de cromatina (ChIP) de modificaciones de las histonas de <em>Saccharomyces cerevisiae</em>
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Jezek, M., Jacques, A., Jaiswal, D., Green, E. M. Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae. J. Vis. Exp. (130), e57080, doi:10.3791/57080 (2017).More

    Jezek, M., Jacques, A., Jaiswal, D., Green, E. M. Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae. J. Vis. Exp. (130), e57080, doi:10.3791/57080 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    Simple Hit Counter