Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Cancer Research

Een uitgebreide Procedure voor de evaluatie van de prestaties In Vitro van de vermeende Hemangioblastoma Neovascularization met behulp van de kiemen Assay sferoïde

doi: 10.3791/57183 Published: April 12, 2018

Summary

Dit artikel presenteert een uitgebreide procedure om te evalueren in vitro of klassieke tumor angiogenese in hemangioblastomas (HBs) en haar rol in de HBs bestaat. De resultaten wijzen op de complexiteit van de HB-neovascularization en suggereren dat deze gemeenschappelijke vorm van angiogenese slechts een aanvullende mechanisme in de HB-neovascularization is.

Abstract

De inactivering van het von Hippel-Lindau (VHL) tumor suppressor gen speelt een cruciale rol in de ontwikkeling van de hemangioblastomas (HBs) binnen het menselijk zenuwstelsel (CNS). Echter zowel de cytologische oorsprong en het evolutieproces van HBs (inclusief neovascularization) blijven omstreden, en anti-angiogenese voor VHL-HBs, gebaseerd op de klassieke HB angiogenese, teleurstellende resultaten in de klinische proeven hebben opgeleverd. Een belangrijke belemmering voor de succesvolle klinische vertaling van anti-vasculaire behandeling is het ontbreken van een grondige kennis van neovascularization in deze vasculaire tumor. In dit artikel presenteren we een uitgebreide procedure om te evalueren in vitro of klassieke tumor angiogenese in HBs, evenals zijn rol in de HBs bestaat. Met deze procedure, kunnen onderzoekers nauwkeurig begrijpen de complexiteit van HB neovascularization en identificeren van de functie van deze gemeenschappelijke vorm van angiogenese in HBs. Deze protocollen kunnen worden gebruikt om de meest veelbelovende anti-vasculaire therapie voor tumoren, die hoge translationeel potentieel tumoren behandeling of heeft voor medeplichtigheid in de optimalisatie van de anti-angiogenic behandeling van HBs voortaan vertalingen evalueren. De resultaten wijzen op de complexiteit van HB neovascularization en suggereren dat dit gemeenschappelijk formulier angiogenese slechts een aanvullende mechanisme in HB neovascularization is.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hemangioblastomas (HBs) zijn goedaardige vasculaire tumoren die uitsluitend binnen het menselijk zenuwstelsel (CNS) worden gevonden. Zij ontwikkelen bij patiënten met de ziekte van von Hippel-Lindau (VHL) of sporadische laesies. VHL-HBs zijn moeilijk te genezen door middel van de chirurgische behandeling als gevolg van de frequente herhaling en meerdere letsels die het gevolg zijn van deze genetische wanorde1. Hoewel de inactivering van het VHL tumor suppressor gen is beschouwd als de oorzaak van de tumorigenesis van VHL-HBs, blijven de cytologische oorsprong (met inbegrip van neovascularization) en het evolutieproces van HBs grotendeels controversiële2. Dus, een beter begrip van HB-neovascular biologische mechanismen kan voorzien nuttige inzichten in de strategieën van de meest veelbelovende anti-vasculaire VHL-HBs.

Recent onderzoek heeft gesuggereerd dat HB-neovascularization vergelijkbaar met de embryologic vasculogenese3,4,5 is. Klassieke vasculaire endotheliale-groeifactor (VEGF)-gemedieerde angiogenese die afkomstig is van het vasculaire endotheel en die wordt aangestuurd door VHL verlies van functie resulteerde in proliferatie en neovascular formatie, die is6uitgedaagd. In 1965, Cancilla en Zimmerman gevonden, met behulp van elektronenmicroscopie, die HBs afkomstig van het endotheel-7 zijn. Later bleek dat stromale cellen zijn afgeleid van vasoformative element8. In 1982 vonden Jurco et al. dat stromale cellen van endothelial oorsprong9. Dus veronderstelde we dat menselijke vasculaire endotheliale cellen de oorspronkelijke cellen van HB-neovascularization10 zijn. Hoewel het is beter om het gebruik van de primaire culturen uit HB-cellen afgeleid van VHL patiënten chirurgische ingrepen, onze vorige onderzoek aangegeven dat primaire culturen van HB niet stabiel zijn, en cellijnen gevestigde3niet kon worden. Bovendien, de primaire culturen in de 3D-omgeving kunnen niet identificeren de cytologische oorsprong van HB-neovascularization omdat zij de progenitoren van HB-vasculaire ingrediënten10,11 omvatten. Daarom, als een primitieve en klassieke model van endotheliale cellen, kunnen menselijke vasculaire endotheliale cellen (HUVEC) dienen als een alternatief cellulaire model voor HBs.

De gekiemde assay sferoïde is een nieuw model in weefsel engineering12,13. In deze paper, een 3D collageen gebaseerde coculture systeem in vitro met behulp van de sferoïde kiemen assay werd ontwikkeld, met een algemene doelstelling om te evalueren of klassieke tumor angiogenese in HBs, evenals zijn rol in de HBs bestaat.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Deze methode werd uitgevoerd overeenkomstig de goedgekeurde richtsnoeren en voorschriften van het onderzoek ethisch comité van Huashan ziekenhuis, Fudan Universiteit. Bijbehorende standaard veiligheidsmaatregelen werden gevolgd in elke stap. Voor een schematische presentatie, Zie Figuur 1.

1. cel cultuur en plasmide Construct

  1. Regelmatig onderhouden de menselijke navelstreng ader endothelial cel (HUVEC) in Dulbecco gewijzigd van Eagle's medium (DMEM), aangevuld met 10% foetale runderserum (FBS), 100 eenheid/mL penicilline en 100 µg/mL streptomycine in een bevochtigde 5% CO2 incubator bij 37 ° C.
  2. PLKO.1 van de Digest plasmide met ApaI en EcoRI voor de synthese van shRNA fragment. Zorg ervoor dat de volgorde van oligonucleotide van VHL shRNA vector CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14.
  3. Meng vervolgens 20 µΜ systeem met voorwaartse 5 µL van oligo, 5 µL van omgekeerde oligo, 5 µL van 10 x NEB buffer en 35 µL van ddH2O samen (het totale volume is 50 µL). Verwarm het mengsel bij 98 ° C gedurende 4 min, en langzaam laat afkoelen tot kamertemperatuur in een paar uur.
  4. Het afbinden van de ontharde oligos en PLKO.1 plasmide samen met T4 ligase bij 4 ° C voor overnachting. 16 h later toevoegen 5 µL van afbinding mix in 25 µL bevoegde DH5α cellen. Vervolgens scherm de met succes ligaturen plasmiden, en controleer of het ingevoegde fragment door sequentiebepaling.

2. lentivirus pakket en infectie

  1. Meng 10 µg van de PLKO.1-shVHL of PLKO.1-shScramble-vector, 7,5 µg plasmide psPAX2 verpakking en 2,5 µg envelop plasmide pMD2.G in 500 µL van de DMEM media zonder foetale runderserum (FBS) gedurende 25 minuten in totaal.
  2. 7 mLDMEM zonder FBS aan de oplossing bereid hierboven toevoegen.
  3. Cultuur 293FT cellen in de DMEM zonder FBS in een 10-cm doorsnede weefselkweek gerechten. Zorg ervoor dat het aantal 293FT cellen 1 x 107 met behulp van een cel-teller.
  4. Voeg 1 mL van de oplossing bereid boven aan het medium van 293FT cellen voor Transfectie.
    Opmerking: De cellijn 293FT is afgeleid van de cellijn van 293F en stabiel express het SV40 grote T antigeen. Daarom is het een geschikte gastheer voor de productie van de lentivirale.
  5. Het kweekmedium vervangen door de DMEM met 10% FBS na 6 uur.
  6. De media met behulp van een precisiepipet in 48 h na de Transfectie te verzamelen.
    Opmerking: Het virus bestaat in de DMEM met 10% FBS. De dode cellen drijven op het medium. Steriele membraan van 0,45 µm gebruiken voor het filteren van de dode cellen en onzuiverheden. In het algemeen is er geen behoefte om te controleren van de veelheid van infectie (MOI). Dit is om een stabiele cellen-lijn. Bij de laatste stap, zal alle levende cellen zonder succesvolle infectie sterven door puromycin. De shScramble group en de HUVEC cellen zijn de controlegroep. Zorg ervoor dat alle HUVEC cellen met de concentratie van de gebruikte puromycin door 72 h sterven. Elke goed heeft hetzelfde aantal cellen.
  7. Cultuur van de HUVEC cellen in de lentivirale media voor 72 uur. Dan, voeg puromycin aan de media van de HUVEC cellen in een concentratie van 2 µg/mL voor 24 h. gebruik HUVEC cellen zonder behandeling als de controlegroep. Ervoor zorgen dat alle controle cellen sterven door deze tijd.
    Opmerking: De levende cellen, vormen een stabiele cellijn van VHL vechtpartij cellen en shSramble cellen. De plating-dichtheid is 5.000 per putje in 96-wells-platen.

3. productie van Endothelial cel spheroïden

  1. Trypsinize van de HUVECs cellen en resuspendeer in het medium van de DMEM met 10% FBS. Met een matig aantal cellen in een schaal 10-cm cultuur, voeg 1 mL typsin-EDTA.
  2. Het zaad van de cellen in een 3D ronde-96-Wells bodemplaat, bij een celdichtheid van 1 × 103 cellen per putje. Gebruik een goed geschikt voor een sferoïde van 0,50 µL op te schorten de sferoïde. Cellen tellen met behulp van een cel teller systeem volgens de instructies van de fabrikant.
  3. Incubeer de cellen bij 37 ° C en 5% CO2 voortdurend voor 72 uur. Zorg ervoor dat de zwevende cellen de spheroïden cel automatisch vormen onder deze omstandigheden. Vervang de helft van het kweekmedium na 36 h.

4. in vitro angiogenese Assay

  1. Ontdooi de gel-oplossing bij 4 ° C en Verdun het met het medium van de verminderde serum met een onderlinge verdunningsverhouding 1:5.
  2. De spheroïden van het DMEM-kweekmedium met een micropipet te zuigen. Na het wassen schorsen de spheroïden met 5 mL van de verminderde serum medium, de spheroïden zachtjes en voorzichtig in de verdunde gel. Ervoor zorgen dat er geen luchtbellen.
  3. 300 µL van gemengde vloeistof in een 15-well-plate insluiten. Na incubatie bij 37 ° C en 5% CO2 voor 1 h, toevoegen 400 µL het verminderde serum medium aan elk putje. Het vullen van steriel water rond de putten voor het genereren van een bevochtigde omgeving om verdamping in de weg staan.
  4. Daarna cultuur de plaat bij 37 ° C in 5% CO2 op 100% vochtigheid gedurende 1 uur.
  5. Zorgvuldig de oud medium gecombineerd en vervang deze door 600 µL van verminderde serum medium met 1% endothelial cel groei supplementen in elk putje.
  6. Na 12 h of 24 h, nemen beelden onder een omgekeerde licht microscope (40 *).

5. de gegevensanalyse

  1. De afbeeldingen uploaden naar een online imago analyse platform om het verkrijgen van gegevens van de lengte van de stronk (Tabel van materialen).
  2. Maak een account per e-mail op de webpagina.
  3. Vervolgens uploaden de beelden door te klikken op de knop ' uploaden '.
  4. Download het resultaat door te klikken op de downloadknop.
    Opmerking: De software genereert u de bewerkte afbeelding en de gegevens. De gegevens bevatten vijf delen: cumulatieve sprout lengte, gemiddelde sprout de lengte, de standaarddeviatie van sprout lengte, sprout gebied en sferoïde gebied. In het verwerkte beeld, wordt elke parameter beschreven in een andere kleur te verlichten identificatie in de bewerkte afbeelding: rode vertegenwoordigt spruiten skelet, het aantal spruiten geel, blauw de stronk structuur, witte stronk einde en oranje sferoïde.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Originele beelden zijn genomen door omgekeerde lichte Microscoop. De typische beelden van de controlegroep en de groep VHL zijn afgebeeld in Figuur 2-A1 en Figuur 2-A2. De gekiemde lengte van de controlegroep is korter dan die van de VHL-groep.

Na het uploaden van de beelden, biedt het online platform rechtstreeks analyseresultaten. De uitvoer bestaat uit twee delen: de bewerkte afbeelding en de bijbehorende analyseresultaten. De verwerkte beelden van de controlegroep en de VHL-gen stilte-groep worden met verschillende kleuren gemarkeerd (Figuur 2-A3 en Figuur 2-A4). De gemiddelde sprout lengte 65 µm en 125 µm in de controlegroep en de groep van de VHL stilte, respectievelijk, en de gemiddelde cumulatieve sprout lengte wordt 680 µm en 1250 µm in de controlegroep en de groep van de VHL stilte, respectievelijk, die aangeeft dat ontkiemen lengte toeneemt door ongeveer twee plooien in de VHL stilte groep, in vergelijking met de controlegroep (Figuur 2B). Deze resultaten wijzen erop dat VHL deficiëntie het vaartuig-vormende vermogen van menselijke endotheliale cellen bevordert.

Figure 1
Figuur 1 . Het schema voor de sferoïde kiemen assay. Stap 1 ziet u HUVEC cellen gekweekt een schotel. In stap 2, HUVEC cellen verplaatst naar 3D ronde onderkant 96-wells-platen voor 72 h. dat stap 3 toont de HUVEC cellen vorm endothelial cel spheroïden automatisch in de 3D-plaat. Toevoegen in stap 4, cel sferoïde aan verdunde gel. Voeg het mengsel bereid boven op een bord van 15-well in stap 5. Stap 6 toont sferoïde kiemen in de plaat 15-well. Stap 7 weergeven de gekiemde beeld genomen onder een omgekeerde lichte Microscoop. Stap 8 toont het geüploade image en stap 9 is de output afbeelding van het platform (bar = 100 µm). Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 . Het effect van de VHL gene zwijgen op het angiogenic vermogen van HUVEC cellen in de sferoïde assay kiemen. (A) representatieve beelden van tuit uitgroei na 12u in de controle (A1) en VHL-zwijgen HUVEC spheroïden (A2) (bar = 100 µm). Toon de afbeeldingen geanalyseerd door het platform voor cijfers A1 en A2, respectievelijk cijfers A3 en A4. Rode vertegenwoordigt spruiten skelet, het aantal spruiten geel, blauw de stronk structuur, witte stronk einde en oranje sferoïde. (B) lengte van de spruiten. Statistische analyse werd uitgevoerd met behulp van de ongepaarde Student t-test. * vertegenwoordigen P < 0.05. CON, controle; HUVEC, menselijke navelstreng ader endothelial cel. Klik hier voor een grotere versie van dit cijfer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Meerdere velden van vasculaire biologie onderzoek werden onlangs, gestimuleerd door de studie van de angiogenic endotheel15. In dit artikel, ontwikkelden we een endothelial sferoïde kiemen techniek als een experimenteel model om te bestuderen van de vorming van het vaartuig dat afkomstig van het VHL-gen verlies van functie in gemanipuleerde endotheliale cellen is te identificeren van nieuwe kandidaat-moleculen van de angiogenic cascade. Tot de beste van onze kennis is dit het eerste verslag het angiogenic effect van de opbouwt gemodificeerde endotheliale cellen te onderzoeken.

Weefsel (met inbegrip van tumor weefsel) neovascularization is een complex proces dat via angiogenic en vasculogenic mechanismen tijdens de ontwikkeling, maar ook in beide fysiologische en pathologische omstandigheden12,15 plaatsvindt , 16. de sferoïde kiemen assay wordt gekenmerkt door een complexe opeenvolging van gebeurtenissen17,18, met inbegrip van de zelfstandige bundeling van endotheliale cellen die zijn ingesloten in een 3D matrix celcultuur, waardoor kiemen en de reproductie van het 3D-netwerk van haarvaten19. Deze 3D gel-embedded sferoïde-model is een veelgebruikt systeem in weefselengineering voor het bestuderen van de vasculaire vorming en de mechanismen vanwege zijn vermogen om te zorgen voor een beter nabootsen omgeving in een geschikte matrix geworden. De meest cruciale stap van deze biologisch proces is echter het activeren van sluimerende endotheliale cellen17,20,21,22. In deze procedure werden de endotheliale cellen geactiveerd door de opbouwt monddood maken van de VHL-gen, een regelgever groei gen van neovessels23,24. Anders dan de klassieke endotheel initiatie via de exogene inductie van de matrix en de bijbehorende extracellulaire milieu (inclusief exogene vasculaire groeifactoren), deze gewijzigde methode kan worden uitgebreid tot talrijke toepassingen te ontrafelen opbouwt genetische mechanismen. Vervolgens werd het protocol om te verminderen de effecten van de exogene matrix, geoptimaliseerd door verdunning van de gel, die een eenvoudige stap in het experiment was. Bovendien, duurde het slechts minuten uploaden van afbeeldingen naar het platform te verkrijgen van de resultaten van de analyse. Het platform biedt een analyse-afbeeldingservice waarmee de experimentator te maken van een objectieve, vergelijkbare, en automatische beeldanalyse van kiemen assay beelden online. Daarom is het protocol overwint meet- en rekentechniek fouten als gevolg van door de mens veroorzaakte factoren.

Het mechanistische begrip van de afzonderlijke stappen van de cascade neovascularization verstrekt een rationele basis voor de ontwikkeling van de anti-vasculaire behandeling dat momenteel wordt erkend om klinische toepassing in oncologie. Deze paper opgericht een eenvoudig en robuust sferoïde gebaseerde assay-model om te studeren vaartuig formatie die afkomstig van gemanipuleerde endotheliale cellen met verlies van functie van het VHL -gen is te identificeren van nieuwe kandidaat-moleculen voor de neovascularization trapsgewijs, die kan worden gebruikt voor tal van angiogenese - en vasculogenese-gerelateerde toepassingen. De auteurs speculeren dat dit model in vitro misschien het verschaffen van aanvullende informatie die u helpen de rol van de angiogenese in sommige solide tumoren (bijvoorbeeld tumor vasculogenic mimicry) evalueren en onderzoeken van de potentiële rol van andere mogelijke voorlopercellen voor het genereren van tumor neovessels in vivo, met name bij patiënten met tumoren die, als een groep, niet reageert op de behandeling met anti-angiogenic agenten alleen zijn.

De gekiemde assay sferoïde is uitgegroeid tot een veel gebruikte methode om te studeren angiogenese en aanverwante mechanismen. De bepaling heeft een belangrijk voordeel door een beter mimic omgeving dan de klassieke 2D culturen. Onlangs, 3D co cultuur modellen zijn ontwikkeld om te bestuderen van tumor angiogenese, die de heterogeniteit en de complexiteit van de angiogenese in de tumor communicatie25nabootst. In dit model worden endotheliale cellen gekweekt rechtstreeks met de kankercellen, alsook een stromale component in een 3D omgeving. Daarnaast is 3D in vitro cultuur systemen gebleken om na te denken hoe nauwkeuriger de reactie in vivo op therapeutische agenten dan conventionele cel cultuur systemen. Bovendien, wordt deze methode gebruikt voor de differentiatie van embryonale stamcellen, weefsel groei, wondgenezing, ischemie en ontsteking. In vergelijking met de klassieke methode, is onze aanpak effectief en eenvoudig te implementeren. Wij geloven het is een nuttig instrument voor de studie van de angiogenese in vitro, en een nieuwe manier om te begrijpen van dit proces beter wordt geopend.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Dit werk werd gesteund door subsidies van de Shanghai Comité van wetenschap en technologie (15411951800, 15410723200). De auteurs bedank Prof. YuMei Wen en Prof. Chao Zhao van de pathogene micro-organismen departement van Fudan Universiteit voor hun technische bijstand.

Materials

Name Company Catalog Number Comments
human umbilical vein endothelial cell Fudan IBS Cell Center FDCC-HXN180
dulbecco’s modified eagle’s medium  Gibco 11995040
fetal bovine serum Gibco  26400044
PLKO.1-puro vector Addgene #8453
packing plasmid psPAX2  Addgene #12260
envelope plasmid pMD2.G Addgene #12259
3D round-bottom 96-well plates S-Bio MS-9096M
matrigel BD Biosciences 354234
Opti-MEM medium Gibco 31985-070 reduced serum medium 
15-well plate Ibidi 81501 Air bubbles in the gel can be reduced by equilibrating the μ–Slide angiogenesis before usage inside the incubator overnight
endothelial cell growth supplements Sciencell #1052
10-cm culture dish Corning Scipu000813
Puromycin Gibco A1113802
typsin-EDTA Gibco 25200056
Automated Cell Counter System   BioTech
Image Analysis software  Winmasis http://mywim.wimasis.com 

DOWNLOAD MATERIALS LIST

References

  1. Lonser, R. R., et al. von Hippel-Lindau disease. Lancet. 361, (9374), 2059-2067 (2003).
  2. Hussein, M. R. Central nervous system capillary haemangioblastoma: the pathologist's viewpoint. Int J Exp Pathol. 88, (5), 311-324 (2007).
  3. Ma, D., et al. Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche. Carcinogenesis. 32, (1), 102-109 (2011).
  4. Zhuang, Z., et al. Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors. Sci Rep. 4, 4102 (2014).
  5. Glasker, S., et al. VHL-deficient vasculogenesis in hemangioblastoma. Exp Mol Pathol. 96, (2), 162-167 (2014).
  6. Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas. Cancer Res. 55, (6), 1358-1364 (1995).
  7. Cancilla, P. A., Zimmerman, H. M. The fine structure of a cerebellar hemangioblastoma. J Neuropathol Exp Neurol. 24, (4), 621-628 (1965).
  8. Kawamura, J., Garcia, J. H., Kamijyo, Y. Cerebellar hemangioblastoma: histogenesis of stroma cells. Cancer. 31, (6), 1528-1540 (1973).
  9. Jurco, S., et al. Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry. Hum Pathol. 13, (1), 13-18 (1982).
  10. Ma, D., et al. Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas. Cancer Biol Ther. 12, (8), 727-736 (2011).
  11. Ma, D., et al. CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma. Tumour Biol. 37, (3), 3765-3774 (2016).
  12. Sharifpanah, F., Sauer, H. Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis. Methods Mol Biol. 1430, 179-189 (2016).
  13. Cai, H., et al. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma. Oncogene. 36, (3), 318-331 (2017).
  14. Xu, J., et al. Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP. Appl Biochem Biotechnol. 181, (2), 699-709 (2017).
  15. Laib, A. M., et al. Spheroid-based human endothelial cell microvessel formation in vivo. Nat Protoc. 4, (8), 1202-1215 (2009).
  16. D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. Angiogenesis and Vasculogenesis in Health and Disease. Biomed Res Int. 2015, 126582 (2015).
  17. Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model. Cell Prolif. 42, (4), 498-505 (2009).
  18. Morin, K. T., Tranquillo, R. T. In vitro models of angiogenesis and vasculogenesis in fibrin gel. Exp Cell Res. 319, (16), 2409-2417 (2013).
  19. Blacher, S., et al. Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour. PLoS One. 9, (5), 97019 (2014).
  20. Straume, O., et al. Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer. Proc Natl Acad Sci U S A. 109, (22), 8699-8704 (2012).
  21. Naumov, G. N., Akslen, L. A., Folkman, J. Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch. Cell Cycle. 5, (16), 1779-1787 (2006).
  22. Naumov, G. N., Folkman, J., Straume, O. Tumor dormancy due to failure of angiogenesis: role of the microenvironment. Clin Exp Metastasis. 26, (1), 51-60 (2009).
  23. Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice. Mol Carcinog. 56, (10), 2342-2351 (2017).
  24. Stratmann, R., Krieg, M., Haas, R., Plate, K. H. Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene. J Neuropathol Exp Neurol. 56, (11), 1242-1252 (1997).
  25. Correa de Sampaio, P., et al. A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis. PLoS One. 7, (2), 30753 (2012).
Een uitgebreide Procedure voor de evaluatie van de prestaties <em>In Vitro</em> van de vermeende Hemangioblastoma Neovascularization met behulp van de kiemen Assay sferoïde
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).More

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter