Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Cancer Research

Une procédure complète d’évaluer la Performance In Vitro de la néovascularisation Hémangioblastome putatif à l’aide de l’ellipsoïde test de germination

doi: 10.3791/57183 Published: April 12, 2018

Summary

Cet article présente une procédure complète pour évaluer in vitro si angiogenèse tumorale classique existe dans les hémangioblastomes (HBs) et son rôle dans HBs. Les résultats soulignent la complexité de la néovascularisation-HB et suggèrent que cette forme courante d’angiogenèse est seulement un mécanisme complémentaire dans la néovascularisation-HB.

Abstract

L’inactivation du gène suppresseur tumeur von Hippel-Lindau (VHL) joue un rôle crucial dans le développement des hémangioblastomes (HBs) dans le système nerveux central (CNS) humain. Toutefois, tant l’origine cytologique et le processus évolutif d’HBs (y compris la néovascularisation) demeurent controversées, et anti-angiogènes pour VHL-HBs, basés sur le classique HB angiogenèse, donnent des résultats décevants dans les essais cliniques. Un obstacle majeur à la traduction clinique réussie du traitement anti-vasculaire est l’absence d’une compréhension approfondie de la néovascularisation dans cette tumeur vasculaire. Dans cet article, nous présentons une procédure complète pour évaluer in vitro si angiogenèse tumorale classique existe en HBs, ainsi que son rôle dans HBs. Avec cette procédure, les chercheurs peuvent précisément comprendre la complexité de la néovascularisation HB et identifier la fonction de cette forme courante de l’angiogenèse dans HBs. Ces protocoles peuvent être utilisés pour évaluer la thérapie anti-vasculaire plus prometteur pour les tumeurs, qui a fort potentiel translationnel pour traitement de tumeurs, ou pour aider dans l’optimisation du traitement anti-angiogénique de HBs à l’avenir les traductions. Les résultats soulignent la complexité de la néovascularisation HB et suggèrent que cette angiogenèse forme commune est uniquement un mécanisme complémentaire dans la néovascularisation HB.

Introduction

Hémangioblastomes (HBs) sont des tumeurs vasculaires bénignes que l'on trouve exclusivement dans le système nerveux central (CNS) humain. Ils se développent dans les patients avec la maladie de von Hippel-Lindau (VHL) ou lésions sporadiques. VHL-HBs sont difficiles à guérir grâce à un traitement chirurgical en raison de la récurrence fréquente et lésions multiples qui résultent de cette génétique trouble1. L’inactivation de la gène suppresseur de tumeur VHL a été considéré comme la cause première de la tumorigenèse de VHL-HBs, l’origine cytologique (y compris la néovascularisation) et le processus évolutif d’HBs restent largement controversée2. Par conséquent, une meilleure compréhension des mécanismes biologiques HB-néovasculaire peut fournir des indications utiles sur les stratégies anti-vasculaires les plus prometteuses pour VHL-HBs.

Une recherche récente a suggéré que HB-néovascularisation est semblable à la vasculogénèse embryologique3,4,5. Facteur de croissance de l’endothélium vasculaire (VEGF) classique-médiation angiogenèse issus de l’endothélium vasculaire et qui est entraînée par la perte de fonction VHL a entraîné la prolifération et néovasculaire formation, qui a été mis au défi6. En 1965, Cancilla et Zimmerman constaté, au microscope électronique, HBs provenant de l' endothélium7. Plus tard, il a été constaté que les cellules du stroma sont issues de vasoformative élément8. En 1982, Jurco et coll. ont découvert que les cellules du stroma sont d’origine endothéliale9. Donc, nous avons émis l’hypothèse que les cellules endothéliales vasculaires humaines sont les cellules d’origine de la néovascularisation-HB10. Bien qu’il soit préférable d’utiliser les cultures primaires de HB cellules dérivées des chirurgies patients VHL, nos recherches antérieures ont indiqué que les cultures primaires de HB ne sont pas stables, et des lignées cellulaires n’a pas peuvent être établie3. En outre, les cultures primaires dans l’environnement 3D ne pouvaient pas identifier l’origine cytologique de HB-la néovascularisation parce qu’elles incluent les progéniteurs des HB-vasculaire ingrédients10,11. Par conséquent, dans un modèle classique et primitif des cellules endothéliales, les cellules endothéliales vasculaires humaines (HUVEC) pourraient servir d’un autre modèle cellulaire pour HBs.

Le test de germination sphéroïde est un nouveau modèle en tissu technique12,13. Dans cet article, une 3D à base de collagène coculture système in vitro à l’aide de l’ellipsoïde test de germination a été développé, avec un objectif général est d’évaluer si l’angiogenèse tumorale classique existe en HBs, ainsi que son rôle dans HBs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Cette méthode a été réalisée conformément aux lignes directrices approuvées et réglementation de la recherche éthique Comité de l’hôpital Huashan, Université Fudan. Les mesures de sécurité standard correspondantes ont été suivis à chaque étape. Pour une présentation schématique, veuillez vous reporter à la Figure 1.

1. cellules de Culture et la construction plasmidique

  1. Maintenir régulièrement les cellules endothéliales de veine ombilicale humaine (HUVEC) dans Dulbecco de l’aigle modifié (DMEM) additionné de 10 % sérum fœtal (SVF), 100 unités/mL de pénicilline et 100 µg/mL de streptomycine dans un humidifié 5 % CO2 incubateur à 37 ° C.
  2. PLKO.1 Digest plasmide avec ApaI et EcoRI pour la synthèse de shARN fragment. Assurez-vous que la séquence du vecteur de shARN VHL est CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14.
  3. Ensuite, mélanger 20 système µΜ avant 5 µl d’oligo, 5 µL d’oligo reverse, 5 µL de NEB mémoire tampon 10 x et 35 µL de ddH2O ensemble (le volume total est de 50 µL). Chauffer le mélange à 98 ° C pendant 4 min, lentement et laissez refroidir à la température de la pièce en quelques heures.
  4. Ligaturer les oligos recuit et le plasmide PLKO.1 ainsi que de la ligase T4 à 4 ° C pour la nuit. 16 h plus tard, ajouter 5 µL du mélange de ligation dans 25 µL DH5α les cellules compétentes. Ensuite, les plasmides ligaturés avec succès de l’écran et vérifiez le fragment inséré par séquençage.

2. infection et paquet de lentivirus

  1. Au total, mélanger 10 µg du vecteur PLKO.1-shVHL ou PLKO.1-shScramble, 7,5 µg d’emballage plasmide psPAX2 et 2,5 µg d’enveloppe plasmide pMD2.G dans 500 µL des médias DMEM sans sérum fœtal (SVF) pendant 25 min.
  2. Ajouter 7 mLDMEM sans FBS à la solution préparée précédemment.
  3. Culture de 293 cellules FT le DMEM sans FBS dans un plats de culture de tissus de 10 cm de diamètre. S’assurer que le nombre de cellules 293FT 1 x 107 à l’aide d’un compteur de cellules.
  4. Ajouter 1 mL de la solution préparée ci-dessus au milieu des cellules 293FT pour la transfection.
    Remarque : La lignée de cellules 293FT est dérivé de la lignée cellulaire 293F et stablement expriment l’antigène T grand SV40. Par conséquent, il est un hôte convenable pour la production des gènes.
  5. Remplacer le milieu de culture avec le DMEM contenant 10 % FBS après 6 h.
  6. Recueillir les médias à l’aide d’une pipette à 48 h après la transfection.
    Remarque : Le virus existe dans le DMEM contenant 10 % FBS. Les cellules mortes flottent sur le milieu. Membrane stérile de 0,45 µm permet de filtrer les cellules mortes et les impuretés. En règle générale, il n’y a pas besoin de vérifier la multiplicité d’infection (MOI). Il s’agit d’établir une ligne de cellules stables. Lors de la dernière étape, toutes les cellules vivantes sans infection réussie vont mourir par la puromycine. Le groupe shScramble et cellules HUVEC constituent le groupe de contrôle. Veiller à ce que toutes les cellules HUVEC mourir avec la concentration de puromycine utilisé après 72 h. Chaque cupule a le même nombre de cellules.
  7. La culture des cellules HUVEC dans les médias des gènes pendant 72 h. Puis, ajoutez la puromycine aux médias des cellules HUVEC à une concentration de 2 µg/mL pour les cellules HUVEC utilisation 24 h sans aucun traitement dans le groupe témoin. Veiller à ce que tous les commande cellules meurent à ce moment-là.
    Remarque : Les cellules vivantes représentent une lignée cellulaire stable VHL cellules démontable et shSramble. La densité de placage est 5 000/puits dans les plaques à 96 puits.

3. génération des sphéroïdes de cellules endothéliales

  1. Trypsinize les cellules HUVEC et remettre en suspension dans le milieu DMEM avec 10 % FBS. Avec un nombre modéré de cellules dans une boîte de Petri de 10 cm, ajouter 1 mL d’EDTA-typsin.
  2. Les cellules dans une plaque à 96 puits fond rond 3D, à une densité cellulaire de 1 × 103 cellules/puits de graines. Utiliser un puits pouvant accueillir un sphéroïde de 0,50 µL à suspendre l’ellipsoïde. Compter les cellules à l’aide d’un système de compteur de cellules suivant les instructions du fabricant.
  3. Incuber les cellules à 37 ° C et 5 % de CO2 en continu pendant 72 h. Dans ces conditions, faire en sorte que les cellules en suspension forment les sphéroïdes cellule automatiquement. Remplacer la moitié du milieu de culture après 36 h.

4. test in vitro de l’angiogenèse

  1. Décongeler la solution de gel à 4 ° C et le diluer avec le milieu de sérum réduit à un taux de dilution de 1:5.
  2. Sucer les sphéroïdes DMEM milieu de culture avec une micropipette. Après avoir lavé les sphéroïdes avec 5 mL de milieu sérum réduit, suspendre les sphéroïdes doucement et prudemment dans le gel dilué. S’assurer qu’il n’y a pas de bulles d’air.
  3. Incorporez 300 µL de liquide mélangé dans un plat de 15 puits. Après incubation à 37 ° C et 5 % de CO2 pendant 1 h, ajouter 400 µL de milieu sérum réduit dans chaque puits. Remplir d’eau stérile autour des puits pour générer un environnement humidifié pour empêcher l’évaporation.
  4. Par la suite, la culture la plaque à 37 ° C à 5 % de CO2 à 100 % d’humidité pendant 1 h.
  5. Aspirer le vieux support avec précaution et remplacez-le par 600 µL de milieu de sérum réduit avec des suppléments de croissance des cellules endothéliales de le 1 % dans chaque puits.
  6. Après 12 h ou 24h, prendre des photos sous un microscope inversé de lumière (40 *).

5. analyse

  1. Télécharger les images sur une plateforme d’analyse en ligne d’image pour obtenir des données de longueur sprout (Table des matières).
  2. Sur la page Web, créez un compte par email.
  3. Puis télécharger les images en cliquant sur le bouton transférer.
  4. Télécharger le résultat en cliquant sur le bouton Télécharger.
    Remarque : Le logiciel va générer l’image traitée et les données. Les données contiennent cinq parties : cumulatif germination, pousse moyenne longueur, l’écart de la longueur de la pousse, pousse et sphéroïde. Dans l’image traitée, chaque paramètre est décrit dans une couleur différente pour faciliter l’identification de l’image traitée : rouge représente les choux de squelette, jaune le nombre de germes, bleu la structure sprout, sprout blanc fin et orange sphéroïde.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Images originales sont prises par microscopie inversée. Les images typiques du groupe témoin et du groupe VHL sont indiquées à la Figure 2-A1 et Figure 2-A2. La durée de germination du groupe témoin est plus courte que celle du groupe VHL.

Après avoir téléchargé les Images, la plateforme en ligne fournit des résultats d’analyse directement. La sortie se compose de deux parties : les images traitées et les résultats de l’analyse correspondante. Les images traitées du groupe témoin et le groupe de silence du gène VHL sont marqués par des couleurs différentes (Figure 2-A3 et Figure 2-A4). La longueur moyenne de germination est de 65 µm et 125 µm dans le groupe témoin et le groupe de silence VHL, respectivement, et la longueur moyenne cumulative sprout est 680 µm et 1250 µm dans le groupe témoin et le groupe de silence VHL, respectivement, indiquant qui poussent la longueur augmente de environ deux plis dans le groupe de silence VHL, comparée au groupe contrôle (Figure 2B). Ces résultats indiquent que la carence en VHL favorise la capacité du navire formant des cellules endothéliales humaines.

Figure 1
Figure 1 . Le schéma de l’ellipsoïde test de germination. Étapes 1 montre les cellules HUVEC cultivées un plat. En 2 étapes, cellules HUVEC sont déplacés vers 3D fond rond plaques à 96 puits pendant 72 h. étapes 3 montre la forme de cellules HUVEC sphéroïdes de cellules endothéliales automatiquement dans la plaque de la 3D. En 4 étapes, ajouter sphéroïde de cellule au gel dilué. En 5 étapes, ajouter le mélange préparé au-dessus d’une plaque de 15 puits. Étapes 6 montre sphéroïde de germination dans la plaque de 15 puits. Étapes 7 montrent l’image sprouting prise sous un microscope inversé de lumière. Échelons 8 montre l’image téléchargée et étape 9 est l’image de la sortie de la plate-forme (bar = 100 µm). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 . L’effet de VHL silençage génique sur la capacité angiogénique des cellules HUVEC dans l’ellipsoïde test de germination. (A) des images représentatives de l’excroissance du bec après 12 h dans le contrôle (A1) et sphéroïdes HUVEC VHL-taire (A2) (bar = 100 µm). Figures A3 et A4 montrent les images analysées par la plate-forme pour les Figures A1 et A2, respectivement. Squelette de choux rouge représente, jaune le nombre de germes, bleu la structure sprout, sprout blanc fin et orange sphéroïde. ()B) longueur des germes. L’analyse statistique a été réalisée en utilisant le test t de Student non appariés. * représentent P < 0,05. CON, contrôle ; HUVEC, cellules endothéliales de veine ombilicale humaine. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Récemment, plusieurs champs de recherche en biologie vasculaire ont été stimulées par l’étude de l' endothélium d’angiogénique15. Dans cet article, nous avons développé un sphéroïde endothélial germination technique comme modèle expérimental pour étudier la formation de vaisseaux qui provient de la perte du gène VHL de fonction dans les cellules endothéliales manipulés pour identifier les molécules de nouveaux candidats de la cascade d’angiogénique. Au meilleur de notre connaissance, c’est le premier rapport d’examiner les effets angiogénique des cellules endothéliales mis à jour l’endogènes.

La néovascularisation de tissu (y compris les tissus tumoraux) est un processus complexe qui se produit par l’intermédiaire des mécanismes angiogéniques et vasculogenic au cours du développement, ainsi que dans les conditions physiologiques et pathologiques12,15 , 16. l’ellipsoïde test de germination se caractérise par une cascade complexe d’événements17,18, y compris l’auto-agrégation des cellules endothéliales qui sont incorporés dans un système de culture cellulaire 3D matrix, qui se traduit par la germination et la reproduction du réseau de capillaires193D. Ce modèle 3D gel incorporé sphéroïde est devenu un système largement utilisé en ingénierie tissulaire pour étudier la formation vasculaire et ses mécanismes en raison de sa capacité à fournir un environnement mieux imitant dans une matrice appropriée. Cependant, la plus importante étape de ce processus biologique est l’activation des cellules endothéliales quiescentes17,20,21,22. Dans cette procédure, les cellules endothéliales ont été activés par le silence endogène du gène VHL, un gène régulateur de la croissance des néovaisseaux23,24. Différente de l’endothélium classique initiation via l’induction exogène de la matrice et l’environnement extracellulaire correspondante (facteurs de croissance vasculaires exogènes y compris), cette méthode modifiée peut être étendue à de nombreux applications pour élucider les mécanismes génétiques endogènes. Ensuite, pour diminuer les effets de la matrice exogène, le protocole a été optimisé en diluant le gel, qui a été une simple étape dans l’expérience. En outre, il a fallu quelques minutes pour télécharger des images vers la plate-forme et d’obtenir des résultats d’analyse. La plate-forme fournit un service d’analyse images qui permet à l’expérimentateur de faire un objectif, l’analyse d’image comparable et automatisé de germination des images de test en ligne. Par conséquent, le protocole surmonte la mesure et le calcul des erreurs causées par des facteurs anthropiques.

L’interprétation mécaniste des différentes étapes de la cascade de néovascularisation a fourni une base rationnelle pour le développement du traitement anti-vasculaire qui est actuellement approuvé pour une application clinique en oncologie. Ce document établi un modèle de test simple et robuste sphéroïde pour étudier la formation de vaisseaux qui provenance des cellules endothéliales manipulés avec perte de la fonction du gène VHL afin d’identifier des molécules de nouveaux candidats pour la néovascularisation cascade, qui peut être utilisé pour de nombreuses applications liées à l’angiogenèse et vasculogénèse. Les auteurs spéculent que ce modèle in vitro peut-être fournir des informations supplémentaires pour aider à évaluer le rôle de l’angiogenèse dans certaines tumeurs solides (p. ex., mimétisme de tumeur vasculogenic) et enquêter sur le rôle potentiel des autres cellules progénitrices possible pour générer des néovaisseaux tumorale in vivo, particulièrement chez les patients atteints de tumeurs qui, collectivement, ne répondent pas au traitement par des agents anti-angiogéniques seulement.

Le test de germination sphéroïde est devenu une méthode largement utilisée pour étudier l’angiogenèse et mécanismes connexes. Le test a un avantage important en fournissant un meilleur environnement mimique que les cultures 2D classiques. Récemment, les modèles de co-culture 3D ont été développés pour étudier l’angiogenèse tumorale qui imite l’hétérogénéité et la complexité de l’angiogenèse dans le microenvironnement de tumeur25. Dans ce modèle, les cellules endothéliales sont cultivées directement avec les cellules cancéreuses, mais aussi un volet stromal dans un environnement 3D. En outre, 3D en vitro systèmes de culture montrent mieux refléter la réponse in vivo à des agents thérapeutiques que les systèmes de cultures cellulaires classiques. En outre, cette méthode est utilisée pour la différenciation des cellules souches embryonnaires, la croissance des tissus, la cicatrisation des plaies, ischémie et l’inflammation. Comparée à la méthode classique, notre approche est efficace et facile à mettre en œuvre. Nous pensons que c’est un outil utile pour l’étude de l’angiogenèse in vitro, puis ouvre une nouvelle façon de comprendre ce processus mieux.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Ce travail a été soutenu par des subventions de la Commission des sciences de Shanghai et de la technologie (15411951800, 15410723200). Les auteurs tiennent à remercier Prof. YuMei Wen et Prof. Chao Zhao de l’Université de département de microorganisme pathogène de Fudan pour leur assistance technique.

Materials

Name Company Catalog Number Comments
human umbilical vein endothelial cell Fudan IBS Cell Center FDCC-HXN180
dulbecco’s modified eagle’s medium  Gibco 11995040
fetal bovine serum Gibco  26400044
PLKO.1-puro vector Addgene #8453
packing plasmid psPAX2  Addgene #12260
envelope plasmid pMD2.G Addgene #12259
3D round-bottom 96-well plates S-Bio MS-9096M
matrigel BD Biosciences 354234
Opti-MEM medium Gibco 31985-070 reduced serum medium 
15-well plate Ibidi 81501 Air bubbles in the gel can be reduced by equilibrating the μ–Slide angiogenesis before usage inside the incubator overnight
endothelial cell growth supplements Sciencell #1052
10-cm culture dish Corning Scipu000813
Puromycin Gibco A1113802
typsin-EDTA Gibco 25200056
Automated Cell Counter System   BioTech
Image Analysis software  Winmasis http://mywim.wimasis.com 

DOWNLOAD MATERIALS LIST

References

  1. Lonser, R. R., et al. von Hippel-Lindau disease. Lancet. 361, (9374), 2059-2067 (2003).
  2. Hussein, M. R. Central nervous system capillary haemangioblastoma: the pathologist's viewpoint. Int J Exp Pathol. 88, (5), 311-324 (2007).
  3. Ma, D., et al. Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche. Carcinogenesis. 32, (1), 102-109 (2011).
  4. Zhuang, Z., et al. Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors. Sci Rep. 4, 4102 (2014).
  5. Glasker, S., et al. VHL-deficient vasculogenesis in hemangioblastoma. Exp Mol Pathol. 96, (2), 162-167 (2014).
  6. Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas. Cancer Res. 55, (6), 1358-1364 (1995).
  7. Cancilla, P. A., Zimmerman, H. M. The fine structure of a cerebellar hemangioblastoma. J Neuropathol Exp Neurol. 24, (4), 621-628 (1965).
  8. Kawamura, J., Garcia, J. H., Kamijyo, Y. Cerebellar hemangioblastoma: histogenesis of stroma cells. Cancer. 31, (6), 1528-1540 (1973).
  9. Jurco, S., et al. Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry. Hum Pathol. 13, (1), 13-18 (1982).
  10. Ma, D., et al. Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas. Cancer Biol Ther. 12, (8), 727-736 (2011).
  11. Ma, D., et al. CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma. Tumour Biol. 37, (3), 3765-3774 (2016).
  12. Sharifpanah, F., Sauer, H. Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis. Methods Mol Biol. 1430, 179-189 (2016).
  13. Cai, H., et al. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma. Oncogene. 36, (3), 318-331 (2017).
  14. Xu, J., et al. Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP. Appl Biochem Biotechnol. 181, (2), 699-709 (2017).
  15. Laib, A. M., et al. Spheroid-based human endothelial cell microvessel formation in vivo. Nat Protoc. 4, (8), 1202-1215 (2009).
  16. D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. Angiogenesis and Vasculogenesis in Health and Disease. Biomed Res Int. 2015, 126582 (2015).
  17. Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model. Cell Prolif. 42, (4), 498-505 (2009).
  18. Morin, K. T., Tranquillo, R. T. In vitro models of angiogenesis and vasculogenesis in fibrin gel. Exp Cell Res. 319, (16), 2409-2417 (2013).
  19. Blacher, S., et al. Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour. PLoS One. 9, (5), 97019 (2014).
  20. Straume, O., et al. Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer. Proc Natl Acad Sci U S A. 109, (22), 8699-8704 (2012).
  21. Naumov, G. N., Akslen, L. A., Folkman, J. Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch. Cell Cycle. 5, (16), 1779-1787 (2006).
  22. Naumov, G. N., Folkman, J., Straume, O. Tumor dormancy due to failure of angiogenesis: role of the microenvironment. Clin Exp Metastasis. 26, (1), 51-60 (2009).
  23. Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice. Mol Carcinog. 56, (10), 2342-2351 (2017).
  24. Stratmann, R., Krieg, M., Haas, R., Plate, K. H. Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene. J Neuropathol Exp Neurol. 56, (11), 1242-1252 (1997).
  25. Correa de Sampaio, P., et al. A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis. PLoS One. 7, (2), 30753 (2012).
Une procédure complète d’évaluer la Performance <em>In Vitro</em> de la néovascularisation Hémangioblastome putatif à l’aide de l’ellipsoïde test de germination
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).More

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter