Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Cancer Research

נוהל מקיף כדי להעריך את ביצועי במבחנה כורוידאלית Hemangioblastoma בשם משתמש את ספרואיד הלבלוב Assay

doi: 10.3791/57183 Published: April 12, 2018

Summary

מאמר זה מציג נוהל מקיף כדי להעריך במבחנה אם אנגיוגנזה קלאסי קיימת ב- hemangioblastomas (HBs) ותפקידו HBs. התוצאות להאיר את המורכבות של HB-כורוידאלית, מציע כי זו הצורה השכיחה של אנגיוגנזה הוא רק מנגנון משלים ב- HB-כורוידאלית.

Abstract

איון של הגן מדכא הגידול פון היפל-Lindau. אייצ ' (.-אל) ממלא תפקיד מכריע בהתפתחות של hemangioblastomas (HBs) בתוך מערכת העצבים המרכזית אנושי (CNS). עם זאת, התהליך האבולוציוני של HBs (כולל כורוידאלית) והן המקור cytological נותרו שנויים במחלוקת, אנגיוגנזה עבור אייצ '-אל-HBs, בהתבסס על קלאסי על בסיס חצי פנסיון אנגיוגנזה, יצרו תוצאות מאכזבות בניסויים קליניים. מכשול רציני תרגום קליני מוצלח של טיפול אנטי-כלי הדם היא חוסר הבנה מעמיקה של כורוידאלית זה הגידול בכלי הדם. במאמר זה, נציג נוהל מקיף כדי להעריך במבחנה אם אנגיוגנזה קלאסי קיימת ב- HBs, וכן את תפקידו ב- HBs. באמצעות הליך זה, חוקרים יכולים במדויק להבין את המורכבות של כורוידאלית על בסיס חצי פנסיון ולזהות את הפונקציה של זו הצורה השכיחה של אנגיוגנזה HBs. פרוטוקולים אלה ניתן להשתמש כדי להעריך את הטיפול האנטי-וסקולרית המבטיחים ביותר עבור גידולים, אשר יש פוטנציאל גבוה translational לטיפול גידולים או לסיוע באופטימיזציה של הטיפול האנגיוגנזה anti HBs בעתיד תרגומים. התוצאות להאיר את המורכבות של כורוידאלית על בסיס חצי פנסיון, מציע כי אנגיוגנזה טופס הנפוץ הזה הוא רק מנגנון משלים בכורוידאלית על בסיס חצי פנסיון.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hemangioblastomas (HBs) הם גידולים שפירים כלי הדם אשר נמצאים אך ורק בתוך האדם מערכת העצבים המרכזית (CNS). הם מפתחים אצל חולים עם מחלת פון היפל-לינדאו (אייצ '-אל) או נגעים סדיר. אייצ '-אל-HBs קשה לרפא באמצעות טיפול כירורגי עקב הישנות תכופים, נגעים מרובים לנבוע זה גנטי ההפרעה1. למרות איון של הגן מדכא הגידול אייצ '-אל נחשב שורש tumorigenesis של אייצ '-אל-HBs, המקור cytological (כולל כורוידאלית) ואת התהליך האבולוציוני של HBs נותרו במחלוקת במידה רבה2. לכן, הבנה טובה יותר של המנגנונים הביולוגיים HB-neovascular עשוי לספק תובנות שימושיות האסטרטגיות אנטי-וסקולרית המבטיחים ביותר אייצ '-אל-HBs.

מחקרים אחרונים הראו כי על בסיס חצי פנסיון-כורוידאלית דומה4,3,embryologic vasculogenesis5. קלאסי כלי הדם צמיחה אנדותל (VEGF)-אנגיוגנזה בתיווך כי מקורם אנדותל כלי הדם, אשר מונעת על ידי אייצ '-אל אובדן התפקוד, גרמו התפשטות והזמנו neovascular היווצרות, אשר כבר6. בשנת 1965, Cancilla וצימרמן מצא, באמצעות מיקרוסקופ אלקטרונים, כי HBs מקורם אנדותל7. מאוחר יותר התברר כי תאי סטרומה נגזרים מתוך רכיב vasoformative8. בשנת 1982, Jurco. et al. נמצא כי תאי סטרומה הם מקור אנדותל9. לכן, שיערנו כי תאי אנדותל כלי הדם אדם הם התאים המקוריים של HB-כורוידאלית10. אמנם עדיף להשתמש התרבויות העיקרי מתאי HB נגזר אייצ '-אל המטופל ניתוחים, מחקרים קודמים שלנו ציינו כי תרבויות העיקרי של HB אינם יציבים, שורות תאים לא יכול להיות הוקמה3. יתר על כן, תרבויות ראשי בסביבת 3D לא יוכל לזהות המקור cytological של HB-כורוידאלית כי הם כוללים המוצא לאגס התרבותי מרכיבים על בסיס חצי פנסיון-וסקולרית10,11. לכן, כמודל פרימיטיביים וקלאסי של תאי אנדותל, תאי אנדותל כלי הדם (HUVEC) אדם יכול לשמש מודל הסלולר אלטרנטיבי HBs.

וזמינותו נבטי ספרואיד הוא מודל חדש12,הנדסת רקמות,13. בנייר זה, יישום תלת-ממד coculture מבוססי קולגן מערכת במבחנה באמצעות ספרואיד את לבלוב assay פותחה, עם מטרה הכוללת כדי להעריך אם אנגיוגנזה קלאסי קיימת ב- HBs, וכן את תפקידו ב- HBs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

שיטה זו בוצעה בהתאם הנחיות שאושרו והתקנות של מחקר אתיקה הוועדה של Huashan חולים, אוניברסיטת פודאן (fudan). אמצעי בטיחות סטנדרטית המתאימה עקבו כל צעד. עבור מצגת סכמטית, נא עיין באיור 1.

1. תא תרבות ובבניית פלסמיד

  1. באופן שגרתי לשמור על התא אנדותל יפתור (HUVEC) ב Dulbecco המתואמת של בינוני הנשר (DMEM) בתוספת 10% סרום שור עוברית (FBS), יחידה/mL 100 של פניצילין, µg/mL 100 של סטרפטומיצין % 5 humidified CO2 מגשים ב 37 º C.
  2. תקציר PLKO.1 פלסמיד עם ApaI, EcoRI לסינתזה של פרגמנט shRNA. ודא כי הרצף oligonucleotide של וקטור shRNA אייצ '-אל CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14.
  3. לאחר מכן, מערבבים 20 מערכת µΜ עם µL 5 קדימה oligo, 5 µL של oligo הפוכה, 5 µL של 10 x מאגר נב ו 35 µL של ddH2O יחד (לנפח הכללי הוא 50 µL). מחממים את התערובת ב 98 ° C 4 דקות, לאט מגניב עד לטמפרטורת החדר בעוד כמה שעות.
  4. מאתרים ומפסיקים את annealed oligos ואת פלסמיד PLKO.1 יחד עם T4 ליגאז ב 4 ° C נלון. 16 h מאוחר יותר, הוסף 5 µL של מצדו מיקס 25 µL תאים DH5α המוסמכת. לאחר מכן, מסך של פלסמידים מחוברים בהצלחה ולאחר לאמת השבר שנוסף על-ידי רצף.

2. lentivirus החבילה ואת זיהום

  1. בסך הכל, מערבבים µg 10 של וקטור PLKO.1-shVHL או PLKO.1-shScramble, µg 7.5 של אריזת פלסמיד psPAX2 ו- 2.5 µg של המעטפה pMD2.G פלסמיד ב 500 µL של התקשורת DMEM ללא סרום שור עוברית (FBS) במשך 25 דקות.
  2. להוסיף mLDMEM 7 ללא FBS הפתרון המוכן מעל.
  3. התרבות התאים מטרים 293 DMEM ללא FBS במנות תרביות רקמה 10 ס מ קוטר. ודא מספר התאים מטרים 293 1 x 107 באמצעות מונה התא.
  4. להוסיף 1 מ"ל של הפתרון המוכן מעל למדיום של תאים מטרים 293 על תרביות תאים.
    הערה: שורת התאים מטרים 293 נגזר מן הקו תא 293F ולבטא stably גדול SV40 T אנטיגן. לכן, זה פונדקאי מתאים לייצור lentiviral.
  5. להחליף את המדיום התרבות DMEM המכיל 10% FBS לאחר 6 שעות.
  6. לאסוף את המדיה באמצעות פיפטה ב- 48 שעות לאחר תרביות תאים.
    הערה: הוירוס קיים DMEM המכיל 10% FBS. התאים המתים לצוף על בינוני. להשתמש ממברנה סטרילי מיקרומטר 0.45 לסינון של תאים מתים וזוהמה. באופן כללי, יש צורך לבדוק את הריבוי של זיהום (MOI). זה כדי לייסד. תאים יציב. בשלב האחרון, כל התאים החיים ללא זיהום מוצלחת תמות עד puromycin. ShScramble קבוצה של תאים HUVEC הם קבוצת הביקורת. ודא כי כל התאים HUVEC למות עם ריכוז puromycin בשימוש על ידי 72 h. כל טוב יש את אותו מספר של תאים.
  7. התרבות התאים HUVEC בתקשורת lentiviral עבור 72 h. לאחר מכן, להוסיף puromycin התקשורת של תאי HUVEC-ריכוז של µg/mL 2 עבור ה 24 תאים לשימוש HUVEC ללא כל טיפול כחלק מקבוצת הביקורת. ודא כי כל לשלוט תאים מתים בזמן הזה.
    הערה: התאים החיים מייצגים קו תא יציב של תאים תמונות ציפורים אייצ '-אל ותאים shSramble. צפיפות ציפוי היא 5000/טוב ב 96-ובכן צלחות.

3. הדור של תאי אנדותל Spheroids

  1. Trypsinize תאי HUVECs, resuspend בטווח הבינוני DMEM עם 10% FBS. עם מספר תאים לצלחת תרבות 10-ס מ, להוסיף 1 מ"ל של typsin-EDTA.
  2. זרע התאים בצלחת 96-ובכן למטה סיבוב תלת-ממד, ב צפיפות התאים של 1 × 103 תאים/טוב. השתמש גם להכיל ספרואיד של µL 0.50 להשעות את ספרואיד. ספירת תאים באמצעות מערכת מונה תא ההוראות של היצרן.
  3. דגירה התאים ב 37 ° C ו- 5% CO2 ברציפות במשך 72 h. בתנאים אלה, ודא כי התאים מושעה טופס על spheroids תא באופן אוטומטי. להחליף חצי של המדיום תרבות לאחר 36 שעות.

4. במבחנה Assay אנגיוגנזה

  1. להפשיר את הפתרון ג'ל ב 4 ° C, לדלל את זה עם המדיום סרום מופחת ביחס דילול של 1:5.
  2. למצוץ את spheroids של המדיום התרבות DMEM עם micropipette. לאחר הרחצה spheroids עם 5 מ של מדיום מופחת סרום, להשעות את spheroids בעדינות ובזהירות הג'ל מדולל. ודא כי ישנם אין בועות אוויר.
  3. הטבע µL 300 של נוזל מעורב לתוך צלחת 15-. טוב. לאחר דגירה-37 ° C ו- 5% CO2 עבור 1 h, להוסיף 400 µL מדיום מופחת סרום מכל קידוח. למלא במים סטריליים סביב הבארות ליצירת סביבה humidified לעכב אידוי.
  4. לאחר מכן, תרבות הצלחת ב 37 ° C ב- 5% CO2 ב- 100% לחות לשעה.
  5. בזהירות תשאף המדיום הישן ולהחליף אותו על ידי 600 µL של מדיום מופחת סרום 1% תא אנדותל הצמיחה תוספי כל היטב.
  6. לאחר 12 שעות או 24 שעות ביממה, לקחת תמונות תחת מיקרוסקופ אור הפוך (40 *).

5. ניתוח נתונים

  1. להעלות את התמונות פלטפורמת ניתוח תמונה באינטרנט כדי לקבל נתוני אורך נבט (טבלה של חומרים).
  2. בדף האינטרנט, ליצור חשבון בדואר אלקטרוני.
  3. ואז להעלות את התמונות על ידי לחיצה על כפתור ההעלאה.
  4. להוריד את התוצאה על ידי לחיצה על לחצן הורד.
    הערה: התוכנה יפיק את התמונה המעובדת ואת הנתונים. הנתונים מכילים לחמישה חלקים: נבט המצטבר אורך, אורך נבט מרושע, סטיית התקן של נבט אורך, נבט אזור ואזור ספרואיד. בתמונה מעובד, כל פרמטר המותווה בצבע שונה כדי להקל על זיהוי בתמונה המעובדת: אדום מייצג נבטים שלד, צהוב מספר נבטים, כחול את מבנה נבט, וסוף לבן נבט, ספרואיד כתום.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

התמונות המקוריות נלקחים על ידי מיקרוסקופ אור הפוך. דמויות טיפוסיות של קבוצת הביקורת וקבוצת אייצ '-אל מוצגים באיור2-A1 , איור 2-A2. אורך נבטי של קבוצת הביקורת היא קצרה יותר מזו של קבוצת אייצ '-.

לאחר העלאת התמונות, הפלטפורמה המקוונת מספקת תוצאות ניתוח ישירות. הפלט מורכב משני חלקים: התמונה המעובדת ואת התוצאות המתקבלות ניתוח. תמונות מעובד של קבוצת הביקורת וקבוצת שתיקה אייצ '-אל הגן מסומנים בצבעים שונים (איור 2-A3 , איור 2-A4). האורך נבט הממוצע הוא 65 מיקרומטר ו- 125 µm ב קבוצת הביקורת וקבוצת שתיקה אייצ '-אל, בהתאמה, והוא אורך ממוצע מצטבר נבט מיקרומטר 680 1250 מיקרומטר ב קבוצת הביקורת וקבוצת שתיקה אייצ '-אל, בהתאמה, המציין כי נבט אורך גדל על ידי כ שני קיפולים בקבוצה שתיקה אייצ '-אל, לעומת קבוצת הביקורת (איור 2B). תוצאות אלו מצביעות על מחסור אייצ '-אל מקדם את היכולת להיוות הקיבול של תאי אנדותל אדם.

Figure 1
איור 1 . הסכימה עבור ספרואיד לבלוב assay. שלבים 1 מראה התאים HUVEC תרבותי תבשיל. 2 שלבים, HUVEC תאים מועברים ללוחות 96-ובכן למטה סיבוב תלת-ממד עבור ה 72 שלבים 3 מציג הטופס תאים HUVEC spheroids תא אנדותל באופן אוטומטי בצלחת תלת-ממד. 4 צעדים, להוסיף תא ספרואיד ג'ל מדולל. ב- 5 צעדים, להוסיף את תערובת מוכנה מעל צלחת 15-. טוב. שלבים 6 מראה ספרואיד הלבלוב בצלחת 15-. טוב. שלבים 7 הצג את התמונה נבטי נלקח תחת מיקרוסקופ אור הפוך. שלבים 8 מראה את התמונה שהועלה והוא שלב 9 התמונה פלט מן הרציף (בר = 100 מיקרומטר). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2 . השפעת אייצ '-אל ג'ין להחרשת ביכולת אנגיוגנזה של תאים HUVEC ספרואיד הלבלוב וזמינותו. (א) להחליפן בתמונות של תוצר זרבובית לאחר 12 שעות הבקרה (A1), HUVEC מושתקים-אייצ '-אל spheroids (A2) (בר = 100 מיקרומטר). דמויות A3 ו- A4 להראות את התמונות נותחו על ידי הפלטפורמה עבור דמויות A1 ו- A2, בהתאמה. האדום מייצג נבטים שלד, צהוב מספר נבטים, כחול את מבנה נבט, וסוף לבן נבט, ספרואיד כתום. (B) אורך של הנבטים. ניתוח סטטיסטי בוצעה באמצעות מבחן t של סטודנט אינטראקצית. * מייצגים P < 0.05. קון, שליטה; HUVEC, תאי אנדותל יפתור. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

לאחרונה, מספר תחומי מחקר לביולוגיה היו מגורה על ידי המחקר של אנדותל האנגיוגנזה15. במאמר זה, פיתחנו ספרואיד אנדותל של לבלוב טכניקה כמודל ניסויי ללמוד היווצרות כלי שמקורו ג'ין אייצ '-אל אובדן התפקוד בתאי האנדותל מניפולציות כדי לזהות מולקולות המועמד הרומן של אשד אנגיוגנזה. למיטב ידיעתנו, זה הדו ח הראשון לבחון את ההשפעות אנגיוגנזה של תאי אנדותל ששונה endogenic.

כורוידאלית רקמה (כולל גידול רקמות) היא תהליך מורכב המתרחשת באמצעות האנגיוגנזה, vasculogenic מנגנונים במהלך הפיתוח, כמו גם שני מצבים פיזיולוגיים ופתולוגיים12,15 , 16. ספרואיד הלבלוב assay מאופיין על-ידי תצוגה מדורגת מורכבת של אירועי17,18, כולל הצבירה העצמית של תאי אנדותל המוטבעות מערכת תרבות מטריקס תא תלת-ממד, דבר המתבטא הלבלוב הרבייה של הרשת תלת-ממד של נימים19. מודל 3D ספרואיד ג'ל-מוטבע זה הפך מערכת הנפוצה בהנדסת רקמות ללמוד היווצרות כלי דם ומנגנונים שלה בשל יכולתו לספק סביבה כדאי היה שווה במטריצה מתאימים. אולם, השלב המכריע ביותר של התהליך הביולוגי הוא ההפעלה של תאי אנדותל השבתה הדרגתית17,20,21,22. בהליך זה, תאי אנדותל הופעלו על-ידי endogenic להחרשת אייצ '-אל הגן, גן מווסת צמיחה neovessels23,24. שונה אנדותל קלאסי חניכה דרך אקסוגני אינדוקציה של המטריקס והסביבה חוץ-תאית המתאים (כולל אקסוגני כלי דם גורמי גדילה), שיטה זו שונה ניתן להרחיב עם המון יישומים כדי לפענח מנגנונים גנטיים endogenic. בשלב הבא, כדי לצמצם את ההשפעות של המטריקס אקסוגני, הפרוטוקול היה אופטימיזציה על ידי דילול הג'ל, אשר היה צעד פשוט לניסוי. בנוסף, לקח רק דקות כדי להעלות תמונות פלטפורמת וכדי להשיג תוצאות ניתוח. פלטפורמת מספק שירות ניתוח תמונה המאפשר הנסיין לעשות. של המטרה, ניתוח תמונות דומות, ואוטומטיים מונבטים assay תמונות באינטרנט. לכן, הפרוטוקול מתגבר על שגיאות מדידה וחישוב הנגרמות על ידי גורמים מעשה ידי אדם.

ההבנה מכניסטית של צעדים בודדים של המפל כורוידאלית סיפק בסיס רציונלי התפתחות הטיפול האנטי-וסקולרית כעת הוא להיות מאושר עבור יישום קליני באונקולוגיה. נייר זה הקימה מודל פשוט וחזק מבוססי ספרואיד assay ללמוד היווצרות כלי שמקורו תאי אנדותל מניפולציה עם אובדן תפקוד הגן אייצ '-אל זיהוי מולקולות המועמד הרומן כורוידאלית מדורגים, אשר יכול להיות מנוצל עבור יישומים רבים אנגיוגנזה, vasculogenesis-הקשורות. המחברים משערים כי מודל זה במבחנה עשוי לספק מידע נוסף כדי לסייע להעריך את התפקיד של אנגיוגנזה כמה גידולים מוצקים (למשל, גידול vasculogenic חיקוי) ולחקור את תפקידי פוטנציאליות אחרות ובתאים אפשרי כדי להפיק גידול neovessels ויוו, במיוחד בחולים עם גידולים, כקבוצה, אינם מגיבים לטיפול עם סוכנים אנטי-אנגיוגנזה בלבד.

וזמינותו נבטי ספרואיד הפכה שיטה הנפוצה ללמוד אנגיוגנזה ומנגנונים נלווים. הבדיקה יש יתרון חשוב על-ידי מתן מחקים סביבה טובה יותר מאשר התרבויות 2D קלאסית. לאחרונה, פותחו מודלים 3D תרבות משותפת ללמוד אנגיוגנזה המחקה את הטרוגניות והמורכבות של אנגיוגנזה בתוך הגידול microenvironment25. במודל זה, תאי אנדותל מתורבתים ישירות עם תאים סרטניים, כמו גם מרכיב סטרומה סביבה תלת-ממד. בנוסף, מערכות תלת-ממד in vitro לקשרי תרבות הוכחו כדי לשקף באופן מדויק יותר את התגובה ויוו סוכני טיפולית מאשר מערכות התרבות התא קונבנציונלי. בנוסף, שיטה זו משמשת את הבידול של תאי גזע עובריים של רקמה, ריפוי פצעים, איסכמיה, דלקת. לעומת השיטה הקלאסית, הגישה שלנו היא יעילה וקלה ליישום. אנו מאמינים הוא כלי שימושי עבור המחקר של אנגיוגנזה במבחנה, ופותחת דרך חדשה להבין את התהליך הזה טוב יותר.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgments

עבודה זו נתמכה על ידי מענקים שנגחאי ועדת המדע והטכנולוגיה (15411951800, 15410723200). המחברים רוצים להודות פרופסור של YuMei וון וז'או צ'או פרופסור באוניברסיטת פתוגניים מיקרואורגניזם המחלקה של פודאן לסיוע טכני שלהם.

Materials

Name Company Catalog Number Comments
human umbilical vein endothelial cell Fudan IBS Cell Center FDCC-HXN180
dulbecco’s modified eagle’s medium  Gibco 11995040
fetal bovine serum Gibco  26400044
PLKO.1-puro vector Addgene #8453
packing plasmid psPAX2  Addgene #12260
envelope plasmid pMD2.G Addgene #12259
3D round-bottom 96-well plates S-Bio MS-9096M
matrigel BD Biosciences 354234
Opti-MEM medium Gibco 31985-070 reduced serum medium 
15-well plate Ibidi 81501 Air bubbles in the gel can be reduced by equilibrating the μ–Slide angiogenesis before usage inside the incubator overnight
endothelial cell growth supplements Sciencell #1052
10-cm culture dish Corning Scipu000813
Puromycin Gibco A1113802
typsin-EDTA Gibco 25200056
Automated Cell Counter System   BioTech
Image Analysis software  Winmasis http://mywim.wimasis.com 

DOWNLOAD MATERIALS LIST

References

  1. Lonser, R. R., et al. von Hippel-Lindau disease. Lancet. 361, (9374), 2059-2067 (2003).
  2. Hussein, M. R. Central nervous system capillary haemangioblastoma: the pathologist's viewpoint. Int J Exp Pathol. 88, (5), 311-324 (2007).
  3. Ma, D., et al. Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche. Carcinogenesis. 32, (1), 102-109 (2011).
  4. Zhuang, Z., et al. Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors. Sci Rep. 4, 4102 (2014).
  5. Glasker, S., et al. VHL-deficient vasculogenesis in hemangioblastoma. Exp Mol Pathol. 96, (2), 162-167 (2014).
  6. Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas. Cancer Res. 55, (6), 1358-1364 (1995).
  7. Cancilla, P. A., Zimmerman, H. M. The fine structure of a cerebellar hemangioblastoma. J Neuropathol Exp Neurol. 24, (4), 621-628 (1965).
  8. Kawamura, J., Garcia, J. H., Kamijyo, Y. Cerebellar hemangioblastoma: histogenesis of stroma cells. Cancer. 31, (6), 1528-1540 (1973).
  9. Jurco, S., et al. Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry. Hum Pathol. 13, (1), 13-18 (1982).
  10. Ma, D., et al. Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas. Cancer Biol Ther. 12, (8), 727-736 (2011).
  11. Ma, D., et al. CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma. Tumour Biol. 37, (3), 3765-3774 (2016).
  12. Sharifpanah, F., Sauer, H. Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis. Methods Mol Biol. 1430, 179-189 (2016).
  13. Cai, H., et al. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma. Oncogene. 36, (3), 318-331 (2017).
  14. Xu, J., et al. Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP. Appl Biochem Biotechnol. 181, (2), 699-709 (2017).
  15. Laib, A. M., et al. Spheroid-based human endothelial cell microvessel formation in vivo. Nat Protoc. 4, (8), 1202-1215 (2009).
  16. D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. Angiogenesis and Vasculogenesis in Health and Disease. Biomed Res Int. 2015, 126582 (2015).
  17. Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model. Cell Prolif. 42, (4), 498-505 (2009).
  18. Morin, K. T., Tranquillo, R. T. In vitro models of angiogenesis and vasculogenesis in fibrin gel. Exp Cell Res. 319, (16), 2409-2417 (2013).
  19. Blacher, S., et al. Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour. PLoS One. 9, (5), 97019 (2014).
  20. Straume, O., et al. Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer. Proc Natl Acad Sci U S A. 109, (22), 8699-8704 (2012).
  21. Naumov, G. N., Akslen, L. A., Folkman, J. Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch. Cell Cycle. 5, (16), 1779-1787 (2006).
  22. Naumov, G. N., Folkman, J., Straume, O. Tumor dormancy due to failure of angiogenesis: role of the microenvironment. Clin Exp Metastasis. 26, (1), 51-60 (2009).
  23. Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice. Mol Carcinog. 56, (10), 2342-2351 (2017).
  24. Stratmann, R., Krieg, M., Haas, R., Plate, K. H. Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene. J Neuropathol Exp Neurol. 56, (11), 1242-1252 (1997).
  25. Correa de Sampaio, P., et al. A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis. PLoS One. 7, (2), 30753 (2012).
נוהל מקיף כדי להעריך את ביצועי <em>במבחנה</em> כורוידאלית Hemangioblastoma בשם משתמש את ספרואיד הלבלוב Assay
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).More

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter