Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Cancer Research

Una procedura completa per valutare le prestazioni In Vitro del Hemangioblastoma Neovascularization putativo utilizzando la sferoide germogliatura Assay

doi: 10.3791/57183 Published: April 12, 2018

Summary

Questa carta presenta una procedura completa per valutare in vitro in esistenza l'angiogenesi del tumore classico nel hemangioblastomas (HBs) e del suo ruolo in HBs. I risultati evidenziare la complessità della HB-neovascolarizzazione e suggeriscono che questa forma comune dell'angiogenesi è solo un meccanismo complementare in HB-neovascolarizzazione.

Abstract

L'inattivazione del gene soppressore del tumore del von Hippel-Lindau (VHL) svolge un ruolo cruciale nello sviluppo dei hemangioblastomas (HBs) entro l'umano sistema nervoso centrale (SNC). Tuttavia, sia l'origine citologica e il processo evolutivo di HBs (tra cui neovascolarizzazione) rimangono discutibili, e anti-angiogenesi per VHL-HBs, basato sul classico HB angiogenesi, hanno prodotto risultati deludenti in studi clinici. Uno dei principali ostacoli per il successo clinico di trattamento anti-vascolare è la mancanza di una conoscenza approfondita della neovascolarizzazione in questo tumore vascolare. In questo articolo, presentiamo una procedura completa per valutare in vitro se l'angiogenesi del tumore classico esiste in HBs, come pure il suo ruolo in HBs. Con questa procedura, i ricercatori possono accuratamente comprendere la complessità del neovascularization HB e identificare la funzione di questa forma comune dell'angiogenesi in HBs. Questi protocolli possono essere utilizzati per valutare la terapia anti-vascolare più promettente per i tumori, che ha alto potenziale traslazionale per trattamento di tumori o per aiutare nell'ottimizzazione del trattamento anti-angiogenico per HBs in futuro traduzioni. I risultati evidenziare la complessità della neovascolarizzazione HB e suggeriscono che questa comune forma l'angiogenesi è solo un meccanismo complementare in HB neovascolarizzazione.

Introduction

Hemangioblastomas (HBs) sono tumori vascolari benigni che si trovano esclusivamente nell'ambito umano sistema nervoso centrale (CNS). Si sviluppano in pazienti con malattia di von Hippel-Lindau (VHL) o lesioni sporadiche. VHL-HBs sono difficili da curare attraverso trattamento chirurgico a causa della frequente ricorrenza e lesioni multiple che derivano da questo genetico disturbo1. Sebbene l'inattivazione del gene soppressore del tumore VHL è stata considerata la causa principale di tumorigenesis di VHL-HBs, l'origine citologica (tra cui neovascolarizzazione) e il processo evolutivo di HBs rimangono in gran parte controverso2. Di conseguenza, una migliore comprensione dei meccanismi biologici HB-neovascolare può fornire utili intuizioni più promettenti strategie anti-vascolare per VHL-HBs.

Recenti ricerche hanno suggerito che HB-neovascolarizzazione è simile alla vasculogenesi embriologica3,4,5. Classico fattore di crescita endoteliale vascolare (VEGF)-mediata angiogenesi che ha provenuto dall'endotelio vascolare e che è guidato da perdita VHL di funzione ha provocato la proliferazione e la formazione neovascolare, che è stato sfidato6. Nel 1965, Cancilla e Zimmerman trovato, usando la microscopia, HBs originata dal endotelio7. Più successivamente è stato trovato che le cellule stromal sono derivate da vasoformative elemento8. Nel 1982, Vladimír et al ha trovato che le cellule stromale sono di origine endoteliale9. Pertanto, abbiamo ipotizzato che le cellule endoteliali vascolari umane sono celle originali di HB-neovascularization10. Anche se è preferibile utilizzare le colture primarie da HB cellule derivate da pazienti ambulatori VHL, la nostra ricerca precedente indicato che colture primarie da HB non sono stabili, e linee cellulari non potevano essere stabilita3. Inoltre, le colture primarie nell'ambiente 3D non ha potevano identificare l'origine citologica della HB-neovascolarizzazione perché essi comprendono i progenitori di HB-vascolare ingredienti10,11. Pertanto, come un modello classico e primitivo delle cellule endoteliali, cellule vascolari endoteliali (HUVEC) potrebbero servire come modello cellulare alternativo per HBs.

Il dosaggio di germogliatura sferoide è un nuovo modello in tessuto ingegneria12,13. In questa carta, un 3D basati su collagene coculture sistema in vitro utilizzando la sferoide germogliatura dosaggio è stato sviluppato, con un obiettivo globale per valutare se l'angiogenesi del tumore classico esiste in HBs, come pure il suo ruolo in HBs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Questo metodo è stato eseguito in conformità con le linee guida approvate e i regolamenti della ricerca etica Comitato di Huashan Hospital, Università di Fudan. Misure di sicurezza standard corrispondenti sono stati seguiti in ogni passo. Per una presentazione schematica, fare riferimento alla Figura 1.

1. cultura e costrutto plasmidico delle cellule

  1. Gestire periodicamente delle cellule endoteliali di vena ombelicale umana (HUVEC) in Dulbecco s modified medium dell'Aquila (DMEM) supplementato con 10% siero bovino fetale (FBS), 100 unità/mL di penicillina e 100 µ g/mL di streptomicina in un 5% umidificata incubatore a CO2 a 37 ° C.
  2. Digerire PLKO.1 plasmide con ApaI ed EcoRI per la sintesi del frammento di shRNA. Assicurarsi che la sequenza del oligonucleotide del vettore di shRNA VHL è CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14.
  3. Quindi, mescolare 20 sistema di µΜ con avanti 5 µ l di oligo, 5 µ l di oligo inversa, 5 µ l di tampone di NEB 10x e 35 µ l di ddH2O insieme (il volume totale è di 50 µ l). Riscaldare la miscela a 98 ° C per 4 min e lentamente raffreddare a temperatura ambiente in poche ore.
  4. Legare i oligos ricotto e plasmide PLKO.1 insieme ligasi T4 a 4 ° C per una notte. 16 h dopo, aggiungere 5 µ l di mix di legatura in cellule DH5α competente di 25 µ l. Quindi, i plasmidi con successo legati a schermo e verificare il frammento inserito dall'ordinamento.

2. infezione e pacchetto lentivirus

  1. In totale, mescolare 10 µ g del vettore PLKO.1-shVHL o PLKO.1-shScramble, 7,5 µ g di imballaggio plasmide psPAX2 e 2,5 µ g di busta plasmide pMD2.G in 500 µ l di media DMEM senza siero bovino fetale (FBS) per 25 min.
  2. Aggiungere 7 mLDMEM senza FBS alla soluzione preparata in precedenza.
  3. Cellule di cultura 293FT in DMEM senza FBS in piatti di coltura del tessuto un diametro di 10 cm. Assicurarsi che il numero delle cellule 293FT è di 1 x 107 utilizzando un contatore di cellule.
  4. Aggiungere 1 mL di soluzione preparata sopra al mezzo delle cellule 293FT per la transfezione.
    Nota: La linea cellulare di 293FT è derivato dalla linea cellulare 293F ed esprimere stabilmente il grande T antigene SV40. Pertanto, è un ospite adatto per la produzione di vettori lentivirali.
  5. Sostituire il terreno di coltura con DMEM contenente 10% FBS dopo 6 h.
  6. Raccogliere i media usando una pipetta a 48 h dopo la trasfezione.
    Nota: Il virus esiste in DMEM contenente 10% FBS. Le cellule morte galleggiano sul mezzo. Utilizzare sterile membrana da 0,45 µm per filtrare le cellule morte e le impurità. In generale, non c'è nessuna necessità di controllare la molteplicità di infezione (MOI). Si tratta di stabilire una linea di cellule stabili. Nell'ultima fase, tutte le cellule viventi senza successo infezione morirà da con puromicina. Il gruppo di shScramble e cellule HUVEC sono il gruppo di controllo. Garantire che tutte le cellule HUVEC morire con la concentrazione usata con puromicina 72h. Ogni pozzo ha lo stesso numero di celle.
  7. Coltura le cellule HUVEC nei media lentivirali per 72 h. Quindi, aggiungere con puromicina ai media delle cellule HUVEC ad una concentrazione di 2 µ g/mL per 24 h. uso cellule HUVEC senza alcun trattamento come gruppo di controllo. Garantire che tutti controllare le cellule muoiono entro questo tempo.
    Nota: Le cellule viventi rappresentano una linea cellulare stabile delle celle di colpo di VHL e shSramble delle cellule. La densità di placcatura è 5.000/pozzetto in piastre da 96 pozzetti.

3. generazione di cellule endoteliali sferoidi

  1. Tripsinizzano le cellule HUVEC e risospendere in mezzo DMEM con 10% FBS. Con un numero moderato di cellule in una piastra di coltura di 10 cm, aggiungere 1 mL di typsin-EDTA.
  2. Le cellule in una piastra a 96 pozzetti fondo tondo 3D, ad una densità di cella di 1 × 10-3 cellule/pozzetto del seme. Utilizzare un pozzo che può ospitare uno sferoide di 0,50 µ l di sospendere la sferoide. Contare le celle utilizzando un sistema di contatore cellulare seguendo le istruzioni del produttore.
  3. Incubare le cellule a 37 ° C e 5% CO2 continuamente per 72 h. In queste condizioni, garantire che le cellule sospese formano sferoidi cellulare automaticamente. Sostituire metà nel terreno di coltura dopo 36 h.

4. analisi di angiogenesi in vitro

  1. Scongelare la soluzione di gel a 4 ° C e diluirlo con il mezzo di siero riduttore con un rapporto di diluizione di 1:5.
  2. Succhiare gli sferoidi da terreno di coltura DMEM con una micropipetta. Dopo aver lavato le sferoidi con 5 mL di terreno riduttori del siero, sospendere le sferoidi delicatamente e con cautela nel gel diluito. Assicurarsi che non siano senza bolle d'aria.
  3. Incorporare 300 µ l di liquido misto in una piastra 15-pozzetti. Dopo incubazione a 37 ° C e 5% CO2 per 1 h, aggiungere 400 µ l il mezzo di riduttore del siero in ciascun pozzetto. Riempire di acqua sterile intorno ai pozzi per generare un ambiente umidificato per ostacolare l'evaporazione.
  4. Da allora in poi, cultura la piastra a 37 ° C in 5% CO2 al 100% di umidità per 1 h.
  5. Attentamente il vecchio mezzo di aspirare e sostituirlo con 600 µ l di siero riduttore terreno con i supplementi di crescita delle cellule endoteliali di 1% in ogni pozzetto.
  6. Dopo 12 ore o 24 ore, prendere le immagini sotto un microscopio ottico invertito (40 *).

5. analisi dei dati

  1. Caricare le immagini su una piattaforma di analisi di immagine online per ottenere dati di lunghezza del germoglio (Tabella materiali).
  2. Nella pagina Web, è necessario creare un account di posta elettronica.
  3. Quindi è possibile caricare le immagini facendo clic sul pulsante carica.
  4. Scaricare il risultato cliccando sul pulsante Scarica.
    Nota: Il software genererà l'immagine elaborata e i dati. I dati contengono cinque parti: cumulativo germoglio, germoglio di media lunghezza, la deviazione standard della lunghezza del germoglio, germoglio e sferoide area. Nell'immagine elaborata, ogni parametro è delineato in un colore diverso per semplificare l'identificazione nell'immagine elaborata: germogli di rosso rappresenta lo scheletro, giallo il numero di germogli, blu la struttura germoglio, germoglio bianco fine e arancia sferoide.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Immagini originali vengono prese dal microscopio ottico invertito. Le immagini tipiche del gruppo di controllo e del gruppo VHL sono mostrate nella Figura 2-A1 e Figura 2-A2. La lunghezza di germogliatura del gruppo di controllo è inferiore a quella del gruppo di VHL.

Dopo aver caricato le immagini, la piattaforma online fornisce direttamente i risultati dell'analisi. L'output è costituito da due parti: l'immagine elaborata e i risultati dell'analisi corrispondente. Le immagini elaborate del gruppo di controllo e del gruppo di silenzio gene VHL sono segnate con colori diversi (Figura 2-A3 e Figura 2-A4). La lunghezza media del germoglio è 65 µm e 125 µm nel gruppo di controllo e il gruppo di silenzio VHL, rispettivamente, e la lunghezza media cumulativa germoglio è 680 µm e 1250 µm nel gruppo di controllo e il gruppo di silenzio VHL, rispettivamente, che indica che germogliano aumenta la lunghezza di circa due pieghe nel gruppo di silenzio VHL, rispetto al gruppo di controllo (Figura 2B). Questi risultati indicano che la carenza di VHL promuove la capacità delle cellule endoteliali umane che formano la nave.

Figure 1
Figura 1 . Lo schema per la sferoide dosaggio di germogliatura. I passaggi da 1 Mostra le cellule HUVEC coltivate un piatto. In 2 passaggi, cellule HUVEC vengono spostate in piastre da 96 pozzetti fondo tondo 3D per 72 h. passaggi 3 Mostra il form di cellule HUVEC sferoidi delle cellule endoteliali automaticamente nella piastra di 3D. In 4 passaggi, aggiungere sferoide cellula al gel diluito. In 5 passi, aggiungere la miscela preparata sopra ad una piastra 15-pozzo. Passaggi 6 spettacoli sferoide che spuntano nei 15-pozzetti. Passaggi da 7 mostrano la germogliatura immagine scattata sotto un microscopio ottico invertito. I passaggi da 8 Mostra l'immagine caricata e passaggio 9 è l'immagine di output dalla piattaforma (bar = 100 µm). Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2 . L'effetto di silenziamento del gene VHL sulla capacità angiogenica delle cellule HUVEC in sferoide dosaggio di germogliatura. (A) immagini rappresentative del beccuccio escrescenza dopo 12 h in controllo (A1) e messo a tacere di VHL HUVEC sferoidi (A2) (bar = 100 µm). Figure A3 e A4 mostrare le immagini analizzate dalla piattaforma per figure A1 e A2, rispettivamente. Rosso rappresenta lo scheletro di germogli, il numero di germogli di giallo, blu la struttura germoglio, germoglio bianco fine e arancia sferoide. (B) lunghezza dei germogli. L'analisi statistica è stata eseguita utilizzando il test t di Student spaiati. * rappresentano P < 0.05. CON, controllo; HUVEC, delle cellule endoteliali di vena ombelicale umana. Clicca qui per visualizzare una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Recentemente, più campi di ricerca di biologia vascolare sono stati stimolati dallo studio dell' endotelio angiogenici15. In questo articolo, abbiamo sviluppato uno sferoide endoteliale germogliatura tecnica come modello sperimentale per studiare la formazione del vaso che proviene dalla perdita del gene VHL di funzione in cellule endoteliali manipolate identificare molecole candidate romanzo della cascata angiogenica. Al meglio della nostra conoscenza, questo è il primo rapporto per esaminare gli effetti di angiogenica delle cellule endoteliali modificate endogene.

La neovascolarizzazione del tessuto (tra cui il tessuto del tumore) è un processo complesso che si verifica tramite meccanismi angiogenetici e vascolare durante lo sviluppo, così come in entrambe le condizioni fisiologiche e patologiche12,15 , 16. la sferoide dosaggio di germogliatura è caratterizzata da una complessa cascata di eventi17,18, tra cui l'auto-aggregazione delle cellule endoteliali che sono incorporati in un sistema di coltura cellulare 3D matrix, che si traduce in germinazione e la riproduzione della rete 3D di capillari19. Questo modello 3D gel incorporato sferoide è diventato un sistema ampiamente usato in ingegneria tissutale per studiare la formazione vascolare e dei suoi meccanismi grazie alla sua capacità di fornire un ambiente meglio che imitano in una matrice adatto. Tuttavia, il passaggio più importante di questo processo biologico è l'attivazione di cellule endoteliali quiescenti17,20,21,22. In questa procedura, le cellule endoteliali sono state attivate gli endogeno silenziamento del gene VHL, un gene di crescita regolatore di neovasi23,24. Diverso dalla classica endotelio iniziazione tramite l'induzione esogeno della matrice e l'ambiente extracellulare corrispondente (tra cui fattori esogeni crescita vascolari), questo metodo modificato può essere esteso a numerosi applicazioni per svelare i meccanismi genetici endogene. Successivamente, per diminuire gli effetti della matrice esogena, il protocollo è stato ottimizzato diluendo il gel, che era un semplice passo nell'esperimento. Inoltre, ci sono voluti pochi minuti per caricare immagini sulla piattaforma e ottenere i risultati dell'analisi. La piattaforma fornisce un servizio di analisi di immagine che permette lo sperimentatore di rendere un obiettivo, analisi dell'immagine paragonabili e automatizzati di analisi immagini online di germogliatura. Pertanto, il protocollo supera di misura e calcolo errori causati da fattori artificiali.

La comprensione meccanicistica dei singoli passaggi della cascata della neovascolarizzazione fornito una base razionale per lo sviluppo del trattamento anti-vascolare che è attualmente essere approvato per l'applicazione clinica in oncologia. Questa carta stabilito un modello di analisi semplice e robusto sferoide-basata per studiare la formazione dei vasi che proviene dalle cellule endoteliali manipolate con perdita di funzione del gene di VHL identificare molecole candidate romanzo per la neovascolarizzazione Cascade, che può essere utilizzato per numerose applicazioni relative vasculogenesi e dell'angiogenesi. Gli autori speculano che questo modello in vitro potrebbe fornire ulteriori informazioni utili per valutare il ruolo dell'angiogenesi in alcuni tumori solidi (ad es., mimetismo di tumore vascolare) e indagare i possibili ruoli di altre cellule progenitrici possibili per generare tumore neovasi in vivo, specialmente in pazienti con tumori che, come gruppo, non rispondono al trattamento con agenti anti-angiogenici solo.

Il dosaggio di germogliatura sferoide è diventato un metodo ampiamente usato per studiare l'angiogenesi e meccanismi correlati. Il saggio ha un vantaggio importante fornendo un ambiente mimico migliore rispetto le culture classiche 2D. Recentemente, sono stati sviluppati modelli 3D co-coltura per studiare l'angiogenesi del tumore che imita l'eterogeneità e la complessità dell'angiogenesi all'interno del microambiente del tumore25. In questo modello, le cellule endoteliali sono coltivate direttamente con le cellule tumorali, come pure una componente stromal in un ambiente 3D. Inoltre, 3D in vitro sistemi di coltura sono stati indicati per riflettere più accuratamente la risposta in vivo agli agenti terapeutici rispetto a sistemi di coltura cellulare convenzionale. Inoltre, questo metodo viene utilizzato per la differenziazione delle cellule staminali embrionali, la crescita dei tessuti, la guarigione della ferita, ischemia e l'infiammazione. Confrontato con il metodo classico, il nostro approccio è efficace e facile da implementare. Crediamo che è un utile strumento per lo studio dell'angiogenesi in vitro, e si apre un nuovo modo di comprendere questo processo migliore.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

Questo lavoro è stato sostenuto da sovvenzioni da Shanghai Comitato della scienza e della tecnologia (15411951800, 15410723200). Gli autori desiderano ringraziare la Prof. ssa YuMei Wen e Prof. ssa Chao Zhao dell'Università Dipartimento microorganismo patogeno di Fudan per loro assistenza tecnica.

Materials

Name Company Catalog Number Comments
human umbilical vein endothelial cell Fudan IBS Cell Center FDCC-HXN180
dulbecco’s modified eagle’s medium  Gibco 11995040
fetal bovine serum Gibco  26400044
PLKO.1-puro vector Addgene #8453
packing plasmid psPAX2  Addgene #12260
envelope plasmid pMD2.G Addgene #12259
3D round-bottom 96-well plates S-Bio MS-9096M
matrigel BD Biosciences 354234
Opti-MEM medium Gibco 31985-070 reduced serum medium 
15-well plate Ibidi 81501 Air bubbles in the gel can be reduced by equilibrating the μ–Slide angiogenesis before usage inside the incubator overnight
endothelial cell growth supplements Sciencell #1052
10-cm culture dish Corning Scipu000813
Puromycin Gibco A1113802
typsin-EDTA Gibco 25200056
Automated Cell Counter System   BioTech
Image Analysis software  Winmasis http://mywim.wimasis.com 

DOWNLOAD MATERIALS LIST

References

  1. Lonser, R. R., et al. von Hippel-Lindau disease. Lancet. 361, (9374), 2059-2067 (2003).
  2. Hussein, M. R. Central nervous system capillary haemangioblastoma: the pathologist's viewpoint. Int J Exp Pathol. 88, (5), 311-324 (2007).
  3. Ma, D., et al. Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche. Carcinogenesis. 32, (1), 102-109 (2011).
  4. Zhuang, Z., et al. Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors. Sci Rep. 4, 4102 (2014).
  5. Glasker, S., et al. VHL-deficient vasculogenesis in hemangioblastoma. Exp Mol Pathol. 96, (2), 162-167 (2014).
  6. Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas. Cancer Res. 55, (6), 1358-1364 (1995).
  7. Cancilla, P. A., Zimmerman, H. M. The fine structure of a cerebellar hemangioblastoma. J Neuropathol Exp Neurol. 24, (4), 621-628 (1965).
  8. Kawamura, J., Garcia, J. H., Kamijyo, Y. Cerebellar hemangioblastoma: histogenesis of stroma cells. Cancer. 31, (6), 1528-1540 (1973).
  9. Jurco, S., et al. Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry. Hum Pathol. 13, (1), 13-18 (1982).
  10. Ma, D., et al. Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas. Cancer Biol Ther. 12, (8), 727-736 (2011).
  11. Ma, D., et al. CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma. Tumour Biol. 37, (3), 3765-3774 (2016).
  12. Sharifpanah, F., Sauer, H. Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis. Methods Mol Biol. 1430, 179-189 (2016).
  13. Cai, H., et al. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma. Oncogene. 36, (3), 318-331 (2017).
  14. Xu, J., et al. Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP. Appl Biochem Biotechnol. 181, (2), 699-709 (2017).
  15. Laib, A. M., et al. Spheroid-based human endothelial cell microvessel formation in vivo. Nat Protoc. 4, (8), 1202-1215 (2009).
  16. D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. Angiogenesis and Vasculogenesis in Health and Disease. Biomed Res Int. 2015, 126582 (2015).
  17. Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model. Cell Prolif. 42, (4), 498-505 (2009).
  18. Morin, K. T., Tranquillo, R. T. In vitro models of angiogenesis and vasculogenesis in fibrin gel. Exp Cell Res. 319, (16), 2409-2417 (2013).
  19. Blacher, S., et al. Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour. PLoS One. 9, (5), 97019 (2014).
  20. Straume, O., et al. Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer. Proc Natl Acad Sci U S A. 109, (22), 8699-8704 (2012).
  21. Naumov, G. N., Akslen, L. A., Folkman, J. Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch. Cell Cycle. 5, (16), 1779-1787 (2006).
  22. Naumov, G. N., Folkman, J., Straume, O. Tumor dormancy due to failure of angiogenesis: role of the microenvironment. Clin Exp Metastasis. 26, (1), 51-60 (2009).
  23. Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice. Mol Carcinog. 56, (10), 2342-2351 (2017).
  24. Stratmann, R., Krieg, M., Haas, R., Plate, K. H. Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene. J Neuropathol Exp Neurol. 56, (11), 1242-1252 (1997).
  25. Correa de Sampaio, P., et al. A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis. PLoS One. 7, (2), 30753 (2012).
Una procedura completa per valutare le prestazioni <em>In Vitro</em> del Hemangioblastoma Neovascularization putativo utilizzando la sferoide germogliatura Assay
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).More

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter