Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Cancer Research

Un procedimiento integral para evaluar el rendimiento In Vitro de la neovascularización de Hemangioblastoma putativo con el esferoide brotación ensayo

doi: 10.3791/57183 Published: April 12, 2018

Summary

Este trabajo presenta un procedimiento general para evaluar en vitro si angiogénesis tumoral clásico existe en los hemangioblastomas (HBs) y su papel en HBs. Los resultados destacan la complejidad de la neovascularización de la HB y sugieren que esta forma común de angiogénesis es solamente un mecanismo complementario en la neovascularización de la HB.

Abstract

La inactivación del gen de supresor de tumor von Hippel-Lindau (VHL) desempeña un papel crucial en el desarrollo de hemangioblastomas (HBs) en el sistema de nervioso central (SNC) humano. Sin embargo, el origen citológico y el proceso evolutivo de HBs (incluyendo el neovascularization) siguen siendo polémicas, y anti-angiogénesis para la BVS-HBs, basados en el clásico HB angiogénesis, han producido resultados decepcionantes en ensayos clínicos. Un obstáculo importante para la traducción clínica exitosa de tratamiento vascular es la falta de un conocimiento profundo del neovascularization en este tumor vascular. En este artículo, presentamos un procedimiento general para evaluar en vitro si angiogénesis tumoral clásico existe en HBs, así como su papel en HBs. Con este procedimiento, los investigadores pueden comprender la complejidad de la neovascularización de la HB con precisión e identificar la función de esta forma común de la angiogénesis en HBs. Estos protocolos pueden utilizarse para evaluar la terapia vascular más prometedor para los tumores, que tiene alto potencial traslacional para tratamiento de tumores o para ayudar en la optimización del tratamiento anti-angiogénico para HBs en el futuro las traducciones. Los resultados destacan la complejidad de la neovascularización de la HB y sugieren que esta angiogénesis forma común es solamente un mecanismo complementario en la neovascularización de la HB.

Introduction

(HBs) los hemangioblastomas son tumores vasculares benignos que se encuentran exclusivamente en el sistema de nervioso central (SNC) humano. Se desarrollan en pacientes con enfermedad de von Hippel-Lindau (VHL) o lesiones esporádicas. BVS-HBs son difíciles de curar a través de tratamiento quirúrgico debido a la frecuente repetición y lesiones múltiples que resultan de esta genética desorden1. Aunque la inactivación del gen supresor VHL tumor se ha considerado la causa principal de la tumorigénesis de BVS-HBs, el origen citológico (incluyendo el neovascularization) y el proceso evolutivo de HBs siendo polémico en gran parte2. Por lo tanto, una mejor comprensión de los mecanismos biológicos de HB-neovascular puede proporcionar ideas útiles sobre las estrategias más prometedoras vasculares para BVS-HBs.

La investigación reciente ha sugerido que HB-neovascularización es similar a la vasculogénesis embriológico3,4,5. Clásico factor de crecimiento endotelial (VEGF)-angiogénesis mediada que origina el endotelio vascular y que es conducido por pérdida de la BVS de la función dio lugar a la proliferación y la formación neovascular, que ha sido desafiado6. En 1965, Cancilla y Zimmerman encontró, utilizando microscopía electrónica, que HBs se originaron en el endotelio7. Más tarde se encontró que las células del estroma se derivan vasoformativas elemento8. En 1982, Jurco et al encontraron que las células del estroma son de origen endotelial9. Por lo tanto, la hipótesis de que las células endoteliales vasculares humanas son las células originales de neovascularización de la HB10. Aunque es mejor utilizar los cultivos primarios de células HB de cirugías pacientes VHL, nuestra investigación anterior indicó que cultivos primarios de HB no son estables, y las líneas celulares no pueden ser establecido3. Por otra parte, los cultivos primarios en el entorno 3D no pudieran identificar el origen citológico de neovascularización de HB porque incluyen los progenitores de HB-vascular ingredientes10,11. Por lo tanto, como un modelo primitivo y clásico de las células endoteliales, las células endoteliales vasculares humanas (HUVEC) podían servir como modelo celular alternativo para HBs.

El ensayo de despunte de esferoide es un nuevo modelo en tejido ingeniería12,13. En este papel, un cocultivo de colágeno-basado 3D sistema en vitro con el esferoide brotación ensayo fue desarrollado, con una meta para evaluar si la angiogénesis tumoral clásico existe en HBs, así como su papel en HBs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Este método fue realizado según las directrices aprobadas y regulaciones de la investigación ética Comité de Huashan Hospital, Universidad de Fudan. Correspondientes medidas de seguridad estándar se siguieron en cada paso. Una presentación esquemática, por favor consulte la figura 1.

1. cultura y construcción del plásmido de la célula

  1. Habitualmente, mantener las células endoteliales de vena umbilical humana (HUVEC) en Dulbecco de modificado medio del águila (DMEM) suplementado con 10% suero bovino fetal (FBS), 100 unidades/mL de penicilina y 100 μg/mL de estreptomicina en un 5% humidificado incubadora de CO2 a 37 ° C.
  2. Digerir PLKO.1 plásmido con ApaI y EcoRI para la síntesis del fragmento de shRNAs. Garantizar que la secuencia de oligonucleótidos del vector de shRNAs BVS CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14.
  3. Luego, mezcle 20 sistema µΜ delantero 5 μl de oligo, 5 μl de oligo reverse, 5 μl de 10 x buffer de NEB y 35 μl de ddH2O junto (el volumen total es de 50 μL). Calienta la mezcla a 98 ° C por 4 minutos y poco a poco enfriar a temperatura ambiente unas horas.
  4. Ligar los oligos recocido y PLKO.1 plásmido junto con T4 ligasa a 4 ° C para pasar la noche. 16 h más tarde, añadir 5 μl de mezcla de ligadura en competentes DH5α células de 25 μl. Luego, la plásmidos ligada con éxito de la pantalla y verificar el fragmento insertado por la secuencia.

2. infección y paquete de lentivirus

  1. En total, mezclar 10 μg del vector PLKO.1-shVHL o PLKO.1-shScramble, 7,5 μg de plásmido psPAX2 de embalaje y 2,5 μg de envolvente plásmido pMD2.G en 500 μl del medio DMEM sin suero fetal bovino (FBS) durante 25 minutos.
  2. Añadir 7 mLDMEM sin SFB a la solución preparada anteriormente.
  3. La cultura 293 células FT en DMEM sin FBS en un platos de cultivo de tejidos de 10 cm de diámetro. Asegúrese de que el número de células 293 pies es 1 x 107 usando un contador de células.
  4. Añadir 1 mL de la solución preparada anteriormente en el soporte de células 293 pies para transfección.
    Nota: La línea celular de 293 pies se deriva de la línea celular de 293F y estable expresan el antígeno T grande de SV40. Por lo tanto, es un huésped adecuado para la producción de lentivirales.
  5. Reemplazar el medio de cultivo con DMEM con 10% FBS después de 6 h.
  6. Recoger los medios de comunicación con una pipeta a las 48 h después de transfección.
    Nota: El virus existe en DMEM con 10% FBS. Las células muertas flotan en el medio. Utilizar membrana estéril de 0,45 μm para filtrar las células muertas e impurezas. Por lo general, no hay necesidad para revisar la multiplicidad de infección (MOI). Se trata de establecer una línea estable de células. En el último paso, todas las células vivas sin éxito infección morirán por puromicina. El grupo de shScramble y las células HUVEC están el grupo de control. Asegúrese de que todas las células HUVEC mueren con la concentración de puromicina usado por 72 h. Cada pozo tiene el mismo número de células.
  7. La cultura las células HUVEC en los medios de comunicación lentivirales para 72 h. Luego, añadir puromicina a los medios de comunicación de las células HUVEC en una concentración de 2 μg/mL para las células HUVEC uso de 24 h. sin ningún tratamiento como el grupo de control. Asegúrese de que todos los de control las células mueren por este tiempo.
    Nota: Las células vivas representan una línea celular estable de células precipitación BVS y shSramble. La densidad de placas es 5.000/pozo en placas de 96 pocillos.

3. generación de esferoides de células endoteliales

  1. Trypsinize las células HUVECs y resuspender en medio DMEM con 10% FBS. Con un número moderado de células en una placa de cultivo de 10 cm, añadir 1 mL de EDTA typsin.
  2. Las células en una placa de 96 pocillos de fondo redondo 3D, con una densidad celular de 1 × 103 células/pozo de la semilla. Uso de un bien que puede acomodar un esferoide de 0,50 μL para suspender el esferoide. Contar las células mediante un sistema de contador celular siguiendo las instrucciones del fabricante.
  3. Incube las células a 37 ° C y 5% CO2 continuamente durante 72 h. En estas condiciones, asegurarse de que las células suspendidas forman los esferoides celulares automáticamente. Vuelva a colocar la mitad de medio de cultivo después de 36 h.

4. ensayo de angiogénesis in vitro

  1. Descongelar la solución gel a 4 ° C y diluir con el medio de suero reducido en una proporción de dilución de 1:5.
  2. Chupar los esferoides de medio de cultivo DMEM con una micropipeta. Después de lavar los esferoides con 5 mL de medio de suero reducido, suspender los esferoides suavemente y con cuidado el gel diluido. Asegúrese de que no hay ninguna burbuja de aire.
  3. Incorporar 300 μL de líquido mezclado en una placa de la pozo 15. Después de incubación a 37 ° C y 5% CO2 para 1 h, añadir 400 μL del medio reducido suero a cada pozo. Llene de agua estéril alrededor de los pozos para generar un ambiente humidificado para dificultar la evaporación.
  4. Después de eso, la cultura la placa a 37 ° C en 5% CO2 en el 100% de humedad durante 1 hora.
  5. Cuidadosamente aspirar el medio viejo y sustituirlo por 600 μl del medio de suero reducido con suplementos de crecimiento celular endotelial de 1% en cada pozo.
  6. Después de 12 h o 24 h, tomar imágenes en un microscopio de luz invertido (40 *).

5. Análisis de datos

  1. Subir las imágenes a una plataforma de análisis de imagen en línea para obtener datos de la longitud del brote (Tabla de materiales).
  2. En la página web, crear una cuenta de correo electrónico.
  3. Luego subir las imágenes haciendo clic en el botón subir.
  4. Descargar el resultado haciendo clic en el botón de descarga.
    Nota: El software genera los datos y la imagen procesada. Los datos contienen cinco partes: brote acumulado, longitud de brotes promedio, la desviación estándar de longitud de brotes, área de brote y esferoide. En la imagen procesada, cada parámetro se contornea en un color diferente para facilitar la identificación en la imagen procesada: rojo representa brotes de esqueleto, el número de brotes de amarillo, azul el brote estructura final brote blanco y naranja esferoide.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Imágenes originales son tomados por microscopio de luz invertida. Las imágenes típicas del grupo control y el grupo de la BVS se muestran en la figura 2-A1 y figura 2-A2. La longitud de brote del grupo de control es más corta que el del grupo VHL.

Después de subir las imágenes, la plataforma online ofrece análisis de resultados directamente. La salida consta de dos partes: la imagen procesada y los resultados de análisis correspondientes. Las imágenes procesadas del grupo control y el grupo de silencio del gene VHL son marcadas con diferentes colores (figura 2-A3 y figura 2-A4). La longitud de brotes promedio es 65 μm y 125 en el grupo control y el grupo de silencio de BVS, respectivamente, y la longitud de brote acumulado promedio es 680 μm y 1250 en el grupo control y el grupo de silencio de BVS, respectivamente, indicando que brotan los aumentos de longitud por aproximadamente dos pliegues en el grupo de silencio de la BVS, en comparación con el grupo control (figura 2B). Estos resultados indican que la deficiencia de la BVS promueve la capacidad formadora de vasos de células endoteliales humanas.

Figure 1
Figura 1 . El esquema para el esferoide brotación análisis. Pasos 1 muestra células HUVEC cultivan un plato. En 2 pasos, células HUVEC se mueven a 3D placas de 96 pocillos de fondo redondo para 72 h. que pasos 3 muestra la forma de las células HUVEC esferoides celulares endoteliales automáticamente en la placa 3D. En 4 pasos, agregar esferoide célula gel diluido. En 5 pasos, agregar la mezcla preparada anteriormente a una placa de la pozo 15. Pasos 6 muestra esferoide brotación en la placa de la pozo 15. Pasos 7 muestran la brotación imagen tomada en un microscopio de luz invertido. Pasos 8 muestra las imágenes cargadas y paso 9 es la imagen de salida de la plataforma (barra = 100 μm). Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 . El efecto de silenciamiento del gen de VHL en la capacidad angiogénica de células HUVEC en el esferoide ensayo de germinación. (A) imágenes representativas de Caño consecuencia después de 12 h en esferoides HUVEC BVS silenciado (A2) y control (A1) (barra = 100 μm). Figuras A3 y A4 mostrar las imágenes analizadas por la plataforma para figuras A1 y A2, respectivamente. Esqueleto de brotes rojo representa, el número de brotes de amarillo, azul el brote estructura final brote blanco y naranja esferoide. (B) longitud de los brotes. Análisis estadístico se realizó utilizando la prueba t de Student impar. * representar P < 0.05. ACONDICIONADO, control; HUVEC, células endoteliales de vena umbilical humana. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Recientemente, varios campos de investigación de la biología vascular fueron estimulados por el estudio del endotelio angiogénicos15. En este artículo, hemos desarrollado un esferoide endotelial brotación técnica como un modelo experimental para estudiar la formación de vasos que origina la pérdida del gen VHL de función en las células endoteliales manipuladas para identificar moléculas de nuevo candidato de la cascada angiogénica. A lo mejor de nuestro conocimiento, éste es el primer informe para examinar los efectos de angiogénico de las células endoteliales modificadas endógena.

Neovascularización del tejido (incluyendo el tejido del tumor) es un proceso complejo que se produce a través de los mecanismos angiogénicos y Vasculogénica durante el desarrollo, así como en ambas condiciones fisiológicas y patológicas12,15 , 16. el esferoide ensayo de germinación se caracteriza por una compleja cascada de eventos17,18, incluyendo la propia agregación de células endoteliales que están incrustados en un 3D matriz cultivo celular, que se traduce en brotación y la reproducción de la red 3D de capilares19. Este modelo esferoide 3D embebido en gel se ha convertido en un sistema ampliamente utilizado en ingeniería de tejidos para el estudio de la formación vascular y sus mecanismos debido a su capacidad para proporcionar un ambiente mejor mímico en una matriz adecuada. Sin embargo, el paso más crucial de este proceso biológico es la activación de células endoteliales quiescentes17,20,21,22. En este procedimiento, las células endoteliales fueron activadas por el silenciamiento endógena del gen VHL, un gen regulador de crecimiento de neovessels23,24. A diferencia de la clásica endotelio iniciación a través de la inducción exógena de la matriz y el ambiente extracelular correspondiente (incluyendo exógenos factores de crecimiento vascular), este método modificado puede ser extendido a numerosos aplicaciones para desentrañar los mecanismos genéticos endógena. A continuación, para disminuir los efectos de la matriz exógena, se optimizó el protocolo diluyendo el gel, que era un simple paso en el experimento. Además, tardó sólo minutos para subir imágenes a la plataforma y obtener resultados del análisis. La plataforma proporciona un servicio de análisis de imagen que permite al experimentador hacer un objetivo, análisis de imagen comparable y automatizado de brotación ensayo imágenes en línea. Por lo tanto, el Protocolo supera la medición y cálculo de errores causados por factores artificiales.

La comprensión mecanicista de los pasos individuales de la cascada de neovascularización proporciona una base racional para el desarrollo del tratamiento vascular que actualmente está siendo aprobado para uso clínico en oncología. Este documento estableció un modelo de análisis basado en el esferoide sencilla y robusta para estudiar la formación de vasos que se origina de las células endoteliales manipuladas con pérdida de función del gen VHL para identificar moléculas de nuevo candidato para la neovascularización cascada, que puede ser utilizado para numerosas aplicaciones relacionadas con la angiogénesis y la vasculogénesis. Los autores especulan que este modelo en vitro puede proporcionar información adicional para ayudar a evaluar el papel de la angiogénesis en algunos tumores sólidos (por ejemplo, la mímica Vasculogénica tumor) e investigar el papel potencial de otras células progenitoras posible generar tumor neovessels en vivo, particularmente en pacientes con tumores que, como grupo, responden al tratamiento con agentes anti-angiogénicos solamente.

El análisis brotes de esferoide se ha convertido en un método ampliamente utilizado para estudiar la angiogenesis y mecanismos relacionados. El ensayo tiene una ventaja importante al proveer un ambiente imitan mejor que las culturas 2D clásicos. Recientemente, han desarrollado modelos 3D cocultivo para el estudio de la angiogénesis tumoral que imita la heterogeneidad y la complejidad de la angiogénesis en el microambiente tumoral del25. En este modelo, las células endoteliales se cultivan directamente con las células cancerosas, así como un componente stromal en un entorno 3D. Además, 3D en vitro los sistemas de cultivo han demostrado para reflejar con mayor precisión la respuesta en vivo a agentes terapéuticos que los sistemas de cultivo celular convencional. Además, este método se utiliza para la diferenciación de las células madre embrionarias, crecimiento del tejido, cicatrización de heridas, isquemia e inflamación. En comparación con el método clásico, nuestro enfoque es eficaz y fácil de implementar. Creemos que es una herramienta útil para el estudio de la angiogénesis en vitro, y se abre una nueva forma de entender este proceso mejor.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Este trabajo fue financiado por becas del Comité de Shanghai de ciencia y tecnología (15411951800, 15410723200). Los autores desean agradecer al Prof. YuMei Wen y Prof. Chao Zhao de la Universidad del Departamento de microorganismo patógenos de Fudan para su asistencia técnica.

Materials

Name Company Catalog Number Comments
human umbilical vein endothelial cell Fudan IBS Cell Center FDCC-HXN180
dulbecco’s modified eagle’s medium  Gibco 11995040
fetal bovine serum Gibco  26400044
PLKO.1-puro vector Addgene #8453
packing plasmid psPAX2  Addgene #12260
envelope plasmid pMD2.G Addgene #12259
3D round-bottom 96-well plates S-Bio MS-9096M
matrigel BD Biosciences 354234
Opti-MEM medium Gibco 31985-070 reduced serum medium 
15-well plate Ibidi 81501 Air bubbles in the gel can be reduced by equilibrating the μ–Slide angiogenesis before usage inside the incubator overnight
endothelial cell growth supplements Sciencell #1052
10-cm culture dish Corning Scipu000813
Puromycin Gibco A1113802
typsin-EDTA Gibco 25200056
Automated Cell Counter System   BioTech
Image Analysis software  Winmasis http://mywim.wimasis.com 

DOWNLOAD MATERIALS LIST

References

  1. Lonser, R. R., et al. von Hippel-Lindau disease. Lancet. 361, (9374), 2059-2067 (2003).
  2. Hussein, M. R. Central nervous system capillary haemangioblastoma: the pathologist's viewpoint. Int J Exp Pathol. 88, (5), 311-324 (2007).
  3. Ma, D., et al. Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche. Carcinogenesis. 32, (1), 102-109 (2011).
  4. Zhuang, Z., et al. Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors. Sci Rep. 4, 4102 (2014).
  5. Glasker, S., et al. VHL-deficient vasculogenesis in hemangioblastoma. Exp Mol Pathol. 96, (2), 162-167 (2014).
  6. Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas. Cancer Res. 55, (6), 1358-1364 (1995).
  7. Cancilla, P. A., Zimmerman, H. M. The fine structure of a cerebellar hemangioblastoma. J Neuropathol Exp Neurol. 24, (4), 621-628 (1965).
  8. Kawamura, J., Garcia, J. H., Kamijyo, Y. Cerebellar hemangioblastoma: histogenesis of stroma cells. Cancer. 31, (6), 1528-1540 (1973).
  9. Jurco, S., et al. Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry. Hum Pathol. 13, (1), 13-18 (1982).
  10. Ma, D., et al. Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas. Cancer Biol Ther. 12, (8), 727-736 (2011).
  11. Ma, D., et al. CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma. Tumour Biol. 37, (3), 3765-3774 (2016).
  12. Sharifpanah, F., Sauer, H. Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis. Methods Mol Biol. 1430, 179-189 (2016).
  13. Cai, H., et al. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma. Oncogene. 36, (3), 318-331 (2017).
  14. Xu, J., et al. Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP. Appl Biochem Biotechnol. 181, (2), 699-709 (2017).
  15. Laib, A. M., et al. Spheroid-based human endothelial cell microvessel formation in vivo. Nat Protoc. 4, (8), 1202-1215 (2009).
  16. D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. Angiogenesis and Vasculogenesis in Health and Disease. Biomed Res Int. 2015, 126582 (2015).
  17. Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model. Cell Prolif. 42, (4), 498-505 (2009).
  18. Morin, K. T., Tranquillo, R. T. In vitro models of angiogenesis and vasculogenesis in fibrin gel. Exp Cell Res. 319, (16), 2409-2417 (2013).
  19. Blacher, S., et al. Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour. PLoS One. 9, (5), 97019 (2014).
  20. Straume, O., et al. Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer. Proc Natl Acad Sci U S A. 109, (22), 8699-8704 (2012).
  21. Naumov, G. N., Akslen, L. A., Folkman, J. Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch. Cell Cycle. 5, (16), 1779-1787 (2006).
  22. Naumov, G. N., Folkman, J., Straume, O. Tumor dormancy due to failure of angiogenesis: role of the microenvironment. Clin Exp Metastasis. 26, (1), 51-60 (2009).
  23. Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice. Mol Carcinog. 56, (10), 2342-2351 (2017).
  24. Stratmann, R., Krieg, M., Haas, R., Plate, K. H. Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene. J Neuropathol Exp Neurol. 56, (11), 1242-1252 (1997).
  25. Correa de Sampaio, P., et al. A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis. PLoS One. 7, (2), 30753 (2012).
Un procedimiento integral para evaluar el rendimiento <em>In Vitro</em> de la neovascularización de Hemangioblastoma putativo con el esferoide brotación ensayo
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).More

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter