Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Cancer Research

Sözde Hemangioblastoma tahlil çimlenme küresel kullanarak neovaskülarizasyon Vitro performansını değerlendirmek için kapsamlı bir yordam

doi: 10.3791/57183 Published: April 12, 2018

Summary

Bu kağıt vitro hemangioblastomas (HBs) ve HBs rolü klasik tümör angiogenez bulunmaktadır olup olmadığını değerlendirmek için kapsamlı bir yordam sunar. Sonuçları HB-neovaskülarizasyon karmaşıklığı vurgulamak ve bu sık görülen angiogenez HB neovaskülarizasyon sadece tamamlayıcı bir mekanizma olduğunu göstermektedir.

Abstract

Von Hippel-Lindau (VHL) Tümör baskılayıcı gen inactivation insan merkezi sinir sistemi (MSS) içinde hemangioblastomas (HBs) gelişiminde önemli bir rol oynar. Ancak, saytolojik kökeni ve (neovaskülarizasyon dahil) HBs evrimsel süreci tartışmalı kalır ve anti-angiogenez VHL-HBs, klasik HB angiogenez üzerinde dayalı için klinik çalışmalarda hayal kırıklığı yaratan sonuçlar doğurmuştur. Anti-damar tedavi başarılı klinik çevrilmesi için bir diğer önemli engel vasküler Bu tümör neovaskülarizasyon kapsamlı bir anlayış eksikliğidir. Bu makalede, biz vitro HBs yanı sıra HBs rolü klasik tümör angiogenez bulunmaktadır olup olmadığını değerlendirmek için kapsamlı bir yordam mevcut. Bu yordamla, araştırmacılar doğru HB neovaskülarizasyon karmaşıklığı anlamak ve bu sık görülen HBs angiogenez işlevini tanımlamak. Bu protokoller tümörleri tedavi anti-anjiogenik tedavi HBs için optimizasyon gelecekte çevirileri yardım için veya yüksek çevirim potansiyele sahip en umut verici Anti-damar tedavi tümör, değerlendirmek için kullanılabilir. Sonuçlar HB neovaskülarizasyon karmaşıklığı vurgulamak ve bu ortak form angiogenez HB neovaskülarizasyon sadece tamamlayıcı bir mekanizma olduğunu göstermektedir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hemangioblastomas (HBs) sadece insan sinir sistemi içinde (CNS) bulunan iyi huylu damar tümör vardır. Onlar von Hippel-Lindau (VHL) hastalığı veya sporadik lezyonlar olan hastalarda geliştirmek. VHL-HBs sık nüks nedeniyle cerrahi tedavi ile tedavi etmek zordur ve bu genetik neden çoklu lezyonlar1bozukluk. Ne kadar VHL Tümör baskılayıcı gen inactivation VHL-HBs tumorigenesis kök neden olarak, saytolojik kökeni (neovaskülarizasyon dahil olmak üzere) ve HBs evrimsel süreci büyük ölçüde tartışmalı2kalır. Bu nedenle, HB-neovasküler biyolojik mekanizmaları daha iyi anlaşılmasını VHL-HBs için en umut verici Anti-vasküler stratejileri içine yararlı anlayışlar sağlayabilir.

Son araştırmalar HB-neovaskülarizasyon embryologic vasculogenesis3,4,5' e benzer olduğunu ileri sürdü. Klasik vasküler endotelyal büyüme faktörü (VEGF)-vasküler endotel kökenli ve fonksiyon kaybı VHL tarafından tahrik aracılı angiogenez sonuçlandı içinde yayılması ve olmuştur neovasküler oluşumu meydan6. 1965 yılında, Cancilla ve bulundu, Zimmerman elektron mikroskobu, HBs7endotel kökenli kullanarak. Daha sonra stromal hücreler vasoformative öğesi8' den türetilen bulundu. 1982 yılında, Jurco ve ark. stromal hücreler endotel kökenli9olduğunu buldum. Bu nedenle, biz insan vasküler endotel hücreleri HB-neovaskülarizasyon10orijinal hücrelerdir onaylanmadığına karar. VHL hasta ameliyat elde edilen HB hücrelerden birincil kültürler kullanmak daha iyi olsa da, önceki araştırma birincil kültürler HB kararlı değil ve hücre hatları kurulan3olamazdı göstermiştir. Ayrıca, HB-vasküler malzemeler10,11ataları içerdiğinden 3D çevre birincil kültürlerde HB-neovaskülarizasyon saytolojik kökeni teşhis değil. Bu nedenle, endotel hücrelerinin ilkel ve klasik model olarak insan vasküler endotel hücreleri (HUVEC) HBs için alternatif bir hücresel model hizmet verebilir.

Küresel çimlenme tahlil doku Mühendisliği12,13' te yeni bir modeldir. Bu yazıda, tahlil çimlenme küresel kullanarak 3D coculture kollajen tabanlı sistem vitro ile klasik tümör angiogenez HBs yanı sıra HBs rolü var olup olmadığını değerlendirmek için genel bir amacı da geliştirilmiştir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu yöntem onaylı yönergeleri ve araştırma Etik Komitesi, Huashan Hastanesi, Bund'a Üniversitesi düzenlemelere uygun şekilde gerçekleştirildi. Karşılık gelen standart güvenlik önlemleri her adımda takip edildi. Şematik bir sunu için şekil 1' e bakınız.

1. hücre kültür ve plazmid yapı

  1. Rutin olarak Dulbecco içinde insan göbek damar endotel hücre (HUVEC) kartal orta (DMEM) ile % 10 fetal sığır serum (FBS), 100 birim/mL penisilin ve streptomisin oksijen %5 100 µg/mL takıma değiştiren'ın korumak CO2 kuluçka 37 ° C'de
  2. ShRNA parçası sentezi için Özet PLKO.1 plazmid ile APAI ve EcoRI. Oligonükleotid serisini VHL shRNA vektör CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14olduğundan emin olun.
  3. Sonra 20 µΜ sistem oligo, ters oligo 5 µL, 10 NF'leri arabellek x 5 µL ve (Toplam 50 µL birimdir) GKD2O birlikte 35 µL ileri 5 µL ile karıştırın. 4 dk ve yavaş yavaş aşağı oda sıcaklığına serin için 98 ° C'de karışımı bir kaç saat içinde ısı.
  4. Tavlanmış oligos ve PLKO.1 plazmid T4 ligaz 4 ° C'de birlikte gece için ligate. 16 h sonra 5 µL 25 µL yetkili DH5α hücrelere ligasyonu karışımı ekleyin. Sonra başarıyla ve birleştirilmiş plazmid ekran ve sıralama tarafından eklenen parça doğrulayın.

2. lentivirus paket ve enfeksiyon

  1. Toplamda, PLKO.1-shVHL veya PLKO.1-shScramble vektör 10 µg, plazmid psPAX2 ambalaj 7.5 µg ve zarf plazmid pMD2.G 500 µL fetal sığır serum (FBS) 25 min için olmadan DMEM medyanın içinde 2,5 µg karıştırın.
  2. 7 mLDMEM FBS olmadan yukarıda hazırlanan çözüm ekleyin.
  3. Kültür 293FT 10 cm çapında doku kültürü yemekleri FBS olmadan DMEM hücrelerde. 293 FT hücreleri hücre sayaç 1 x 107 olduğundan emin olun.
  4. Yukarıda transfection için 293 FT hücreleri Orta olarak hazırlanan çözeltinin 1 mL ekleyin.
    Not: 293FT hücre kültürünü 293F hücre satırından türetilir ve stabil SV40 büyük T antijen ifade eder. Bu nedenle, lentiviral üretim için uygun bir ev sahipliği yapmaktadır.
  5. % 10 içeren DMEM ile Kültür orta yerine FBS 6 h sonra.
  6. Bir pipet 48 h transfection sonra medya toplamak.
    Not: % 10 içeren DMEM virüs var FBS. Ortamdaki ölü hücreleri float. Steril 0,45 µm membran ölü hücreleri ve kirleri filtre uygulamak için kullanın. Genel olarak, enfeksiyon (MOI) çokluğu denetlemek için gerek yoktur. Bu bir istikrarlı hücreleri çizgi oluşturmaktır. Son adımda, başarılı enfeksiyonu olmadan tüm canlı hücreler tarafından puromisindir ölecek. ShScramble grup ve HUVEC hücreleri kontrol grubu vardır. Tüm HUVEC hücreleri 72 h tarafından kullanılan puromisindir konsantrasyon ile ölmek emin olun. Her şey aynı sayıda hücre vardır.
  7. Lentiviral medya için 72 h HUVEC hücrelerde kültür. Daha sonra puromisindir HUVEC hücre 2 µg/mL 24 h kullanım HUVEC hücreleri kontrol grubu olarak herhangi bir tedavi için bir konsantrasyon, medya ekleyin. Tüm bu zamana kadar hücreleri die kontrol emin olun.
    Not: Canlı hücreler VHL devirme hücreleri ve shSramble hücreleri istikrarlı hücre kültürünü temsil eder. Kaplama 5.000/96-şey levha iyi yoğunluğudur.

3. nesil endotel hücre pulcuklarının

  1. HUVECs hücre trypsinize ve % 10 DMEM orta resuspend FBS. Hücre 10 cm kültür tabak içinde ılımlı sayısı ile 1 mL typsin-EDTA ekleyin.
  2. 1 × 103 hücreleri/iyi bir hücre yoğunluğuna, 3D bir yuvarlak alt 96-şey plaka hücrelerde tohum. Küresel askıya almak için 0.50 µL küresel ağırlayacak iyi kullanın. Üreticinin yönergelerini izleyerek bir hücre sayaç sistemi kullanarak hücreleri saymak.
  3. 37 ° C ve 72 h için sürekli olarak % 5 CO2 hücreleri kuluçkaya. Bu koşullar altında askıya alınan hücrelerin hücre pulcuklarının otomatik olarak oluşturmak emin olun. Kültür orta yarısı 36 h sonra değiştirin.

4. vitro angiogenez tahlil

  1. Jel çözüm 4 ° C'de erimek ve ile indirimli serum orta seyreltme oranı 1:5 oranında seyreltin.
  2. Bir micropipette ile DMEM kültür ortamdan pulcuklarının emmek. Yıkandıktan sonra düşük serum orta 5 mL ile pulcuklarının askıya pulcuklarının yavaşça ve dikkatli seyreltilmiş jel. Hava hava kabarcığı yok olduğundan emin olun.
  3. Karışık sıvı 300 µL bir 15-şey tabak içinde embed. 37 ° C ve 1 h için % 5 CO2 kuluçka sonra 400 µL düşük serum orta her şey için ekleyin. Buharlaşma engellemek için oksijen bir ortam oluşturmak için kuyu etrafında steril su doldurun.
  4. Bundan sonra kültür plaka 37 ° c için 1 h %100 nem oranı, % 5 CO2 .
  5. Dikkatle eski orta Aspire edin ve düşük serum orta % 1 endotel hücre büyüme takviyeleri her iyi ile 600 µL tarafından değiştirin.
  6. 12 saat veya 24 saat sonra bir ters ışık mikroskobu altında görüntü almak (40 *).

5. veri analizi

  1. Filiz uzunluğu veri (Tablo reçetesi) elde etmek için çevrimiçi görüntü analiz platformu için resim yüklemek.
  2. Web sayfasında, e-posta ile bir hesap oluşturun.
  3. O zaman Resim Yükle düğmesini tıklatarak yüklemek.
  4. Sonuç karşıdan yükle düğmesini tıklatarak karşıdan yükleyin.
    Not: Yazılım işlenmiş görüntü ve veri oluşturur. Beş bölümden verileri içeren: toplu Filiz uzunluğu, ortalama Filiz uzunluğu, Filiz uzunluğu, Filiz alanı ve küresel alan standart sapması. İşlenmiş görüntüde her parametre tanımlama işlenen görüntünün içinde kolaylaştırmak için farklı bir renkte ana hatlarıyla: kırmızı temsil lahanası iskelet, lahanası sayısı sarı, Filiz yapısı, beyaz Filiz end ve turuncu küresel mavi.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Orijinal görüntüleri ters ışık mikroskobu tarafından alınır. Kontrol grubu ve VHL grup tipik görüntüleri Şekil 2' deki-A1 ve Şekil 2-A2. Kontrol grubu çimlenme uzunluğu VHL grup kısadır.

Görüntüleri yükledikten sonra online platformu doğrudan çözümleme sonuçlarını sağlar. Çıktı iki bölümden oluşur: işlenmiş görüntü ve karşılık gelen analiz sonuçları. Kontrol grubu ve VHL gene sessizlik grup işlenmiş görüntüleri farklı renklerle işaretlenir (Şekil 2-A3 ve Şekil 2-A4). Ortalama Filiz uzunluğu 65 µm ve kontrol grubu ve VHL sessizlik grup 125 µm sırasıyla ise ortalama toplu Filiz uzunluğu 680 µm ve 1250 µm kontrol grubu ve VHL sessizlik grubunda, sırasıyla, uzunluğu artar Filiz gösteren VHL sessizlik grubunda (Şekil 2B) kontrol grubu ile karşılaştırıldığında yaklaşık iki pas geçiyor. Bu sonuçları, VHL eksikliği insan endotel hücrelerinin damar şekillendirme yeteneği teşvik gösterir.

Figure 1
Resim 1 . Tahlil çimlenme küresel şemasını. Adımları 1 gösterir bir tabak HUVEC hücreler kültürlü. Adım 2'de, HUVEC hücreleri 3D tur-alt 96-şey plakalar için 72 h. ile 3 arasındaki adımları HUVEC hücreleri form endotel hücre pulcuklarının gösterir otomatik olarak 3D tabak içinde taşınır. Adım 4'te, hücre küresel seyreltilmiş jöleye ekleyin. Adım 5'te yukarıda 15-şey plaka için hazırlanan karışımı ekleyin. Adımları 6 15-şey plaka küresel çimlenme gösterir. Adımlar 7 ters bir ışık mikroskobunda alınan çimlenme görüntü gösterir. Adımları 8 gösterir karşıya yüklenen görüntü ve adım 9 çıkış görüntü platformu (çubuk = 100 µm). Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2 . Tahlil çimlenme küresel HUVEC hücrelerinin anjiogenik yeteneği üzerinde gen VHL damping etkisi. (A) kontrolü (A1) ve VHL susturdu HUVEC pulcuklarının (A2) 12 h sonra emzik akıbet temsilcisi görüntüleri (çubuk = 100 µm). Rakamlar A3 ve A4 platformu tarafından rakamlar A1 ve A2, sırasıyla analiz resimleri göster. Kırmızı temsil lahanası iskelet, lahanası sayısı sarı, Filiz yapısı, beyaz Filiz end ve turuncu küresel mavi. (B) lahanası uzunluğu. İstatistiksel analiz unpaired bir öğrenci t-testi kullanılarak gerçekleştirildi. * temsil P < 0,05. CON, Denetim; HUVEC, insan göbek damar endotel hücre. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Son zamanlarda, birden çok alanı vasküler Biyoloji Araştırma anjiogenik endotel15çalışma tarafından teşvik. Bu makalede, geliştirdiğimiz bir endotel küresel roman aday molekülleri tanımlamak için işlenmiş endotel hücrelerindeki fonksiyon kaybı VHL Gene'in kaynaklandığı damar oluşumu çalışmaya deneysel bir model olarak teknik çimlenme anjiogenik cascade. Bizim bilgi en iyi şekilde endogenic değiştirilmiş endotel hücreleri anjiogenik etkilerini incelemek için ilk rapor bu.

(Tümör doku dahil) doku neovaskülarizasyon anjiogenik ve vasculogenic mekanizmaları yoluyla geliştirme sırasında hem de her iki fizyolojik ve patolojik koşulları12,15 dakika sonra oluşan karmaşık bir süreçtir , 16. tahlil çimlenme küresel olaylar17,18çimlenme içinde sonuçları bir matris 3D hücre kültür sistemi içinde gömülü endotel hücre kendini toplama dahil, karmaşık bir çağlayan ile karakterizedir ve kılcal193D ağ çoğaltılması. Bu jel gömülü 3D küresel model damar oluşumu ve onun mekanizmaları uygun bir matris daha iyi taklit eden bir ortamda sağlamak yeteneği nedeniyle çalışmak için doku mühendisliğinde yaygın olarak kullanılan bir sistem haline gelmiştir. Bu biyolojik sürecin en önemli adım deneniyor endotel hücreleri17,20,21,22aktivasyonu be. Bu yordam, endotel hücreleri VHL gen bir düzenleyici büyüme gen neovessels23,24endogenic susturmak tarafından etkinleştirildi. Farklı klasik endotel inisiyasyon yoluyla eksojen indüksiyon matrix ve ilgili ekstraselüler çevre (dahil eksojen vasküler büyüme faktörü), değiştirilen bu yöntem için çok sayıda uzatılabilir endogenic genetik mekanizmaları çözülmeye uygulamaları. Daha sonra eksojen matris etkilerini azaltmak için protokol deneyinde basit bir adımdı jel sulandrarak optimize edildi. Buna ek olarak, yalnızca platforma resim yüklemek için ve analiz sonuçları elde etmek için dakika sürdü. Platform bir amaç, tahlil görüntüleri online çimlenme karşılaştırılabilir ve otomatik görüntü analizi yapmak deneyci bir görüntü analiz hizmeti sağlar. Bu nedenle, protokol insan yapımı faktörlerden kaynaklanan ölçüm ve hesaplama hataları üstesinden gelir.

Neovaskülarizasyon cascade bireysel adımlardan mekanik anlayışı Onkoloji klinik uygulamada için şu anda onaylandıktan Anti-damar tedavisi geliştirilmesi için rasyonel bir temel oluşturdu. Bu kağıt roman aday molekülleri neovaskülarizasyon için tanımlamak için VHL gen fonksiyon kaybı ile işlenmiş endotel hücreleri kaynaklandığı damar oluşumu çalışmaya basit ve sağlam küresel tabanlı tahlil manken kurulan cascade, hangi-ebilmek var kullanmak için çeşitli anjiogenez ve vasculogenesis ile ilgili uygulamalar. Yazarlar bu vitro modeli rolü angiogenez bazı solid tümör (örneğin, tümör vasculogenic taklit) içinde değerlendirmek ve diğer olası progenitör hücre potansiyel rolleri araştırmak yardımcı olacak ek bilgiler sağlayabilir spekülasyon Özellikle, bir grup olarak yalnızca anti-anjiogenik aracıları ile tedaviye yanıt vermeyen tümörler olan hastalarda tümör neovessels vivo içindeoluşturmak için.

Küresel çimlenme tahlil anjiogenez ve ilgili mekanizmaları incelemek için yaygın olarak kullanılan bir yöntem haline gelmiştir. Tahlil Klasik 2D kültürleri daha daha iyi bir taklit ortam sağlayarak önemli bir avantaja sahiptir. Son zamanlarda, 3D ortak kültür modelleri karmaşıklığını anjiogenez tümör microenvironment25içinde ve heterojenlik taklit eden tümör angiogenez incelemek için geliştirilmiştir. Bu modelde, endotel hücreleri kanser hücrelerinin yanı sıra 3D ortamda stromal bir bileşeni ile doğrudan kültürlü. Buna ek olarak, 3D vitro kültür sistemleri vivo içinde yanıt-e doğru geleneksel hücre kültür sistemleri daha terapötik ajanlar daha doğru yansıtacak biçimde gösterilmiştir. Buna ek olarak, bu yöntem embriyonik kök hücre, doku büyüme, yara iyileşmesi, iskemi ve inflamasyon farklılaşma için kullanılır. Klasik yöntem ile karşılaştırıldığında, bizim etkili ve uygulanması kolay bir yaklaşımdır. İnanıyoruz angiogenez vitroçalışma için yararlı bir araçtır ve bu süreci daha iyi anlamak için yeni bir yol açar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Bu eser hibe Shanghai komite bilim ve Teknoloji (15411951800, 15410723200) tarafından desteklenmiştir. Yazarlar Prof. YuMei Wen ve Prof. Chao Zhao patojen mikroorganizma bölümü Bund'a Üniversitesi Teknik yardım için teşekkür etmek istiyorum.

Materials

Name Company Catalog Number Comments
human umbilical vein endothelial cell Fudan IBS Cell Center FDCC-HXN180
dulbecco’s modified eagle’s medium  Gibco 11995040
fetal bovine serum Gibco  26400044
PLKO.1-puro vector Addgene #8453
packing plasmid psPAX2  Addgene #12260
envelope plasmid pMD2.G Addgene #12259
3D round-bottom 96-well plates S-Bio MS-9096M
matrigel BD Biosciences 354234
Opti-MEM medium Gibco 31985-070 reduced serum medium 
15-well plate Ibidi 81501 Air bubbles in the gel can be reduced by equilibrating the μ–Slide angiogenesis before usage inside the incubator overnight
endothelial cell growth supplements Sciencell #1052
10-cm culture dish Corning Scipu000813
Puromycin Gibco A1113802
typsin-EDTA Gibco 25200056
Automated Cell Counter System   BioTech
Image Analysis software  Winmasis http://mywim.wimasis.com 

DOWNLOAD MATERIALS LIST

References

  1. Lonser, R. R., et al. von Hippel-Lindau disease. Lancet. 361, (9374), 2059-2067 (2003).
  2. Hussein, M. R. Central nervous system capillary haemangioblastoma: the pathologist's viewpoint. Int J Exp Pathol. 88, (5), 311-324 (2007).
  3. Ma, D., et al. Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche. Carcinogenesis. 32, (1), 102-109 (2011).
  4. Zhuang, Z., et al. Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors. Sci Rep. 4, 4102 (2014).
  5. Glasker, S., et al. VHL-deficient vasculogenesis in hemangioblastoma. Exp Mol Pathol. 96, (2), 162-167 (2014).
  6. Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas. Cancer Res. 55, (6), 1358-1364 (1995).
  7. Cancilla, P. A., Zimmerman, H. M. The fine structure of a cerebellar hemangioblastoma. J Neuropathol Exp Neurol. 24, (4), 621-628 (1965).
  8. Kawamura, J., Garcia, J. H., Kamijyo, Y. Cerebellar hemangioblastoma: histogenesis of stroma cells. Cancer. 31, (6), 1528-1540 (1973).
  9. Jurco, S., et al. Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry. Hum Pathol. 13, (1), 13-18 (1982).
  10. Ma, D., et al. Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas. Cancer Biol Ther. 12, (8), 727-736 (2011).
  11. Ma, D., et al. CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma. Tumour Biol. 37, (3), 3765-3774 (2016).
  12. Sharifpanah, F., Sauer, H. Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis. Methods Mol Biol. 1430, 179-189 (2016).
  13. Cai, H., et al. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma. Oncogene. 36, (3), 318-331 (2017).
  14. Xu, J., et al. Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP. Appl Biochem Biotechnol. 181, (2), 699-709 (2017).
  15. Laib, A. M., et al. Spheroid-based human endothelial cell microvessel formation in vivo. Nat Protoc. 4, (8), 1202-1215 (2009).
  16. D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. Angiogenesis and Vasculogenesis in Health and Disease. Biomed Res Int. 2015, 126582 (2015).
  17. Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model. Cell Prolif. 42, (4), 498-505 (2009).
  18. Morin, K. T., Tranquillo, R. T. In vitro models of angiogenesis and vasculogenesis in fibrin gel. Exp Cell Res. 319, (16), 2409-2417 (2013).
  19. Blacher, S., et al. Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour. PLoS One. 9, (5), 97019 (2014).
  20. Straume, O., et al. Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer. Proc Natl Acad Sci U S A. 109, (22), 8699-8704 (2012).
  21. Naumov, G. N., Akslen, L. A., Folkman, J. Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch. Cell Cycle. 5, (16), 1779-1787 (2006).
  22. Naumov, G. N., Folkman, J., Straume, O. Tumor dormancy due to failure of angiogenesis: role of the microenvironment. Clin Exp Metastasis. 26, (1), 51-60 (2009).
  23. Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice. Mol Carcinog. 56, (10), 2342-2351 (2017).
  24. Stratmann, R., Krieg, M., Haas, R., Plate, K. H. Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene. J Neuropathol Exp Neurol. 56, (11), 1242-1252 (1997).
  25. Correa de Sampaio, P., et al. A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis. PLoS One. 7, (2), 30753 (2012).
Sözde Hemangioblastoma tahlil çimlenme küresel kullanarak neovaskülarizasyon <em>Vitro</em> performansını değerlendirmek için kapsamlı bir yordam
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).More

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter