Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

שיבוש גנטי יעילים ביותר מאתר ואנושי Hematopoietic ובתאים מאת CRISPR/Cas9

doi: 10.3791/57278 Published: April 10, 2018
* These authors contributed equally

Summary

עבור פרוטוקול מהיר CRISPR/Cas9-מתווכת ' שיבוש גנטי עכבר, התאים hematopoietic העיקרי של האדם מתואר במאמר זה. Cas9-sgRNA ribonucleoproteins הם הציגו ויה אלקטרופורציה עם sgRNAs שנוצר דרך במבחנה שעתוק ו Cas9 מסחרי. יעילות העריכה גבוהה מושגות עם זמן מוגבל ועלות פיננסיים.

Abstract

ההתקדמות בתחום תאי הגזע hematopoietic (HSCs) יש בגילויים על ידי שיטות להנדס גנטית ובתאים הראשי, כמו גם מודלים בעלי חיים. אבלציה ג'ין מלאה ב- HSCs הנדרש הדור של עכברים knockout שממנו HSCs יכול להיות מבודדים, ואת ג'ין אבלציה ב ראשי HSCs האנושית איננה אפשרית. התמרה חושית ויראלי יכול לשמש עבור גישות דפיקה למטה, אך אלה סבלה היעילות משתנה. מניפולציה כללי, הגנטי של האדם, תאים hematopoietic העכבר היה הקשו על ידי יעילות נמוכה ובזמן נרחב, עלות התחייבויות. לאחרונה, CRISPR/Cas9 התרחב באופן דרמטי את היכולת מהנדס ה-DNA של תאי יונקים. עם זאת, היישום של CRISPR/Cas9 לתאים hematopoietic מאתגרת, בעיקר בשל היעילות שלהם נמוכה תרביות תאים, הרעילות של גישות פלסמיד וזמן הטיפול האיטי של פרוטוקולים מבוססי וירוס.

שיטה מהירה לביצוע ג'ין CRISPR/Cas9-מתווכת ' עריכת גזע hematopoietic מאתר ואנושי, קדמון התאים בעזרת נוקאאוט יעילות של עד 90% מסופק במאמר זה. גישה זו מנצל אסטרטגיה משלוח ribonucleoprotein (RNP) עם זרימת עבודה יעילה של שלושה ימים. השימוש Cas9-sgRNA RNP מאפשר גישה פגע וברח, היכרות עם רצפי DNA אקסוגני אין הגנום של תאים הערוך והפחתת תופעות את המטרה. השיטה מבוססת-RNP היא מהירה וישירה: שהוא אינו מצריך שיבוט של sgRNAs, וירוס הכנה או שינוי כימי sgRNA ספציפיים. עם פרוטוקול זה, מדענים צריכים להיות מסוגלים להפיק בהצלחה הסתרה של גנים עניין בתאים hematopoietic העיקרי בתוך שבוע, כולל downtimes של סינתזה oligonucleotide. גישה זו תאפשר יותר רחבה קבוצת משתמשים להתאים פרוטוקול זה לצרכים שלהם.

Introduction

כניסתו של CRISPR/Cas9 באופן קיצוני פישטה את ג'ין עריכה בתאים בתרבית. פרוטוקולים CRISPR/Cas9 מוקדם מנוצל פלסמיד או מבוסס-וירוס משלוח של Cas9 חלבון ו sgRNA1,2,3. גישות אלה הוכיחו מהפכני לפיתוח של דגמי הסלולר ובעלי חיים, הוחלו גם בהצלחה על ראשי hematopoietic גזע, קדמון תאים (HSPCs)4,5. עם זאת, שיטות אלה יש מספר חסרונות. ראשית, יעילות שיבוש גנטי נשאר לעיתים קרובות מתחת4,50%5. אמנם זה מספיק ליצירת שיבוטים נוקאאוט (KO) בשורות תאים, הצורך של תרבות לטווח קצר הופך HSPCs לא נוטה? אסטרטגיה כזו. שנית, הדרישה שיבוט מגביל את כמות sgRNAs זה יכול להיבדק בניסויים יחיד ויוצרת גדולה, שקשה transfect בונה. שלישית, גישות אלה בכוח מדענים להאט ולוחות זמנים.

כדי להתגבר על מגבלות אלה, הקבוצה שלנו פיתחה ופורסם לאחרונה בגישה אלטרנטיבית CRISPR/Cas9 ב HSPCs באמצעות Cas9-sgRNA ribonucleoproteins (RNPs)-המבוסס על משלוח6. באסטרטגיה זו, המרכיבים הגולמיים של CRISPR (Cas9 חלבון ו במבחנה עיבד sgRNA) הם טרום-ומורכבת וסגורה ישירות לתוך תאי היעד באמצעות אלקטרופורציה (איור 1). זמן מחצית החיים של המתחם RNP Cas9-sgRNA הוא יותר קצר יותר מהזמן הזה פלסמיד או חומצת גרעין ויראלי הוא עיבד, הקצב את המטרה נמוכה לעומת גישות מוקדם7. יתר על כן, הגישה RNP מוסיף את היתרון של ביטול כל מקור ה-DNA אקסוגני, אשר יכול להשתלב באופן אקראי הגנום בתא היעד המוביל לשינוי הסלולר.

פרוטוקול זה מבוסס על תהליך עבודה יעיל לניסויים הפרעה ג'ין מבוסס-RNP, כפי שמוצג באיור1. הצעד הראשון הוא עיצוב וסידור צבעי יסוד כל sgRNA. צבעי יסוד אלה מנוצלים כדי להפוך את תבניות DNA sgRNA המשמשים עבור במבחנה שעתוק (IVT) כדי לקבל את sgRNAs. SgRNAs מטוהרים מודגרת ואז עם חלבון Cas9 שנרכש קודם לכן, כדי מתחמי RNP טופס Cas9-sgRNA. לבסוף, RNPs Cas9-sgRNA טרום-ומורכבת הם electroporated לתוך התאים. בעקבות אלקטרופורציה, עריכת יעילות יכול להיבדק, במבחנה/ ניסוייםויוו ניתן להתחיל, בהתאם לצרכים. להלן תיאור מפורט של גישה חדשנית זו ניסיוני יכול להימצא.

Protocol

הפרוטוקול עוקב אחר הקווים המנחים של ועדת האתיקה האנושית ביילור לרפואה. כל ההליכים ניסיוני המבוצעת על עכברים המאושרים על ידי ביילור המכללה של רפואה מוסדיים חיה טיפול והוועדה שימוש.

1. sgRNA Fwd עיצוב

  1. נווט אל http://www.crisprscan.org/?page=track8 כדי להתחיל בעיצוב sgRNAs עניין.
  2. לחץ על "העכבר" או "אנושי" לחצן בהתאם לסוג התא עניין.
  3. הזן את הגן עניין בתיבת החיפוש UCSC ' ולחץ על ' ללכת '.
  4. התקרבות ולעבור לאזור של הגן (כלומר. אקסון ספציפי) זה עניין למטרה.
    הערה: כדי להשיג שיבוש גנטי יעיל שמומלץ מיקוד מציגים exon(s) המוקדם כל איזופורמים משועתקים בסוג התא הספציפי שלך.
  5. להבטיח כי הרצפים יעד פוטנציאליים sgRNA מפורטים תחת "תחזיות CRISPRscan את הגנים (תקליטורים)" כותרת.
  6. למצוא ולחץ על רצף המטרה עם ניקוד גבוה יחסית מעט חופש- מטרות (מודגשים בירוק בהיר). העתקת את הרצף המלא מוצג תחת הסעיף "Oligo רצף" והדבקתו למסמך טקסט. להוסיף "ATAGC" 3' בסוף הרצף. עם סיום, מקם את סדר רצף באורך מלא.
    הערה: עבור כל רצף המטרה, CRISPRscan8 מספק של פריימר "משולב" sgRNA קדמי הכולל ייצוג המקדם T7, הרצף protospacer (יעד), ואודות הרצף חפיפה לגרדום אוניברסלי (ראה איור 1 א'). רצף באורך מלא עשוי נוקלאוטידים או 56 או 57 בהתאם לאורך protospacer.

2. sgRNA לסינתזת DNA תבנית

  1. ו לדלל את sgRNA Fwd ו פריימר Rev אוניברסלי (ראה טבלה 1 את הרצף השלם). על מנת לקבל ריכוז סופי 10 מיקרומטר, מלא את ההוראות היצרן על איך לדלל צבעי בסיס 100 מיקרומטר, ולאחר מכן להפוך 1:10 דילול עם מים ללא נוקלאז.
  2. כדי לבצע חפיפה PCR (ראה איור 1B), לערבב הפעולות הבאות ברצועת המבחנות: פריימר לפנים sgRNA ' µL 2 ' (10 מיקרומטר), µL 2 לגרדום Rev אוניברסלי פריימר (hplc, קורס מטוהרים) (10 מיקרומטר), 10 µL (2x) מיקס מאסטר DNA פולימראז High fidelity ומים 6 µL נוקלאז-חופשית.
  3. להפעיל את ה-PCR עם התוכנית הבאה: 95 מעלות צלזיוס למשך 3 דקות, 98 ° C 5 s, 60 ° C 5 s, 72 מעלות צלזיוס במשך 10 s, ללכת ל- 2 על 6 מחזורים, 72 ° C עבור 1 דקות, 4 ° C לנצח.
  4. לטהר את מוצר ה-PCR באמצעות עמודות טיהור DNA (ראה טבלה של חומרים). בצע הוראות יצרן, elute עם µL 11.5 • תנאי המאגר.
  5. מודדים את ריכוז המוצרים PCR על ספקטרופוטומטרים. בלנק את המכשיר עם מאגר • תנאי.
    הערה: ריכוז הדנ א צריך להיות בין ~ 50 ו ~ 120 ng/µL.

3. במבחנה שעתוק של sgRNA

  1. לערבב את המרכיבים הבאים ברצועת המבחנות (ריאגנטים ניתנים בערכה סינתזה RNA): 4 µL של eluted DNA, 4 µL של dNTPs, µL 1 של 10 x תגובת מאגר µL 1 של T7 RNA פולימראז אנזים מיקס.
  2. דגירה בדגימות ב 37 מעלות צלזיוס במשך לפחות 4 שעות.
  3. להחיל את הסוכן RNase ניקוי להסיר RNase ידיים בכפפות.
  4. להביא כל מדגם ה-RNA עד הנפח הכולל של 50 µL במים נטולי נוקלאז (צעד ראשון של RNA טיהור בעקבות הוראות יצרן).
  5. המשך בטהרה RNA בעקבות הוראות יצרן, elute ב µL 50 שסופק על-ידי ערכת נוקלאז ללא מים.
  6. מודדים את ריכוז sgRNA eluted ב ספקטרופוטומטרים. בלנק את המכשיר עם מים ללא נוקלאז.
    הערה: התשואה הצפויה לאחר טיהור הוא 50-80 µg של RNA (כלומר ריכוז של 1.0-1.5 µg/µL).
  7. להשתמש את sgRNA מטוהרת באופן מיידי או לאחסן aliquots של 2-4 µL ב-80 מעלות צלזיוס לטווח הארוך.

4. HSPC בידוד ותרבות

  1. בידוד HSPCs מאתר ותרבות
    הערה: זכריים ונקביים Ubc-GFP עכברים (JAX004353) Rosa26-LSL-tdTomato (JAX007914) חצה עם ו- iCre (JAX008610)-2-6 חודשים של גיל שימשו כדי להשיג את התוצאות המוצגות להלן.
    1. המתת חסד ומורדמת עכברים דרך נקע בצוואר הרחם.
      הערה: שני אנשים מאומנים לוודא באופן עצמאי המתת חסד מוצלחת מאת וציין את חוסר נשימה, פעימות לפחות 5 דק להסיר את העור החיות.
    2. לנתח tibias, עצמות הירך ו- iliac crests של עכברים ולהסיר כל שריר, רקמת חיבור סביב העצמות גזור. מקום עצמות בשלמותם לתוך תבשיל תרביות רקמה על הקרח עם HBSS בתוספת 2% FBS (HBSS +). להעביר תא למינארי ברגע al העצמות לנקות והעבירו למנה תרביות רקמה.
    3. העברת ניקה עצמות כדי מרגמה סטרילי, המכיל 2 מ"ל HBSS קפואים + לכל 3 עצמות. באמצעות איחדו את, לרסק עצמות לתוך העצם שברים, שחרור מח מ בתוך. המשך pestling עד העצמות תפסיק קורסת תחת איחדו.
    4. לאסוף תגובת שיקוע מכתש ועלי מסנן לתוך צינור חרוטי 50-mL באמצעות מסננת תא 40 מיקרומטר. לשטוף את רסיסי עצם, 5 מ ל קרה כקרח HBSS + ו מסנן לאמבטיה אותו 50 מ ל חרוט באמצעות מסננת אותו את 40 µm.
    5. לשטוף את התאים פעמיים על ידי ציפוי את הצינור עם קרח HBSS + צריך שתוציאו ב 400 x g עבור 7 מינימלית להשליך תגובת שיקוע.
    6. בעקבות לשטוף את השני resuspend בגדר תא ב- 20 מ של PBS קר קרח. ספירת התאים קיימא מאת הדרה trypan-כחול9.
    7. דגירה עונה 1 פרק 108 התאים קיימא לכל 1 מ ל HBSS קפואים + עם נוגדן c-kit מצומדת ביוטין-מטריים דילול למשך 45 דקות על קרח.
    8. לשטוף את התאים עם קרח HBSS + מאת צריך שתוציאו ב 400 g x עבור 7 דקות ומחיקת את תגובת שיקוע.
    9. דגירה התאים עם אנטי ביוטין beads מגנטי בעקבות הוראות יצרן.
    10. לבודד תאים חיובי c-kit, באמצעות עמודות מגנטי או הממיינים מגנטי תא לפעיל על-בעקבות הוראות יצרן. איסוף תאים חיובי c-kit צינורות חרוט 15 מ"ל.
    11. רוחצים את התאים פעמיים עם PBS על ידי תוספת את הצינור חרוט 15-mL את צריך שתוציאו ב 400 g x עבור 7 מינימלית למחוק את תגובת שיקוע. בין שני שוטף לחשב את המספר הכולל של התאים קיימא מאת הדרה trypan blue9.
    12. Resuspend c-kit + תאים על ריכוז של viablecells6 עד 10 לכל 100 µL של תרבות בינונית עבור מאתר HSPCs בתוספת 2% FBS, 50 ng/mL העכבר תא גזע פקטור (SCF), 50 ng/mL העכבר thrombopoietin (TPO), 10 ננוגרם למ"ל עכבר IL-3, ועכבר ננוגרם למ"ל 10 IL-6.
    13. דגירה התאים ב 37 מעלות צלזיוס, 5% CO2 לפחות שעה למקסימום של 24 שעןת לפני אלקטרופורציה.
  2. בידוד HSPCs האנושי והתרבות
    הערה: יש לבצע את הפעולות הבאות ב תא למינארי.
    1. לסנן תאי דם במח העצם/חוט דרך מסננת תא 40 מיקרומטר.
    2. למהול 1:2 כדוריות הדם במח העצם מסוננים/כבל עם PBS בתוספת 1 מ"מ EDTA (PBS/EDTA).
    3. לוותר על 15 מ"ל של צפיפות בינונית הדרגתיות לתוך צינור חרוטי 50-mL. שופכים בעדינות 30 מ של דם מדולל מח עצם/כבל על פני הדרגתיות צפיפות בינונית. אם הנפח של התא הבולם גדול מ- 30 מ ל להכין טורפדו מרובים.
      הערה: הקפד לשמור את הממשק בין הדם המדיום הדרגתיות צפיפות חד ככל האפשר.
    4. לסובב את הצינורות-750 גרם x במשך 30 דקות עם ההאטה אין.
    5. לאסוף את שכבת תאי תא לזיהוי-ממשק והעברה של המדיום כדי צינור חרוטי נקי 50 מ. ממלאים את הצינור עם PBS/EDTA ולסובב התאים ב g 280 במשך 15 דקות להשליך את תגובת שיקוע.
    6. לשטוף את התאים פעמיים ב- PBS/EDTA ספינינג-400 g x עבור 7 דקות ומחיקת את תגובת שיקוע.
    7. דגירה תאי תאי עם אנטי-CD34 beads מגנטי בעקבות הוראות יצרן.
    8. בידוד תאי CD34 + שימוש בעמודות מגנטי או הממיינים מגנטי תא לפעיל על-בעקבות הוראות יצרן. איסוף תאי CD34 + צינורות חרוט 15 מ"ל.
    9. שטיפת נאספים תאי CD34 + פעמיים על-ידי גולות הכותרת את הצינור עם PBS ואת מסתובבת במהירות 400 x g עבור 7 דקות ומחיקת את תגובת שיקוע. בין שני שוטף לחשב את המספר הכולל של התאים קיימא מאת הדרה trypan blue9.
    10. Resuspend התאים במדיום תרבות בתוספת 100 ננוגרם למ"ל SCF אנושי, 100 ננוגרם למ"ל האנושי FLT3 ליגנד (FLT3L), 100 ננוגרם למ"ל TPO אנושי-ריכוז של התאים קיימא5 ~2.5 x 10 / ml. תרבות בודדו תאי CD34 + ב 37 מעלות צלזיוס, 5% CO2 עבור 24 שעות ביממה כדי לכהן מקסימום 48 שעות כדי אלקטרופורציה.
      הערה: לפני אלקטרופורציה לבדוק את טוהר מועשר CD34 + אוכלוסייה על-ידי cytometry זרימה.

5. אלקטרופורציה

הערה: להלן כללי התנהגות ממוטב 10 טיפים אלקטרופורציה µL. כל השלבים צריכה להתבצע בתוך תא למינארי.

  1. לספור תאים על-ידי trypan blue אי-הכללה של9. לאסוף 2 x 105 התאים קיימא לכל שכפול (למשל לאסוף 6 x 105 תאים עבור 3 electroporations).
  2. תאים תשטוף פעמיים עם PBS, ספינינג ב g 300 x במשך 7 דקות, בזהירות להסיר את תגובת שיקוע.
  3. במקביל, הכן מתחמי RNP Cas9-sgRNA על ידי המקננת ב המבחנות למשך 20-30 דקות ב- RT 1.5 µg Cas9 עם 1 µg של sgRNA הכולל עבור כל שכפול, מלבד השליטה היחידה Cas9.
    הערה: Cas9 חלבון מספק 10 ריכוז µg/µl. כדי להבטיח pipetting מדויק, לדלל 1:10 הסכום הכולל של חלבון Cas9 הצורך במים נטולי נוקלאז (למשל עבור 10 electroporations לקחת 1 µl של חלבון Cas9 לדלל את זה עם µl 9 של נוקלאז ללא מים, דגירה µl 1 של Cas9 מדולל לכל שכפול. בהתאם, את ריכוז sgRNA הנפח הכולל של Cas9 ו- sgRNA צריך כמורכבת בין µl 1.7 ו- 2 לכל שכפול. אם משתמש שני sgRNAs דגירה 500 ננוגרם של כל sgRNA לכל שכפול; אם משתמש 3 sgRNAs דגירה 330 ng של כל sgRNA לכל שכפול, וכן הלאה.
  4. לחשב הנפח הכולל של resuspension T מאגר הדרושים על-ידי הכפלת 10 µL המספר של סה כ משכפל הדרושים (למשל 30 µL עבור משכפל 3). Resuspend מגורען תאים עם הנפח מחושב של מאגר טי להבטיח הריכוז הסופי של התליה תא 2 x 107 תאים למ"ל.
  5. µL 10 aliquot של תאים resuspended/שכפול לתוך כל שפופרת PCR המכיל את טרום-ומורכבת sgRNA/Cas9 RNP (לדוגמה, עבור μL שהפקידים aliquot 30 של התא השעיה לתוך צינור PCR המכילים pre-ומורכבת Cas9-sgRNA).
  6. כדי להגדיר את המערכת אלקטרופורציה להפעיל את המכשיר, להוסיף 3 מ"ל של מאגר E לתוך cuvette אלקטרופורציה והחלק את cuvette לתוך בעל cuvette.
  7. להגדיר את התנאים הרצויים אלקטרופורציה במכשיר: HSPCs האנושית (1600 V, 10 ms, 3 פולסים) או בעכבר HSPCs (1700 V, 20 ms, הדופק 1).
    הערה: אם רצונך בכך, לפני ביצוע ניסויים על CD34 + HSPCs, sgRNA יעילות יכול להיבדק על שורות תאים לוקמיה מיאלואידית חריפה (AML) (לדוגמא HL60) באמצעות האסטרטגיה אותה (שימוש תרופתיים בינונית עבור שורות תאים לוקמיה מיאלואידית חריפה) עם התנאים אלקטרופורציה הבאים: מאגר R 1350 V, 35 ms, הדופק 1.
  8. אלקטרופורציה מתבצע באמצעות פיפטה אלקטרופורציה מיוחד, אשר יש טופר אשר נצמדת הטיפ פיפטה אלקטרופורציה. להחזיק את פיפטה אלקטרופורציה, להאריך את הציפורן, לתפוס את הדיסק בתוך הטיפ פיפטה, והקש בחוזקה פיפטה ל מאובטח הטיפ.
  9. Pipette המדגם לאורך 10 פעמים כדי לערבב. להוציא 10 µL, לוודא שאין אין בועות, והכנס את הקצה פיפטה ישירות לתוך המאגר electrolytic ב cuvette אלקטרופורציה. מנסה לא לגעת בקירות של cuvette. לחץ על "התחל" על המסך. לאחר מופיעה ההודעה "המלאה", להסיר את פיפטה, לוותר על תוכן טוב עם מדיום חדש של תרבות HSPC.
  10. חזור על כל הדגימות. שינוי פיפטה טיפים בין דגימות, במידת הצורך בלבד.

Representative Results

המטרה של פרוטוקול זה היא כדי לבצע נוקאאוט גנטי (KO) ב- HSPCs האנושי באמצעות Cas9-sgRNA RNPs של עכבר. זרימת העבודה היא קלה ומהירה ומאפשרת השלמת הניסויים ב פחות משבוע מעיצוב ניסיוני ובחינת יעילות KO.

לעומת פלסמיד או וירוס-גישות, ההצלחה של פרוטוקול שלנו מתבססת שילוב של sgRNA RNPs, אלקטרופורציה. אסטרטגיה זו ללא שכפול מקצר באופן משמעותי את הזמן הדרוש כדי להשיג את הרכיבים transfect. יתר על כן, אלקטרופורציה מאפשר תקנים של עד 95% של תאים, למקסם את המסירה של sgRNAs RNPs. יכול להיות synthetized במעבדה דרך במבחנה שעתוק (IVT), בעוד חלבון Cas9 מטוהרים ניתן לרכוש מספר חברות ( ראה פרוטוקול). sgRNA תבניות DNA עבור IVT מתקבלים ביצוע של PCR קצר באמצעות sgRNA של פריימר Fwd (איור 1 א', ב'), האוניברסלי לגרדום Rev פריימר (איור 1B - ראה פרוטוקול). המוצר PCR משמש לאחר מכן כתבנית עבור IVT (איור 1C). Cas9-sgRNA RNP מתחמי נוצרות המקננת למשך 15-30 דקות, את sgRNAs, את Cas9 (איור 1C). לבסוף, sgRNA RNPs הם electroporated לתוך התאים. הערוך HSPCs יכול לשמש לאחר מכן ביצוע ניסויים גם במבחנה וגם ויוו .

שיבוש גנטי בתאי עכבר

כדי להדגים את היעילות של האסטרטגיה אלקטרופורציה RNP Cas9-sgRNA, c-kit + HSPCs מבודד עכברים ubiquitously לבטא GFP או tdTomato היו electroporated עם sgRNA נגד GFP או tdTomato. בין שלוש sgRNA תוכנן נגד ה-GFP, GFP sg1 לבצע באופן היעיל ביותר, בתערוכה כ- 70-75% שיבוש בביטוי GFP כפי שנקבע על ידי cytometry זרימה (איור 2 א, ב'). כדי לכמת את תדירות השיבוש הגן ברמת גנומית, דנ א גנומי מתאי electroporated הופרדה ובוצע T7 endonuclease אני מבוסס assay (T7EI). כפי שמוצג באיור 2C, T7EI assay זיהה את היווצרות ויאסין 60%. שימו לב כי מבחני T7EI נוטים להמעיט התדרים של indels. אנו גם להפיק sgRNA נגד HSPCs tdTomato, electroporated לבטא tdTomato ממיקומה Rosa26. כפי שמוצג באיור 2D, tdTomato sg1 ablated ביעילות את הביטוי של tdTomato.

שיבוש גנטי בתאי אדם

. הנה, הפרעה יעיל שהושג עם גישה sgRNA יחיד מיקוד CD45, סמן משטח תאים הביע על תאים hematopoietic, מוצג. SgRNAs 3 מיקוד exons שונים של CD45 היו מעוצבים (CD45 sg1, sg2 ו מס ג 3). היעילות של sgRNAs נבחנה בקו תא HL60 AML (איור 3 א). חלבון KO הוערכה על ידי cytometry זרימה 5 ימים לאחר אלקטרופורציה. CD45 sg1 היה היעיל ביותר (98% KO יעילות - איור 3A), שימש לניסויים נוספים. איור 3B מציג CD45 קו ראשי האדם CD34 + ובתאים באמצעות CD45 sg1, מוערך על ידי cytometry זרימה 5 ימים לאחר אלקטרופורציה. בעוד הביטוי CD34 היה לא מושפע, ביטוי CD45 שהיה שקוע כ- 80% של התאים. 200.000 הערוך העיקרי CD34 + תאים הושתלו רטרו-orbitally לתוך NSG עכברים 6 שעות לאחר אלקטרופורציה. מח העצם הטחול התאים היו שנקטפו 3 חודשים לאחר ההשתלה. תאים הערוך (הלע-ABC חיובי CD45 שלילי, מודגשים באדום) הם לזיהוי רק דוגמאות sgRNA מטופלים ולא Cas9 רק על פקדים (איור 3C).

אם רצונך בכך, sgRNAs שני מיקוד בקרבת מקום רצפים יכול לשמש ליצירת מחיקות. גישה זו מאפשרת הערכה מהירה של יעילות העריכה עם ה-PCR ומייצרת לעיתים קרובות יעילות גבוהה יותר של ההפרעה. איור 3D מציג את הדור יעיל של מחיקה bp 58 אקסון 10 של DNMT3A. 200.000 הערוך CD34 + התאים היו מושתלים לתוך NSG עכברים 6 שעות לאחר אלקטרופורציה. המחיקה bp 58 זוהתה בבירור בדם ההיקפי של עכברים NSG engrafted 5 חודשים לאחר זריקות (איור 3E) המאשרת את עריכת תאי CD34 + עם יכולות engraftment לטווח ארוך.

Figure 1
איור 1: הגישה קלה ומהירה ליצור sgRNA RNPs. A) ייצוג sgRNA Fwd פריימר. SgRNA Fwd פריימר הוא oligonucleotide ה-DNA המכיל את המקדם T7, את רצף protospacer, רצף חפיפה עם לגרדום sgRNA. ב- 3' קצה, המסומנים באדום, היא הרצף "ATAGC" שצריך להוסיף את רצף פריימר Fwd sgRNA שהתקבל ב- CRISPRscan. B) ייצוג סכמטי של החפיפה PCR לבצע כדי להשיג את התבנית IVT. החפיפה בין ומהצמיגים Fwd sgRNA הראשיים. יוניברסל לגרדום Rev מאפשר הרחבת ואת ההגברה ידי PCR. C) קריקטורה התגובה IVT המתאר את sgRNA RNP טרום-complexing. המוצר PCR היא לטהר, המשמש כתבנית IVT. IVT מייצר כמות גבוהה של sgRNAs יכול לשמש ב מרובים משכפל (ראה פרוטוקול). sgRNA RNPs נוצרים המקננת את sgRNA מכל IVT ואת החלבון Cas9 שנרכשו בעבר. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: ג'ין יעילים להפרעה hematopoietic העכבר ובתאים. A) sgRNA מיקוד GFP (GFP sg1) יחד עם חלבון Cas9 היה electroporated לתוך מאתר c-kit + HSPCs לבטא GFP, נותחו על ידי cytometry זרימה 24 שעות לאחר אלקטרופורציה. B) כמות שונה של GFP sg1 היה ומורכבת עם µg 1 של חלבונים Cas9, electroporated. מעט ככל 200 ng של GFP sg1 ביעילות ablated ביטוי GFP. C) T7EI assay שבוצעה ב- DNA גנומי מבודד מן התאים המשמשים A-B. PCR אמפליקון פורש באתר המחשוף של Cas9-sgRNA היה מדולל 1:4 ב 1 x מאגר 2 ו hybridized לאט ב הצנטרפוגה תרמי. קטעים hybridized היו אז מתעכל עם endonuclease U של T7 1.25 אני במשך 10 דקות ב 37 º C. שברי מתעכל היו מופרדים על ידי לזיהוי בג'ל. הלהקה עוצמות נותחו באמצעות תוכנת ImageJ ידי הלהקה עוצמות של כל ליין. פצילות % מחושב על ידי היחס של עוצמות של להקות cleaved ללהקות uncleaved. D) c-kit + HSPCs מבודד עכברים המבטאים tdTomato היה electroporated עם חלבון Cas9 ומורכבת עם sgRNA נגד tdTomato. Cytometry זרימה לבצע 24 שעות אחרי אלקטרופורציה חשף כי כ- 74% של תאים נמחק tdTomato. R26 = Rosa26. * p < 0.05, * * p < 0.01, * * * p < 0.001. איור זה כבר ממאמרו של Gundry et al. 6 אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: ג'ין יעיל הפרעה בתאי hematopoietic אדם. A) sgRNAs 3 מיקוד CD45 (CD45 sg1, sg2 ו מס ג 3) היו תוכננה ונבדקה בקו תא HL60 AML (ראה פרוטוקול אלקטרופורציה התנאים). Cytometry זרימה בוצעה 5 ימים לאחר אלקטרופורציה. CD45 sg1 נבחר יעיל ביותר בקרב sgRNAs 3 (KO יעילות 98%). ב) CD45 KO-אנוש העיקרי כבל דם CD34 + HSPCs באמצעות CD45 sg1. ניתן להבחין CD45 אובדן בערך 80% של התאים. שימו לב כי הביטוי CD34 ללא שינוי לאחר העריכה. C) HSPCs האנושי בעריכה יכול להיות engrafted ביעילות לתוך NSG עכברים. תאים אנושיים nucleated להציג את הלע נורמלי / CD45 + פנוטיפ ב Cas9 בלבד engrafted עכברים, ואילו בעכברים engrafted עם CD45-sg1 מטופלים CD34 + התאים שניכם הלע + CD45 + והלע + / CD45-אוכלוסיות מובחנות המציין engraftment של תאים אנושיים CD45 קו. ד) ג'ל 2% agarose מציג מחיקה bp 58 שנוצר על ידי sgRNAs 2 (מדריך כפול הגישה) ב אקסון 10 של DNMT3A ב HSPCs האנושי של דם טבורי שונים 3 (CB1, CB2 ו CB3). PCR בוצעה 3 ימים לאחר אלקטרופורציה. E) agarose 2% ג'ל הוכחת התמדתו של המחיקה bp 58 חמישה חודשים לאחר השתלת לתוך NSG עכברים. איור זה כבר ממאמרו של. Gundry et al. 6 אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Oligonucleotide רצף הערה
פריימר לגרדום Rev אוניברסלי gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct יוניברסל למתחילים הפוכה חופפים PCR
hCD45 sgRNA 1 taatacgactcactataGGTGCTGGTGTTGGGCGCACgttttagagctagaaatagc sgRNA Fwd פריימר רצף חפיפה PCR
hCD45 sgRNA 2 taatacgactcactataGGGAGCAAGTGAGGATCCTCgttttagagctagaaatagc sgRNA Fwd פריימר רצף חפיפה PCR
hCD45 sgRNA 3 taatacgactcactataGGGATGCTTGTTCCCTTCAGgttttagagctagaaatagc sgRNA Fwd פריימר רצף חפיפה PCR
hDNMT3A Ex10 sg1 taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd פריימר רצף חפיפה PCR
hDNMT3A Ex10 sg2 taatacgactcactataGGGTGGCCAGCAGCCGCGCGgttttagagctagaaatagc sgRNA Fwd פריימר רצף חפיפה PCR
Rosa26 sgRNA taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd פריימר רצף חפיפה PCR
GFP sg1 taatacgactcactataGGGCGAGGAGCTGTTCACCGgttttagagctagaaatagc sgRNA Fwd פריימר רצף חפיפה PCR
tdTomato sg1 taatacgactcactataGGGGTACAGGCGCTCGGTGGgtttaagagctagaaatagc sgRNA Fwd פריימר רצף חפיפה PCR

טבלה 1: להשלים רצפים של sgRNA Fwd תחל המשמשים את הניסויים פריימר אוניברסלי Rev.

Discussion

הגישה RNP שמתואר פרוטוקול מפורט זה מאפשר נוקאאוט גנטי יעיל גם העכבר וגם ראשי hematopoietic תאים אנושיים כמו גם כמו שורות תאים ההשעיה. למרות היעילות קו גבוהה מאוד מתקבלים לעיתים קרובות, מספר משתנים קריטיים צריך להיחשב. ראשית, הבחירה אקסון נכונה היא מפתח המבטיח כי ויאסין יעיל ההתאגדות המתאים נוקאאוט גנטי. שני גורמים חשובים הקשורים אקסון הבחירה הם שימור ברחבי מיקום איזופורמים של אקסון בתוך התמלילים. דפוסי ביטוי Isoform משתנה על פני סוגי תאים, אז אם רצוי ג'ין קו על פני סוגי תאים, תא exons כי הם הקבועה בין סוגי צריך ניתן לפלח. Isoform דפוסי ניתן לאמת באמצעות q-PCR או RNA-רצף נתונים. לתפקיד אקסון בתוך התמלילים, זה הכי טוב כדי למקד exons מוקדם ככל frameshift מוטציות בטרמינל או אקסון הלפני אחרון לברוח דעיכה בתיווך שטויות10, ייצור חלבונים עם רומן או פונקציות לא ידוע ולא נכון ערכי null.

קביעת ויאסין את תדירות היא שלב קריטי כדי להעריך את היעילות KO, נכון לפרש את תוצאת הניסוי הביולוגי. מבחני endonucleases (למשל מודד assay) יש את היתרון של להיות יחסית מהיר וקל לביצוע. עם זאת, הם נוטים להיות לא מדויק בשל רקע משמעותי אותות, תוצאות הם לעתים קרובות קשה לשחזור. יתר על כן, הם אינם מספקים מידע על איכות indels שנוצר (למשל באורך של תוספות ומחיקות) בניסוי. סאנגר רצף מספק אלטרנטיבה endonuclease מבחני יקרי ערך. פלטפורמות כגון הגאות11 (https://tide.nki.nl/) לעזור לפרק סנגר עקבות ולהפיק הערכות מדויקות של הפרעה allelic יעילות, גם בעת מתן התדרים של הפרט indels. החיסרון העיקרי הוא תלות מוחלטת באיכות גבוהה סנגר רצף עקבות. אמפליקון תפוקה גבוהה רצף מתגבר על מרבית הבעיות האלה. אמפליקון ספריות ניתן להכין החל תשומות DNA נמוך מאוד ומבטיחה כיסוי גבוה תוצאות אמינות. כדי להפחית את העלות של רצף אמפליקון, אנחנו בדרך כלל ספייק בספריות אמפליקון לתוך פועל רצף גדול יותר (למשל RNA-רצף) משתמש רק 1-1.5% הקריאות הכולל. לבסוף, כדי לאשר נוקאאוט מוצלח, אנחנו בחום ממליץ על הערכת רמות החלבון על ידי שהכלים המערבי או flow cytometry, כאשר הדבר אפשרי.

כפי שתואר קודם לכן, השיטה המובאת כאן הוא מהיר וישיר ומייצג כלי חדש ללמוד ג'ין מדהימה העכבר, HSPCs האנושית. בעוד הפרוטוקול שלנו מספק הנחיות נוקאאוט גנטי עם מערכת מבוססת טיפ אלקטרופורציה, מערכות אחרות הוכחו להיות יעילים12,13.

שתי מגבלות העיקרי צריך להיות מוערך ביחס הגישה RNP. ראשית, כפי שתואר על ידי הקבוצה שלנו, הכדאיות של HSPCs electroporated עם הפריה עיבד sgRNAs להיות בסכנה באופן משמעותי על ידי אלקטרופורציה, במיוחד כאשר התנאים אינם מיטביים6. אם יש צורך, מסונתז מסחרית sgRNAs (דהיינו ומניעת במבחנה שעתוק) עלול להתגבר על בעיה זו. אלה נעשים פחות יקר עם הזמן, ניתן לרכוש מספר ספקי. בתרחיש זה, במבחנה תמלול יכול לשמש כדי ליצור מאגר של sgRNA עבור יעילות מסך ולאחר מכן ניתן לבחור את sgRNA(s) היעילה ביותר של סינתזה. המגבלה העיקרית השנייה של הגישה RNP הוא חוסר היכולת לעקוב אחר תאים transfected בהצלחה, כמו גישות ויראלי. עם זאת, קו ויעילות גבוהה עריכה מהירה שהושג עם RNPs Cas9-sgRNA ייתכן עולים אלה החסרונות בתרחישים רבים ניסיוני. אנו ממליצים להשתמש רצפי אמפליקון תפוקה גבוהה בדיוק לקבוע את היעילות שיבוש ניסוי. אם הנוק-אאוט של הגן עניין צפוי להתייעץ הפנוטיפ המקדימות (כלומר גם מופחתת או גדל התפשטות בהשוואה לפראי-סוג התאים), קביעת תדירות ויאסין בנקודות זמן מרובים מאפשר לו להעריך אם קו תאים עוברים העשרה (קרי ויאסין תדירות עליות לאורך זמן) או הן outcompeted (כלומר. ויאסין התדירות פוחתת עם הזמן).

ביצוע ניסויים ויוו או במבחנה כדי להבין את השפעות ביולוגיות של אובדן תפקוד הגן מחייבת את הפקדים המתאימים. כאמור, במבחנה עיבד sgRNAs עלולים להיות רעילים לתאים, בעיקר ראשי קדמון תאים6. בנוסף, מעברי כפול-גדיל DNA הנגרם על ידי חלבון Cas9 יכול לגרום תגובה אנטי-proliferative עצמאית ג'ין14. לכן, לעתים קרובות להשתמש במספר שליטה sgRNAs בניסויים CRISPR ואנו ממליצים סמן משטח תאים הביע את סוג התא שלך, כמו גם גן המטרה השנייה כי אינו מתבטא.

תרבות לטווח קצר של האדם HSPCs בנוכחות ציטוקינים מגביר את יעילות שיבוש גנטי6 , והוא הכרחי על מנת להשיג יעילות גבוהה קו. מצאנו 36-48 שעות כדי להיות התקופה האידיאלית של תרבות לפני אלקטרופורציה6. בעקבות אלקטרופורציה, התאים יכולים להיות עוד יותר בתרבית במחשבה כי ככל תרבות גבוהה יותר את הסיכון של אובדן יכולת multilineage engraftment. לכן, אנחנו בדרך כלל לבצע השתלות 6 שעות לאחר אלקטרופורציה, לא יאוחר מ-24 שעות לאחר אלקטרופורציה.

CRISPR/Cas9 השתפרה באופן דרמטי את היכולת של מדענים בהצלחה לערוך את הגנום של תאים בתרבית. ביצוע שיבוש גנטי יותר ריאלי ובתאים hematopoietic העיקרי הוא חזה כדי לשפר במהירות את הידע המדעי בתחום HSPCs ומחלות המטולוגיות. חשוב, הפרוטוקול המתואר כאן מאפשר גם ליצור הסתרה מרובות בו-זמנית עם יעילות גבוהה, המאפשרות עיצוב נופים גנטיים מורכבים, לעיתים לראות מחלות לוקמיה.

למרות הפרוטוקולים המתוארים במסמך זה מתמקדים על שיבוש גנטי, הם עשויים להיות מותאם בקלות ג'ין טוק-אין ניסויים. זה יכול להתבצע באמצעות מסירה שיתוף של תבניות חד גדילי oligonucleotide עבור תיקון מכוון הומולוגיה6,13 (HDR) או את התמרה חושית של תאים פוסט-אלקטרופורציה עם וקטורים AAV6 המכיל הומולוגיה תבנית12. היכולת לתקן או להציג מוטציות ספציפיות HSPCs יקל על אסטרטגיות טיפוליות חדשות עבור הטיפול הגנטי ואת המחקר המורחב של מוטציות סרטן הנהג ב- AML ומחלות המטולוגיות אחרות. בזמן HDR ב HSPCs האנושית הייתה מוצלחת6,12,13, העכבר HSPCs היה קשה לערוך שימוש זה אסטרטגיה6. אופטימיזציה של פרוטוקולים HDR באדם ובעיקר HSPCs העכבר יאפשר הפיתוח של כלים כדי לעקוב אחר תאים הערוכות באמצעות תיוג אנדוגני ועריכה יותר ספציפי.

בסופו של דבר, זה גם הוא שחזה את השיבוש של אללים mutant רווח-של-פונקציה יכול לייצג גישה טיפולית פוטנציאל להפרעות hematopoietic מולדת ולא נרכשת. בתרחיש זה, מומלץ בגישה ללא ה-DNA על מנת להימנע שילובים אפשריים יכול לקדם שינוי. יתר על כן, הגישה "תאונת פגע וברח" מקטין את האפשרות של תופעות לוואי את המטרה. מאמץ נוסף נדרש כדי לפתח מערכות אספקת ספציפי יפתחו דרכים חדשות לטיפול של מחלות המטולוגיות ממאירות שאינם ממאירים.

Disclosures

אין ניגוד אינטרסים לחשוף

Acknowledgments

עבודה זו נתמכה על ידי מניעת סרטן, מכון מחקר טקסס (RP160283, RP140001, R1201), המלאך הקרן של גבריאל לחקר הסרטן, קרן אדוארד אוונס עמ' של NIH (DK092883, CA183252, CA125123, P50CA126752, CA193235, DK107413). M.C.G. נתמך על ידי ביילור מחקר משרד עורכי דין עבור סטודנט מדענים. Cytometry זרימה מומן בחלקו על ידי NIH (המרכז הלאומי לקבלת מענק מחקר משאבים S10RR024574, המכון הלאומי של אלרגיה AI036211 מחלות זיהומיות, ואת P30CA125123 מכון הסרטן הלאומי) עבור מכללת ביילור לרפואה Cytometry ותא מיון הליבה.

Materials

Name Company Catalog Number Comments
Tissue culture plates according to cell numbers
1.5 ml Eppendorf microtubes Sigma Z606340-1000EA
50ml Falcon tubes Corning 352070
Nuclease Free Water - DEPC treated ThermoFisher Scientific AM9915G
KAPA HiFi HotStart ReadyMix (2X) KAPA Biosystems KK2600
MinElute PCR purification Kit Qiagen 28004
RNAse Zap RNAse Decontamination Solution ThermoFisher Scientific AM9780
RNA Clean and Concentrator-25 Zymo R1017
HiScribe T7 High Yield RNA Synthesis Kit New England Biolabs E2040S
Alt-R S.p. Cas9 Nuclease 3NLS, 100 µg IDT 1074181
40 mm Cell Strainers VWR 352340
Dulbecco's Phosphate Buffered Saline (PBS) GenDEPOT CA008-050
Fetal Bovine Serum (FBS), Regular Corning 35010CV
AutoMACS Pro Separator or MACS manual Cell Separation columns Miltenyi
Neon Transfection System Device ThermoFisher Scientific
Neon Transfection System 10mL kit ThermoFisher Scientific MPK1025 For larger numbers of cells (see protocol) Neon Transfection System 100 mL kit (# MPK10025) can be used
Name Company Catalog Number Comments
UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific 15575020 For human experiments only
Lymphoprep Stem Cell Technologies 7851 For human experiments only
CD34 MicroBead Kit UltraPure human Miltenyi Biotec 130-100-453 For human experiments only
Stem Span SFEM II Stem Cell Technologies 9605 For human experiments only
Recombinant Human SCF Miltenyi Biotec 130-096-695 For human experiments only
Recombinant Human TPO Miltenyi Biotec 130-094-013 For human experiments only
Recombinant Human FLT3L Miltenyi Biotec 130-096-479 For human experiments only
Name Company Catalog Number Comments
Mouse dissection tools For mouse experiments only
Mortar and Pestle For mouse experiments only
Hank's Balanced Salt Solution (HBSS) Gibco 14170112 For mouse experiments only
Biotin-conjugated anti c-kit antibody eBioscience 13-1171-82 For mouse experiments only
Anti-Biotin MicroBeads Miltenyi Biotec 130-090-485 For mouse experiments only
X VIVO-15, with L-Glutamine, Genatmycin and Phenol Red Lonza 04-418Q For mouse experiments only
Mouse IL-6 Peprotech 216-16 For mouse experiments only
Mouse TPO Peprotech 315-14 For mouse experiments only
Mouse IL-3 Peprotech 213-13 For mouse experiments only
Mouse SCF Peprotech 250-03 For mouse experiments only

DOWNLOAD MATERIALS LIST

References

  1. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, 816-821 (2012).
  2. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  3. Sternberg, S. H., Doudna, J. A. Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell. 58, 568-574 (2015).
  4. Heckl, D., et al. Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 32, 941-946 (2014).
  5. Mandal, P. K., et al. Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell stem cell. 15, 643-652 (2014).
  6. Gundry, M. C., et al. Highly Efficient Genome Editing of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. Cell Rep. 17, 1453-1461 (2016).
  7. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24, 1012-1019 (2014).
  8. Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature methods. 12, 982-988 (2015).
  9. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Current protocols in immunology. 111, A3 B 1-3 (2015).
  10. Lykke-Andersen, S., Jensen, T. H. Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol. 16, 665-677 (2015).
  11. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 42, e168 (2014).
  12. Dever, D. P., et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells. Nature. 539, 384-389 (2016).
  13. DeWitt, M. A., et al. Selection-free genome editing of the sickle mutation in human adult hematopoietic stem/progenitor cells. Sci Transl Med. 8, 360ra134 (2016).
  14. Aguirre, A. J., et al. Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting. Cancer Discov. 6, 914-929 (2016).
שיבוש גנטי יעילים ביותר מאתר ואנושי Hematopoietic ובתאים מאת CRISPR/Cas9
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).More

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter