Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Højeffektive gen afbrydelse af Murine og menneskelige hæmatopoietisk stamceller ved CRISPR/Cas9

doi: 10.3791/57278 Published: April 10, 2018
* These authors contributed equally

Summary

En protokol for hurtig CRISPR/Cas9-medieret gen forstyrrelser i mus og primære hæmatopoietisk menneskeceller er beskrevet i denne artikel. Cas9-sgRNA ribonucleoproteins er indført via elektroporation med sgRNAs genereret gennem in vitro- transskription og kommercielle Cas9. Høj redigering effektivitet opnås med begrænset tid og finansielle omkostninger.

Abstract

Fremskridt i feltet hæmatopoietisk stamcelle (HSCs) har været hjulpet af metoder til genetisk ingeniør primære stamceller samt dyremodeller. Komplet gen ablation i HSCs kræves generation af knockout mus hvorfra HSCs kunne isoleres, og genet ablation i primære menneskelige HSCs var ikke mulig. Viral transduktion kunne bruges til knock-down tilgange, men disse lidt fra variabel effekt. I generelle, genetisk manipulation af mennesker og mus hæmatopoietisk celler var hæmmet af lav effektivitet og omfattende tid og omkostninger forpligtelser. For nylig, CRISPR/Cas9 har drastisk udvidet evne til ingeniør DNA i pattedyrsceller. Dog har anvendelsen af CRISPR/Cas9 til hæmatopoietisk celler været udfordrende, hovedsagelig på grund af deres lave Transfektion effektivitetsfordele, toksicitet af plasmid-baserede tilgange og den langsomme ekspeditionstid for virus-baserede protokoller.

En hurtig metode til at udføre CRISPR/Cas9-medieret gen redigering i murine og menneskelige hæmatopoietisk stilk og stamfader celler med knockout virkningsgrader på op til 90% er fastsat i denne artikel. Denne metode udnytter en ribonucleoprotein (RNP) levering strategi med en strømlinet tre-dages arbejdsproces. Brugen af Cas9-sgRNA RNP giver mulighed for en hit-and-run tilgang, at indføre ingen udefrakommende DNA-sekvenser i genomet af redigerede celler og reducere off target effekter. RNP-baseret metode er hurtig og ligetil: det kræver ikke kloning af sgRNAs, virus forberedelse eller specifikke sgRNA kemiske modifikation. Med denne protokol, bør forskere kunne med held generere udskæringer af et gen af interesse i primære hæmatopoietisk celler inden for en uge, herunder stilstandstider for oligonukleotid syntese. Denne tilgang giver mulighed for en meget bredere gruppe af brugere at tilpasse denne protokol til deres behov.

Introduction

Fremkomsten af CRISPR/Cas9 har radikalt forenklet gen redigering i pattedyrsceller. Tidlig CRISPR/Cas9 protokoller udnyttet plasmid eller virus-baserede levering af Cas9 protein og sgRNA1,2,3. Disse tilgange viste sig at være revolutionerende for udvikling af cellulære og animalske modeller og også med held har anvendt til primær hæmatopoietisk stilk og stamfader celler (HSPCs)4,5. Men disse metoder har en række ulemper. For det første forbliver gen forstyrrelser effektivitet ofte under 50%4,5. Selv om dette er tilstrækkeligt til at generere knockout (KO) kloner i cellelinjer, gør nødvendighed for kortfristede kultur HSPCs ikke indstillet til en sådan strategi. For det andet begrænser kravet om kloning mængden af sgRNAs, der kan afprøves i enkelt eksperimenter og genererer store, svært at transfect konstruktioner. Tredje, disse tilgange tvinger forskere til at bremse turnaround-tider.

For at overvinde disse begrænsninger, vores gruppe udviklet og for nylig udgivet en alternativ CRISPR/Cas9 tilgang i HSPCs ved hjælp af Cas9-sgRNA ribonucleoproteins (RNPs)-baseret levering6. I denne strategi, de rå komponenter i CRISPR (Cas9 protein og in vitro- transskriberet sgRNA) er pre-kompleksbundet og direkte leveret til målceller via elektroporation (figur 1). Halveringstiden for Cas9-sgRNA RNP komplekset er kortere end tid at plasmid eller virus nukleinsyre er transskriberet, off-målet er lavere i forhold til tidlige tilgange7. Derudover fordelen RNP tilgang af at fjerne enhver kilde af eksogene DNA, som tilfældigt kan integrere i target cell genom fører til cellulær transformation.

Denne protokol er baseret på en strømlinet arbejdsproces for RNP-baserede gen forstyrrelser eksperimenter, som vist i figur 1. Det første skridt at designe og bestilling primere for hver sgRNA. Disse primere udnyttes for at gøre sgRNA DNA skabeloner, der bruges til in vitro- transskription (IVT) for at få sgRNAs. Renset sgRNAs er derefter inkuberes med tidligere købte Cas9 protein, at form Cas9-sgRNA RNP komplekser. Endelig, pre-kompleksbundet Cas9-sgRNA RNPs er electroporated i celler. Efter elektroporation, redigering effektivitet kan afprøves og in vitro-/i vivo eksperimenter kan startes, afhængigt af behov. Nedenstående en detaljeret beskrivelse af denne innovative eksperimenterende tilgang kan findes.

Protocol

Protokollen følger retningslinjerne fra Baylor College of Medicine menneskelige etiske komité. Alle eksperimentelle procedurer udført på mus er godkendt af Baylor College af medicin institutionelle Animal Care og brug udvalget.

1. sgRNA Fwd Design

  1. Navigere hen til http://www.crisprscan.org/?page=track8 til at begynde at designe sgRNAs af interesse.
  2. Klik på "Mus" eller "Menneskelige" knappen afhængigt af hvilken celle interesse.
  3. Gen af interesse indgå UCSC søgefeltet og tryk på go.
  4. Zoome ind og flytte til området af genet (dvs. en specifik exon) der er af interesse for målet.
    Bemærk: At opnå effektiv gen forstyrrelser anbefales det er rettet mod den tidligste exon(s) stede i alle transskriberede isoformer i din specifikke celletype.
  5. Sikre, at de potentielle sgRNA target sekvenser er opført under en "CRISPRscan forudsigelser på gener (cd'er)" overskrift.
  6. Find og klik på en target sekvens med en forholdsvis høj score og få off-mål (fremhævet i lysegrønt). Kopier fuld sekvensen vises under sektionen "Oligo sekvens" og indsætte det i et tekstdokument. Tilføj "ATAGC" 3' slutningen af sekvensen. Når først færdig, placere ordre på fuld længde sekvensen.
    Bemærk: For hvert mål sekvens, CRISPRscan8 giver en "integreret" fremad sgRNA primer, der omfatter T7 promotor, protospacer (target) sekvens og universelle stillads overlapning rækkefølge (Se figur 1A). En fuld længde sekvens er lavet af enten 56 eller 57 nukleotider afhængigt af protospacer længde.

2. sgRNA DNA skabelon syntese

  1. Opløses og fortyndes sgRNA Fwd og universelle Rev primer (se tabel 1 for den fuldstændige sekvens). For at opnå en 10 µM endelige koncentration, Følg producent instruktion på hvordan man kan fortynde primere til 100 µM, så laver en 1:10 fortynding med vand bestemmes nukleasen-fri.
  2. Udføre overlappende PCR (Se figur 1B), mix det følgende i PCR strip rør: 2 µL frem sgRNA primer (10 µM), 2 µL Universal Rev stillads primer (HPLC-renset) (10 µM), 10 µL High fidelity DNA polymerase master mix (2 x) og 6 µL nukleasen-gratis vand.
  3. Køre PCR med følgende program: 95 ° C i 3 min, 98 ° C i 5 s, 60 ° C i 5 s, 72 ° C i 10 s, gå til 2 til 6 cyklusser, 72 ° C i 1 minut, 4 ° C for evigt.
  4. Rense PCR produkt ved hjælp af DNA oprensning kolonner (se tabel af materialer). Følg producentens anvisninger og elueres med 11,5 µL af eluering buffer.
  5. Mål koncentrationen af PCR-produkter i et spektrofotometer. Tomme instrument med eluering buffer.
    Bemærk: DNA-koncentrationen skal mellem ~ 50 og ~ 120 ng/µL.

3. in Vitro transskription af sgRNA

  1. Bland de følgende komponenter i PCR strip rør (reagenser leveres i RNA syntese kit): 4 µL af elueret DNA, 4 µL af dNTP'er, 1 µL af 10 x reaktion Buffer og 1 µL af T7 RNA polymerase enzym mix.
  2. Inkuber prøver ved 37 ° C i mindst 4 h.
  3. Anvende RNase rengøringsmiddel til at fjerne RNase fra behandskede hænder.
  4. Bringe hver RNA prøve op til en samlet maengde paa 50 µL med nukleasen-gratis vand (første trin af RNA oprensning efter producentens anvisninger).
  5. Fortsætte med RNA oprensning efter producentens anvisninger og elueres i 50 µL af kit-forudsat nukleasen-gratis vand.
  6. Mål koncentrationen af den eluted sgRNA i et spektrofotometer. Tomme instrument med nukleasen-gratis vand.
    Bemærk: Det forventede udbytte efter rensning er 50-80 µg RNA (dvs. koncentration på 1,0-1,5 µg/µL).
  7. Anvendes den renset sgRNA straks eller opbevares i alikvoter af 2-4 µL ved-80 ° C på lang sigt.

4. HSPC Isolation og kultur

  1. Murine HSPCs isolation og kultur
    Bemærk: Mandlige og kvindelige Ubc-normal god landbrugspraksis mus (JAX004353) og Rosa26-LSL-tdTomato (JAX007914) krydsede med Vav-iCre (JAX008610) på 2-6 måneder blev brugt til at opnå de resultater, der er vist nedenfor.
    1. Aflive bedøvede mus gennem cervikal dislokation.
      Bemærk: To uddannede personer bør uafhængigt kontrollere vellykket eutanasi ved at bemærke en mangel på åndedræt og hjerterytme i mindst 5 min. Fjern skindet fra dyrene.
    2. Dissekere forbenede, lårben og iliaca kamme af mus og fjerne alle muskler og bindevæv omkring dissekeret knoglerne. Placere intakt knogler i en vævskultur parabol på is med HBSS suppleret med 2% FBS (HBSS +). Flytte til en laminar flow hætte så snart al knoglerne er blevet renset og overført til fadet, vævskultur.
    3. Overførsel renset knogler til sterile mørtel, indeholdende 2 mL iskold HBSS + pr. 3 knogler. Ved hjælp af pistil, knuse knogler i knoglerester, frigive marv fra inden for. Fortsætte pestling indtil knoglerne stoppe revner under pistil.
    4. Indsamle supernatanten fra mørtel og filter ind i en 50 mL konisk rør ved hjælp af en 40 µm celle si. Skyl de resterende knoglerester med 5 mL iskold HBSS + og filter ind i samme 50 mL konisk røret ved hjælp af den samme 40 µm si.
    5. Cellerne vaskes to gange af topping off tube med iskold HBSS + og centrifugering ved 400 x g i 7 min. Fjern supernatanten.
    6. Efter den anden vask resuspenderes celle i 20 mL af is kold PBS. Optælle levedygtige celler ved trypan-blå udstødelse9.
    7. Inkubér 1 x 108 levedygtige celler pr. 1 mL iskold HBSS + med biotin-konjugeret antistof, c-kit på 1: 100 fortynding for 45 min på is.
    8. Cellerne vaskes med iskold HBSS + ved centrifugering ved 400 x g i 7 min og kassere supernatanten.
    9. Inkuber cellerne med anti-biotin magnetiske perler efter producentens anvisninger.
    10. Isolere c-kit positive celler ved hjælp af magnetiske kolonner eller magnetisk aktiveret celle sorteringsanlæg efter producentens anvisninger. Indsamle c-kit positive celler i 15 mL konisk rør.
    11. Cellerne vaskes to gange med PBS af topping off 15 mL konisk røret og centrifugering ved 400 x g i 7 min. supernatanten. Beregne antallet af levedygtige celler af trypan blå udstødelse9mellem de to skylninger.
    12. Resuspend c-kit + celler i en koncentration på op til 106 viablecells pr. 100 µL af næringssubstratet for murine HSPCs suppleret med 2% FBS, 50 ng/mL mus stamcelle faktor (SCF), 50 ng/mL mus thrombopoietin (TPO), 10 ng/mL mus IL-3 og 10 ng/mL mus IL-6.
    13. Inkuber celler ved 37 ° C, 5% CO2 i mindst 1 time til højst 24 timer inden elektroporation.
  2. Menneskelige HSPCs isolation og kultur
    Bemærk: Disse trin skal udføres i en laminar flow hætte.
    1. Filtrer knoglemarv/navlestrengsblod celler gennem en 40 µm celle si.
    2. Fortyndes 1:2 de filtrerede knoglemarv/navlestrengsblod celler med PBS suppleret med 1 mM EDTA (PBS/EDTA).
    3. Dispensere 15 mL af tæthed gradient medium i en 50 mL konisk slange. Forsigtigt hældes 30 mL af det fortyndede knoglemarv/navlestrengsblod på tæthed gradient medium overflade. Hvis mængden af cellesuspension er større end 30 mL forberede flere rør.
      Bemærk: Sørg for at holde grænsefladen mellem blod og tæthed gradient medium så skarpe som muligt.
    4. Spin rør på 750 x g i 30 min med ingen deceleration.
    5. Indsamle mononukleære cellelag kan påvises på medium's interface og overførsel til en ren 50 mL konisk slange. Fylde røret med PBS/EDTA og spin celler på 280 g i 15 min. Fjern supernatanten.
    6. Vaske cellerne to gange i PBS/EDTA spinning på 400 x g i 7 min og kassere supernatanten.
    7. Inkuber de mononukleære celler med anti-CD34 magnetiske perler efter producentens anvisninger.
    8. Isolere CD34 + celler ved hjælp af magnetiske kolonner eller magnetisk aktiveret celle sorteringsanlæg efter producentens anvisninger. Indsamle CD34 + celler i 15 mL konisk rør.
    9. Vask indsamlet CD34 + celler to gange ved topping off tube med PBS og spinding på 400 x g i 7 min og kassere supernatanten. Beregne antallet af levedygtige celler af trypan blå udstødelse9mellem de to skylninger.
    10. Resuspend celler i dyrkningsmediet suppleret med 100 ng/mL menneskelige SCF, 100 ng/mL menneskelige FLT3 ligand (FLT3L), 100 ng/mL menneskelige TPO på en koncentration af ~2.5 x 105 levedygtige celler / ml. kultur isoleret CD34 + celler ved 37 ° C, 5% CO2 i 24 timer til en maksimal 48 h før til elektroporation.
      Bemærk: Før elektroporation tjekke renheden af beriget CD34 + befolkning ved flowcytometri.

5. elektroporation

Bemærk: Følgende protokol er optimeret til 10 µL elektroporation tips. Alle trin skal udføres i en laminar flow hætte.

  1. Tælle celler af trypan blå udstødelse9. Samle 2 x 105 levedygtige celler pr. replikat (f.eks. indsamle 6 x 105 celler for 3 electroporations).
  2. Vask celler to gange med PBS, spinning på 300 x g i 7 min og forsigtigt fjerne supernatanten.
  3. Samtidig forberede Cas9-sgRNA RNP komplekser af inkubere i PCR rør til 20-30 min på RT 1,5 µg Cas9 med 1 µg på totale sgRNA for hver replikeres, undtagen Cas9 eneste kontrol.
    Bemærk: Cas9 protein er fastsat på 10 µg/µl koncentration. For at sikre præcis pipettering, fortyndes 1:10 det samlede beløb af Cas9 protein behov med nukleasen-gratis vand (fx for 10 electroporations tage 1 µl af Cas9 protein og fortynd det med 9 µl nukleasen-gratis vand og inkuberes 1 µl fortyndede Cas9 pr. replikat. Afhængigt af koncentrationen af sgRNA, bør den samlede mængde af Cas9 og sgRNA bestå mellem 1,7 og 2 µl pr. replikat. Hvis du bruger to sgRNAs inkuberes 500 ng af hver sgRNA pr. replikat; Hvis du bruger 3 sgRNAs inkuberes 330 ng af hver sgRNA pr. replikat, og så videre.
  4. Beregn det samlede volumen af resuspension Buffer T behov ved at multiplicere 10 µL af antallet af samlede replikater behov (f.eks. 30 µL til 3 replikater). Resuspend pelleted celler med den beregnede mængde Buffer T. sikre at den endelige koncentration af cellesuspension er 2 x 107 celler/mL.
  5. Alikvot 10 µL af resuspenderede celler/kopiere ind i hver PCR rør indeholdende den pre-kompleksbundet sgRNA/Cas9 RNP (f.eks. for en tre eksemplarer alikvot 30 μL cellesuspension ind i en PCR rør indeholdende pre-kompleksbundet Cas9-sgRNA).
  6. Såsan elektroporation system tænde instrumentet og tilsættes 3 mL buffer E i en elektroporation kuvette, og skub kuvette i kuvette holderen.
  7. Indstille de ønskede elektroporation betingelser på enhed: menneskelige HSPCs (1600 V, 10 ms, 3 bælgfrugter) eller mus HSPCs (1700 V, 20 ms, 1 puls).
    Bemærk: Hvis ønskes, før du udfører eksperimenter på CD34 + HSPCs, sgRNA effektivitet kan blive testet på akut myeloid leukæmi (AML) cellelinjer (f.eks. HL60) ved hjælp af den samme strategi (brug antibiotikum-frit medium for AML cellelinjer) med følgende elektroporation betingelser: Buffer Rasmussen, 1350 V, 35 ms, 1 puls.
  8. Elektroporation er udført med en speciel elektroporation pipette, som har en klo, at låsene på elektroporation pipette tip. Hold elektroporation pipette, udvide klo, grab disc inde pipette tip, og fast tryk pipette til sikker spidsen.
  9. Med pipette udtages prøven op og ned 10 gange for at blande. Tag 10 µL, og sørg for der er ingen bobler, og indsætte pipette tip direkte i den elektrolytiske buffer i elektroporation kuvette. Prøv ikke at røre væggene i kuvette. Tryk på "start" på skærmen. Når meddelelsen "fuldført" vises, fjerne pipetten, og dispensere indholdet ind i godt med nye HSPC næringssubstratet.
  10. Gentag for alle prøver. Ændre pipette tips mellem prøver, hvis det er nødvendigt.

Representative Results

Målet med denne protokol er at udføre gen knockout (KO) i mus og menneskelige HSPCs ved hjælp af Cas9-sgRNA RNPs. Arbejdsprocessen er nemt og hurtigt og giver mulighed for færdiggørelsen af eksperimenter i mindre end en uge fra eksperimentelle design til vurdering af KO effektivitet.

Sammenlignet med plasmid - eller virus-baserede tilgange, bygger succes i vores protokol på en kombination af sgRNA RNPs og elektroporation. Denne kloning-gratis strategi betydeligt forkorter den tid, det tager at anskaffe komponenter for at transfect. Derudover elektroporation giver mulighed for Transfektion af op til 95% af celler, maksimere levering af RNPs. sgRNAs kan være synthetized i lab gennem in vitro- transskription (IVT), mens renset Cas9 protein kan købes fra flere selskaber ( Se protokollen). sgRNA DNA skabeloner til IVT er opnået udfører en kort PCR ved hjælp af sgRNA Fwd primer (figur 1A, B) og universelle stillads Rev primer (figur 1B - se protokollen). PCR-produktet bruges derefter som en skabelon for IVT (figur 1 c). Cas9-sgRNA RNP komplekser genereres inkubere 15-30 minutter, sgRNAs og Cas9 (figur 1 c). Endelig er sgRNA RNPs electroporated ind i celler. Redigeret HSPCs kan derefter bruges til at udføre både in vitro- og i vivo eksperimenter.

Gen forstyrrelser i mus celler

At påvise effekten af Cas9-sgRNA RNP elektroporation strategi, c-kit + HSPCs isoleret fra mus allestedsnærværende udtryk for normal god landbrugspraksis eller tdTomato har været electroporated med sgRNA mod normal god landbrugspraksis eller tdTomato. Blandt de tre sgRNA designet mod normal god landbrugspraksis, normal god landbrugspraksis sg1 udføres mest effektivt udstiller ca 70-75% forstyrrelser af normal god landbrugspraksis udtryk som bestemt ved flowcytometri (figur 2A, B). For at kvantificere forstyrrelser genfrekvensen på niveauet genomisk, genomisk DNA fra electroporated celler blev isoleret og T7 liv1975 jeg-baseret (T7EI) analyse blev udført. Som vist i figur 2 c, T7EI analyse fundet op til 60% indel dannelse. Bemærk, at T7EI assays tendens til at undervurdere frekvenserne af indels. Vi genereret også sgRNA mod tdTomato og electroporated HSPCs udtryk for tdTomato fra Rosa26 locus. Som vist i figur 2D, ablated tdTomato sg1 effektivt udtryk for tdTomato.

Gen forstyrrelser i humane celler

Her, er effektiv afbrydelse fremstillet med en enkelt sgRNA tilgang målretning CD45, en celle overflade markør udtrykt på hæmatopoietisk celler, vist. Tre sgRNAs rettet mod forskellige exons af CD45 var designet (CD45 sg1, sg2 og sg3). Effektiviteten af sgRNAs blev testet i HL60 AML cellelinje (figur 3A). Protein KO blev vurderet ved flowcytometri 5 dage efter elektroporation. CD45 sg1 var den mest effektive (98% KO effektivitet - figur 3A) og blev brugt til yderligere forsøg. Figur 3B viser CD45 KO i primære menneskelige CD34 + stamceller ved hjælp af CD45 sg1, vurderet ved flowcytometri 5 dage efter elektroporation. Mens CD34 udtryk var upåvirket, blev CD45 udtryk tabt i omkring 80% af cellerne. 200.000 redigerede primære CD34 + celler blev retro-orbitally transplanteret ind i NSG mus 6 timer efter elektroporation. Knoglemarv og milt celler var fældet 3 måneder efter transplantationen. Redigerede celler (HLA-ABC positiv, CD45 negative, markeret med rødt) kan registreres kun i sgRNA behandlet prøver og ikke i Cas9 eneste kontrolelementer (figur 3 c).

Hvis det ønskes, kan to sgRNAs målretning i nærheden sekvenser bruges til at generere sletninger. Denne tilgang giver mulighed for et hurtigt skøn redigering effektivitet med en PCR og ofte producerer højere forstyrrelser effektivitet. Figur 3D viser den effektive generation af 58 bp sletning i exon 10 af DNMT3A. 200.000 redigerede CD34 + celler blev transplanteret ind i NSG mus 6 timer efter elektroporation. 58 bp sletningen var klart opdaget i de perifere blod af aflægger NSG mus 5 måneder efter injektioner (figur 3E) bekræfter redigering af CD34 + celler med langsigtede engraftment kapaciteter.

Figure 1
Figur 1: til hurtig og nem tilgang til at generere sgRNA RNPs. A) repræsentation af sgRNA Fwd primer. SgRNA Fwd primer er et DNA oligonukleotid indeholdende T7 promotor, protospacer sekvens og en overlapning sekvens med sgRNA skafottet. Ved 3' er enden, fremhævet med rødt, den "ATAGC" sekvens, der skal tilføjes til sgRNA Fwd primer sekvens fremstillet på CRISPRscan. B) skematisk gengivelse af overlapningen PCR udføres for at hente skabelonen IVT. Overlapning mellem sgRNA Fwd primer og Universal stillads Rev primer giver mulighed for udvidelse og forstærkning af PCR. C) tegnefilm der beskriver IVT reaktion og sgRNA RNP pre-kompleksbindende. PCR produkt er renset og bruges som skabelon for IVT. IVT genererer en stor mængde sgRNAs, der kan bruges i flere flergangsbestemmelser (se protokollen). sgRNA RNPs er genereret inkubere sgRNA renset fra IVT og den tidligere købte Cas9 protein. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: effektiv gen forstyrrelser i mus hæmatopoietisk stamceller. A) en sgRNA rettet mod normal god landbrugspraksis (NGL sg1) sammen med Cas9 protein var electroporated i murine c-kit + HSPCs udtryk for normal god landbrugspraksis, og analyseret ved flowcytometri 24 timer efter elektroporation. B) forskellige mængde af normal god landbrugspraksis sg1 var kompleksbundet med 1 µg af Cas9 protein og electroporated. Så lidt som 200 ng af normal god landbrugspraksis sg1 effektivt ablated normal god landbrugspraksis udtryk. C) T7EI analyse udført om genomisk DNA isoleret fra celler, der anvendes i A-B. PCR amplikon spanning webstedet Cas9-sgRNA kavalergang blev fortyndet 1:4 i 1 x Buffer 2 og hybridiserede langsomt i en termisk cycler. Hybridiserede fragmenter blev derefter fordøjes med 1,25 U af T7 liv1975 jeg i 10 minutter ved 37 ° C. Nedbrudte fragmenter var adskilt af polyacrylamid gelelektroforese. Bandet intensiteter blev analyseret ved hjælp af ImageJ software ved at plotte band intensiteter af hver lane. % kavalergang blev beregnet som forholdet mellem intensiteten af kløvet bands til uncleaved bands. D) c-kit + HSPCs isoleret fra mus at udtrykke tdTomato blev electroporated med Cas9 protein kompleksbundet med sgRNA mod tdTomato. Flowcytometri udført 24 timer efter elektroporation afslørede, at ca. 74% af celler slettet tdTomato. R26 = Rosa26. * p < 0,05, ** p < 0,01, *** p < 0,001. Dette tal er blevet tilpasset fra Gundry mfl. 6 Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: effektiv gen forstyrrelser i hæmatopoietisk menneskeceller. A) tre sgRNAs målretning CD45 (CD45 sg1, sg2 og sg3) er designet og testet i HL60 AML cellelinje (Se protokol for elektroporation betingelser). Flowcytometri blev udført 5 dage efter elektroporation. CD45 sg1 blev valgt som det mest effektive blandt de tre sgRNAs (KO effektivitet 98%). B) CD45 KO i primære menneskelige ledning blod CD34 + HSPCs ved hjælp af CD45 sg1. CD45 tab kan påvises i ca. 80% af cellerne. Bemærk at CD34 udtryk er uændret efter redigering. C) redigeret menneskelige HSPCs kan være effektivt engrafted til NSG mus. Humane nukleeret celler vises den normale HLA +/ CD45 + fænotype i Cas9-kun aflægger mus, der henviser til, at i mus aflægger med CD45-sg1 behandlet CD34 + celler, begge HLA +/ CD45 + og HLA +/ CD45-populationer er observeret, med angivelse af engraftment af CD45 KO menneskeceller. D) 2% agarosegel viser en 58 bp sletning genereret af 2 sgRNAs (dobbelt guide tilgang) i exon 10 af DNMT3A i menneskelige HSPCs fra 3 forskellige navlestrengsblod (CB1, CB2 og CB3). PCR blev udført 3 dage efter elektroporation. E) 2% agarosegel demonstrerer persistens af 58 bp sletningen 5 måneder efter transplantation i NSG mus. Dette tal er blevet tilpasset fra Gundry et al. 6 Venligst klik her for at se en større version af dette tal.

Oligonukleotid Sekvens Bemærk
Universal Rev stillads primer gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct Universal omvendt primer for overlapper PCR
hCD45 sgRNA 1 taatacgactcactataGGTGCTGGTGTTGGGCGCACgttttagagctagaaatagc sgRNA Fwd primer sekvens for overlapning PCR
hCD45 sgRNA 2 taatacgactcactataGGGAGCAAGTGAGGATCCTCgttttagagctagaaatagc sgRNA Fwd primer sekvens for overlapning PCR
hCD45 sgRNA 3 taatacgactcactataGGGATGCTTGTTCCCTTCAGgttttagagctagaaatagc sgRNA Fwd primer sekvens for overlapning PCR
hDNMT3A Ex10 sg1 taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd primer sekvens for overlapning PCR
hDNMT3A Ex10 sg2 taatacgactcactataGGGTGGCCAGCAGCCGCGCGgttttagagctagaaatagc sgRNA Fwd primer sekvens for overlapning PCR
Rosa26 sgRNA taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd primer sekvens for overlapning PCR
Normal god landbrugspraksis sg1 taatacgactcactataGGGCGAGGAGCTGTTCACCGgttttagagctagaaatagc sgRNA Fwd primer sekvens for overlapning PCR
tdTomato sg1 taatacgactcactataGGGGTACAGGCGCTCGGTGGgtttaagagctagaaatagc sgRNA Fwd primer sekvens for overlapning PCR

Tabel 1: Komplet sekvenser af sgRNA Fwd primere anvendes i eksperimenter og Universal Rev primer.

Discussion

RNP fremgangsmåden i denne detaljerede protokollen giver mulighed for effektiv gen knockout i både mus og primære hæmatopoietisk menneskeceller samt som suspension cellelinjer. Selv om meget høj KO effektivitetsgevinster er ofte opnået, skal flere kritiske variabler overvejes. Første, ordentlig exon valg er afgørende for at sikre, at effektiv indel indarbejdelse svarer til gen knockout. To vigtige faktorer relateret til exon valg er bevarelse på tværs af isoformer og exon position inden for udskrifter. Isoform udtryk mønstre er variabel i hele celletyper, så eventuelt gen KO på tværs af celletyper exons der er invariante mellem cellens typer skal være målrettet. Isoform mønstre kan kontrolleres ved hjælp af q-PCR eller RNA-sekvens data. Exon position inden for udskrifter, er det bedst at målrette tidlige exons som frameshift mutationer i terminalen eller næstsidste exon kan undslippe nonsens-medieret henfald10, producerer proteiner med roman eller ukendte funktioner snarere end sande null-værdier.

Bestemmelse af indel er frekvens et afgørende skridt til at anslå KO effektivitet og korrekt fortolke biologiske resultatet af eksperimentet. Endonucleases assays (fx landmåler assay) har fordelen at være relativt hurtigt og let at udføre. Men de har tendens til at være unøjagtig på grund af betydelig baggrund signaler og resultater er ofte vanskelige at formere. De giver desuden ikke oplysninger om kvaliteten af indels genereres (f.eks. længden af indsætninger og sletninger) i eksperimentet. Sanger sekventering giver et værdifuldt alternativ til liv1975 assays. Platforme som TIDEVANDET11 (https://tide.nki.nl/) bidrage til at nedbryde sanger spor og producere nøjagtige skøn over allel forstyrrelser effektivitet, men samtidig også give frekvenserne af individuelle indels. Den store ulempe er en absolutte afhængighed af høj kvalitet Sanger sekventering spor. Høj overførselshastighed amplikon sekventering overvinder de fleste af disse spørgsmål. Amplikon biblioteker kan tilberedes starter med meget lav DNA indgange og en høj dækning sikrer pålidelige resultater. For at reducere omkostningerne ved amplikon sekventering, spike vi normalt i amplikon biblioteker i større sekventering kører (fx RNA-sekventering) ved hjælp af kun 1-1,5% af den samlede læser. Endelig, for at bekræfte vellykket knockout, vi stærkt anbefaler, vurderingen af protein niveauer af western blotting eller flow flowcytometri, når det er muligt.

Som tidligere beskrevet, den metode, der præsenteres her er hurtig og ligetil og repræsenterer et nyt værktøj til at studere gen knock out mus og menneskelige HSPCs. Mens vores protokol indeholder instruktioner for gen knockout med et tip-baserede elektroporation system, har andre systemer vist sig for at være yderst effektiv12,13.

To store begrænsninger skal anerkendes for så vidt angår RNP tilgang. Først, som beskrevet af vores gruppe, levedygtigheden af HSPCs electroporated med in vitro transskriberet sgRNAs kan være betydeligt kompromitteret af elektroporation, især når betingelserne ikke er optimal6. Hvis det er nødvendigt, kan kommercielt syntetiserede sgRNAs (dvs. fjerne in vitro- transskription) afhjælpe dette problem. Disse bliver billigere med tiden og kan købes fra flere leverandører. I dette scenario, in vitro- transskription kan bruges til at generere en pulje af sgRNA til skærmen for effektivitet, og derefter de mest effektive sgRNA(s) kan vælges til syntese. Den anden store begrænsning af RNP tilgang er den manglende evne til at spore med held transfekteret celler, som viral-baserede tilgange. Høj KO effektivitet og hurtig redigering opnås med Cas9-sgRNA RNPs kan dog opveje disse ulemper i mange eksperimentelle scenarier. Vi anbefaler at bruge høj overførselshastighed amplikon sekventering til præcist bestemme forstyrrelser effektivitet i hvert forsøg. Hvis knock-out af gen af interesse forventes at indebære en proliferativ fænotype (dvs. enten reduceret eller forøget spredning i forhold til wild-type celler), fastlæggelse af indel frekvens på flere tidspunkter tillader en at vurdere hvorvidt KO celler gennemgå berigelse (dvs. indel frekvens øges over tid) eller er outcompeted (dvs. indel hyppigheden aftager over tid).

Udførelse af in vivo eller in vitro- eksperimenter for at forstå de biologiske virkninger af tabet af genfunktioner kræver passende kontrol. Som tidligere nævnt, in vitro- transskriberet sgRNAs kan være giftigt for celler, især primære stamfader celler6. Derudover kan DNA dobbelt-strenget pauser forårsaget af Cas9 protein forårsage gen uafhængige anti-proliferativ svar14. Derfor, vi ofte bruger en række kontrol sgRNAs i CRISPR eksperimenter og anbefaler en celle overflade markør udtrykt på din celletype samt en anden target-gen, der ikke er udtrykt.

Kortfristede kultur af human HSPCs i nærværelse af cytokiner øger gen forstyrrelser effektivitet6 og er nødvendige for at opnå høj effektivitet KO. Vi har fundet 36-48 timer for at være den ideelle periode af kultur før elektroporation6. Efter elektroporation, cellerne kan være yderligere kulturperler holde for øje, at jo længere kultur jo højere risiko for at miste multilineage engraftment kapacitet. Derfor, vi normalt udføre transplantationer 6 timer efter elektroporation og aldrig senere end 24 timer efter elektroporation.

CRISPR/Cas9 har dramatisk forbedret mulighed for videnskabsfolk at held Rediger genomet i pattedyrsceller. Gør gen forstyrrelser mere gennemførlig i primære hæmatopoietisk stamceller er forudsagt til at hurtigt forbedre den videnskabelige viden inden for HSPCs og hæmatologiske sygdomme. Vigtigere, gør protokollen beskrevet her det også muligt at samtidig generere flere knockouts med høj effektivitet, gør det muligt for modellering af komplekse genetiske landskaber, ofte ses i leukemic sygdomme.

Selv om de protokoller er beskrevet heri er fokuseret på gen forstyrrelser, kan de være let tilpasses til gen knock-i forsøg. Dette kan opnås gennem fælles levering af enkeltstrenget oligonukleotid skabeloner til homologi-instrueret reparation6,13 (HDR) eller transduktion af celler post-elektroporation med AAV6 vektorer indeholdende den Homologi skabelon12. Evnen til at reparere eller indføre specifikke mutationer i HSPCs vil lette nye terapeutiske strategier for genterapi og en udvidet undersøgelse af kræft driver mutationer i AML og andre hæmatologiske sygdomme. Mens HDR i menneskelige HSPCs har været succesfulde6,12,13, mus HSPCs har været svært at redigere ved hjælp af denne strategi6. Optimering af HDR protokoller i menneskerettighederne og især i mus HSPCs vil gøre det muligt mere specifikke redigering og udvikling af værktøjer til at spore redigerede celler ved hjælp af endogene tagging.

Endelig er det også forestillede sig, at afbrydelse af mutant gevinst af funktion alleler kunne udgøre en potentiel terapeutisk tilgang til medfødte og erhvervede hæmatopoietisk lidelser. I dette scenario anbefales en DNA-fri tilgang for at undgå mulige integrationer, der kunne fremme transformation. Desuden, den "hit og køre" tilgang reducerer muligheden for uønskede off target effekter. Yderligere indsats er nødvendig for at udvikle specifikke leveringssystemer, der ville åbne nye muligheder for behandling af maligne og ikke-maligne hæmatologiske sygdomme.

Disclosures

Nogen interessekonflikt at videregive

Acknowledgments

Dette arbejde blev støttet af den forebyggelse af kræft og forskning Institut for Texas (RP160283, RP140001 og R1201), Gabrielle's Angel Foundation for kræftforskning, Edward P. Evans Foundation og NIH (DK092883, CA183252, CA125123, P50CA126752, CA193235, og DK107413). M.C.G. er støttet af Baylor forskning fortalere for studerende forskere. Flowcytometri blev delvist støttet af NIH (National Center for Research ressourcer grant S10RR024574, National Institute of Allergy og smitsomme sygdomme AI036211 og National Cancer Institute P30CA125123) for Baylor College of Medicine Flowcytometri og celle sortering kerne.

Materials

Name Company Catalog Number Comments
Tissue culture plates according to cell numbers
1.5 ml Eppendorf microtubes Sigma Z606340-1000EA
50ml Falcon tubes Corning 352070
Nuclease Free Water - DEPC treated ThermoFisher Scientific AM9915G
KAPA HiFi HotStart ReadyMix (2X) KAPA Biosystems KK2600
MinElute PCR purification Kit Qiagen 28004
RNAse Zap RNAse Decontamination Solution ThermoFisher Scientific AM9780
RNA Clean and Concentrator-25 Zymo R1017
HiScribe T7 High Yield RNA Synthesis Kit New England Biolabs E2040S
Alt-R S.p. Cas9 Nuclease 3NLS, 100 µg IDT 1074181
40 mm Cell Strainers VWR 352340
Dulbecco's Phosphate Buffered Saline (PBS) GenDEPOT CA008-050
Fetal Bovine Serum (FBS), Regular Corning 35010CV
AutoMACS Pro Separator or MACS manual Cell Separation columns Miltenyi
Neon Transfection System Device ThermoFisher Scientific
Neon Transfection System 10mL kit ThermoFisher Scientific MPK1025 For larger numbers of cells (see protocol) Neon Transfection System 100 mL kit (# MPK10025) can be used
Name Company Catalog Number Comments
UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific 15575020 For human experiments only
Lymphoprep Stem Cell Technologies 7851 For human experiments only
CD34 MicroBead Kit UltraPure human Miltenyi Biotec 130-100-453 For human experiments only
Stem Span SFEM II Stem Cell Technologies 9605 For human experiments only
Recombinant Human SCF Miltenyi Biotec 130-096-695 For human experiments only
Recombinant Human TPO Miltenyi Biotec 130-094-013 For human experiments only
Recombinant Human FLT3L Miltenyi Biotec 130-096-479 For human experiments only
Name Company Catalog Number Comments
Mouse dissection tools For mouse experiments only
Mortar and Pestle For mouse experiments only
Hank's Balanced Salt Solution (HBSS) Gibco 14170112 For mouse experiments only
Biotin-conjugated anti c-kit antibody eBioscience 13-1171-82 For mouse experiments only
Anti-Biotin MicroBeads Miltenyi Biotec 130-090-485 For mouse experiments only
X VIVO-15, with L-Glutamine, Genatmycin and Phenol Red Lonza 04-418Q For mouse experiments only
Mouse IL-6 Peprotech 216-16 For mouse experiments only
Mouse TPO Peprotech 315-14 For mouse experiments only
Mouse IL-3 Peprotech 213-13 For mouse experiments only
Mouse SCF Peprotech 250-03 For mouse experiments only

DOWNLOAD MATERIALS LIST

References

  1. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, 816-821 (2012).
  2. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  3. Sternberg, S. H., Doudna, J. A. Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell. 58, 568-574 (2015).
  4. Heckl, D., et al. Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 32, 941-946 (2014).
  5. Mandal, P. K., et al. Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell stem cell. 15, 643-652 (2014).
  6. Gundry, M. C., et al. Highly Efficient Genome Editing of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. Cell Rep. 17, 1453-1461 (2016).
  7. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24, 1012-1019 (2014).
  8. Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature methods. 12, 982-988 (2015).
  9. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Current protocols in immunology. 111, A3 B 1-3 (2015).
  10. Lykke-Andersen, S., Jensen, T. H. Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol. 16, 665-677 (2015).
  11. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 42, e168 (2014).
  12. Dever, D. P., et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells. Nature. 539, 384-389 (2016).
  13. DeWitt, M. A., et al. Selection-free genome editing of the sickle mutation in human adult hematopoietic stem/progenitor cells. Sci Transl Med. 8, 360ra134 (2016).
  14. Aguirre, A. J., et al. Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting. Cancer Discov. 6, 914-929 (2016).
Højeffektive gen afbrydelse af Murine og menneskelige hæmatopoietisk stamceller ved CRISPR/Cas9
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).More

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter