Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Perturbation de gène hautement efficace des cellules progénitrices hématopoïétiques murins et humains par CRISPR/Cas9

doi: 10.3791/57278 Published: April 10, 2018
* These authors contributed equally

Summary

Un protocole pour rapide CRISPR/Cas9-mediated disruption de génique chez la souris et des cellules hématopoïétiques humaines primaires est décrit dans cet article. Ribonucléoprotéines Cas9-sgRNA sont introduits par électroporation avec sgRNAs des vicitimes in vitro de transcription et commerciale Cas9. Édition de hautes efficacités sont réalisées avec peu de temps et de coût financier.

Abstract

Avancées dans le domaine des cellules souches hématopoïétiques (CSH) ont été aidées par des méthodes à l’ingénieur génétiquement les cellules progénitrices primaire ainsi que des modèles animaux. L’ablation complète du gène dans les CSH requis la génération de souris knock-out d'où autorenouveler a pu être isolé, et ablation de gène en primaire autorenouveler humaine n’a pas été possible. Transduction virale pourrait être utilisée pour des approches de précipitation, mais il souffraient d’une efficacité variable. En générale manipulation génétique de l’homme et de cellules hématopoïétiques de souris a été entravées par la faible efficacité et beaucoup de temps et des engagements en coûts. Récemment, CRISPR/Cas9 a considérablement étendu la capacité de l’ingénieur de l’ADN des cellules de mammifères. Toutefois, l’application de CRISPR/Cas9 aux cellules hématopoïétiques a été difficile, principalement en raison de leur efficacité de transfection faible, la toxicité des approches axées sur le plasmide et le délai d’exécution lente des protocoles à base de virus.

Une méthode rapide pour exécuter CRISPR/Cas9-mediated gene édition progénitrices et souches hématopoïétiques murins et humains avec des efficacités de knockout jusqu'à 90 % des cellules est fournie dans cet article. Cette approche utilise une stratégie de prestation des ribonucléoprotéines (RNP) avec un flux de travail rationalisé de trois jours. L’utilisation de Cas9-sgRNA RNP permet une approche de délit de fuite, ne présentant aucune des séquences d’ADN exogènes dans le génome des cellules édités et réduction des effets hors cible. Méthode de la RNP est rapide et simple : il ne nécessite pas de clonage de sgRNAs, de préparation de virus ou de modifications chimiques spécifiques sgRNA. Avec ce protocole, les scientifiques doivent être capables de générer des coups de grâce d’un gène d’intérêt dans les cellules hématopoïétiques primaires avec succès dans la semaine, y compris les temps d’arrêt pour la synthèse d’oligonucléotide. Cette approche permettra à un groupe beaucoup plus large des utilisateurs d’adapter ce protocole pour leurs besoins.

Introduction

L’avènement de CRISPR/Cas9 a radicalement simplifié édition de gène dans les cellules de mammifères. Les premiers CRISPR/Cas9 protocoles utilisés plasmide ou la prestation de base de virus de Cas9 protéine et sgRNA1,2,3. Ces approches s’est avéré révolutionnaires pour le développement de modèles cellulaires et animaux et ont été appliquées avec succès au primaire hématopoïétiques souches et progénitrices cellules (HSPCs)4,5. Cependant, ces méthodes présentent un certain nombre d’inconvénients. Tout d’abord, efficacité de perturbation gène reste souvent inférieur à 50 %4,5. Alors que cela est suffisant pour générer des clones knockout (KO) dans les lignées cellulaires, la nécessité d’une culture à court terme fait HSPCs ne se prêtent pas à une telle stratégie. Deuxièmement, l’exigence pour le clonage limite la quantité de sgRNAs qui peuvent être testés dans des expériences simples et génère de gros, difficile à transfecter constructions. En troisième lieu, ces approches forcent les scientifiques pour ralentir le temps de rotation.

Afin de surmonter ces limitations, notre groupe a développé et a récemment publié une autre approche CRISPR/Cas9 dans HSPCs à l’aide de Cas9-sgRNA ribonucléoprotéines (RNP)-basée de livraison6. Dans cette stratégie, les composants bruts de CRISPR (protéine Cas9 et in vitro transcrit sgRNA) sont pré-complexé et livrés directement dans les cellules cibles par électroporation (Figure 1). Comme la demi-vie du complexe RNP Cas9-sgRNA est plus courte que le temps ce plasmide ou l’acide nucléique viral est transcrit, le taux hors cible est plus faible comparativement aux premières approches7. En outre, l’approche RNP ajoute l’avantage d’éliminer toute source d’ADN exogène, ce qui permet d’intégrer au hasard dans le génome de cellules de cible conduisant à la transformation cellulaire.

Ce protocole est basé sur un flux de travail rationalisé pour expériences de disruption génique à base RNP, représentée dans la Figure 1. La première étape est conception et commande des amorces pour chaque sgRNA. Ces amorces sont utilisées pour créer des modèles d’ADN de sgRNA qui sont utilisées pour la transcription in vitro (IVT) pour obtenir la sgRNAs. SgRNAs purifiées sont ensuite incubées avec des protéines de Cas9 précédemment achetés, pour former Cas9-sgRNA des complexes RNP. Enfin, pré-complexé Cas9-sgRNA RNP est électroporation dans les cellules. Suite d’électroporation, efficacité d’édition peut être testée et in vitro/in vivo des expériences peuvent être démarrés, selon les besoins. Ci-dessous une description détaillée de cette approche expérimentale novatrice peut être trouvée.

Protocol

Le protocole suit les directives du Comité de l’éthique humaine Baylor College of Medicine. Toutes les procédures expérimentales effectuées sur des souris sont approuvés par le Baylor College of Medicine Institutional Animal Care et Comité d’urbanisme.

1. sgRNA Design Fwd

  1. Naviguez jusqu'à http://www.crisprscan.org/?page=track8 pour commencer la conception sgRNAs d’intérêt.
  2. Cliquez sur la « Souris » ou « Humaine » selon le type de cellules d’intérêt.
  3. Le gène d’intérêt dans la zone de recherche UCSC et appuyez sur go.
  4. Zoomer et se déplacer dans la région du gène (i.e. un exon spécifique) qui est d’un intérêt à la cible.
    Remarque : Réaliser la disruption génique efficace, qu'il est recommandé de cibler les premiers exon(s) présents dans toutes les isoformes transcrits dans votre type de cellule spécifique.
  5. Assurez-vous que les séquences de cible potentielle sgRNA sont répertoriés sous un « prédictions CRISPRscan sur les gènes (CD) » rubrique.
  6. Recherchez et cliquez sur une séquence cible avec un score relativement élevé et quelques hors-cibles (surlignées en vert clair). Copier la séquence complète affichée sous la rubrique « Séquence d’Oligo » et collez-le dans un document texte. Ajoutez « ATAGC » à l’extrémité 3' de la séquence. Une fois terminé, passer la commande de la séquence de pleine longueur.
    Remarque : Pour chaque séquence cible, CRISPRscan8 fournit un apprêt sgRNA avant « intégrée » qui inclut le promoteur T7, la séquence protospacer (cible) et la séquence de recouvrement échafaudage universel (voir Figure 1 a). Une séquence pleine longueur faite de nucléotides soit 56 ou 57 selon la longueur de protospacer.

2. sgRNA modèle de synthèse de l’ADN

  1. Dissoudre et compléter la sgRNA Fwd et amorce universelle de Rev (voir le tableau 1 pour la séquence complète). Afin d’obtenir une concentration finale de 10 µM, suivez les instructions du fabricant diluer les amorces à 100 µM, puis faire un 01:10 dilution avec de l’eau exempte de nucléase.
  2. Pour effectuer le recoupement PCR mix (voir Figure 1 b), ce qui suit dans des tubes PCR bande : 2 µL avant sgRNA primer (10 µM), amorce d’universel Rev échafaudage 2 µL (HPLC purifié) (10 µM), 10 µL haute fidélité ADN polymérase master mix (2 x) et eau exempte de nucléase de 6 µL.
  3. Exécutez le PCR avec le programme suivant : 95 ° C pendant 3 min, 98 ° C pendant 5 s, 60 ° C pendant 5 s, 72 ° C pendant 10 s, passer de 2 à 6 cycles, 72 ° C pendant 1 min, 4 ° C pour toujours.
  4. Purifier le produit de la PCR à l’aide de colonnes de purification de l’ADN (voir la Table des matières). Suivez les instructions du fabricant et éluer avec 11,5 µL de tampon d’élution.
  5. Mesurer la concentration des produits PCR sur un spectrophotomètre. Vierges de l’instrument avec un tampon d’élution.
    Remarque : La concentration d’ADN devrait être entre 50 ~ et ~ 120 ng/µL.

3. in Vitro de Transcription de sgRNA

  1. Mélanger les composants suivants dans les tubes de la bande PCR (les réactifs sont fournis dans le kit de la synthèse d’ARN) : 4 µL d’ADN éluée, 4 µL des dNTPs, 1 µL de la mémoire tampon de réaction 10 x et 1 µL de mélange enzymatique de T7 RNA polymérase.
  2. Incuber les échantillons à 37 ° C pendant au moins 4 h.
  3. Appliquer le produit de nettoyage de RNase pour supprimer la RNase de mains gantées.
  4. Chaque échantillon de RNA jusqu'à un volume total de 50 µL d’eau exempte de nucléase (première étape de purification RNA suivant instructions du fabricant).
  5. Procéder à la purification de RNA suivant instructions du fabricant et éluer dans 50 µL d’eau exempte de nucléase de kit fourni.
  6. Mesurer la concentration de le sgRNA éluée sur un spectrophotomètre. Vierges de l’instrument avec de l’eau exempte de nucléase.
    Remarque : Le rendement attendu après purification est de 50-80 µg d’ARN (c'est-à-dire la concentration de 1,0 à 1,5 µg/µL).
  7. Utilisez le sgRNA purifié immédiatement ou stocker dans des parties aliquotes de 2-4 µL à-80 ° C pour le long terme.

4. culture et isolement HSPC

  1. Culture et murin HSPCs isolation
    Remarque : Souris mâles et femelles de Ubc-GFP (JAX004353) et Rosa26-LSL-tdTomato (JAX007914) croisé avec le Vav-iCre (JAX008610) à l’âge de 2 à 6 mois ont été utilisés pour obtenir les résultats ci-dessous.
    1. Euthanasier souris anesthésiés par dislocation cervicale.
      Remarque : Deux personnes formées devraient vérifier de façon indépendante l’euthanasie réussie en notant l’absence de respiration et rythme cardiaque pendant au moins 5 min. enlever la peau des animaux.
    2. Disséquer les tibias, fémurs et crêtes iliaques des souris et supprimer tous les muscles et du tissu conjonctif autour des os disséqués. Placez les os intacts dans un plat de culture tissulaire sur la glace avec HBSS additionné de 2 % SVF (HBSS +). Se déplacer d’une hotte à flux laminaire dès qu’al les os ont été nettoyés et transférés dans la boîte de culture de tissus.
    3. Transfert nettoyé bones au mortier stérile, contenant 2 mL glacee HBSS + par 3 OS. À l’aide du pilon, écraser os dans des fragments d’os, libérant la moelle osseuse d’intérieur. Continuer pestling jusqu'à l’OS arrêt fissuration sous le pilon.
    4. Recueillir le surnageant du mortier et filtre dans un tube conique de 50 mL à l’aide d’une passoire de cellule de 40 µm. Rincer les restes osseux avec 5 mL glacee HBSS + et le filtre dans le même tube conique de 50 mL en utilisant le même filtre de 40 µm.
    5. Laver les cellules deux fois en tête du tube avec glacee HBSS + et centrifugation à 400 g pendant 7 min. jeter le surnageant.
    6. Après le second lavage Resuspendre le culot cellulaire dans 20 mL de PBS froid de glace. Compter les cellules viables par exclusion bleu trypan-9.
    7. Incuber 1 x 108 cellules viables / mL 1 glacee HBSS + avec anticorps de c-kit biotine conjugué à une dilution au 1/100 pendant 45 min sur la glace.
    8. Laver les cellules avec glacee HBSS + par centrifugation à 400 g pendant 7 min et jeter le surnageant.
    9. Incuber les cellules avec billes magnétiques anti-biotine, suivant les instructions du fabricant.
    10. Isoler les cellules positives c-kit, à l’aide de colonnes magnétiques ou trieurs magnétiques-lancée de cellules suivant les instructions du fabricant. Prélever des cellules positives c-kit dans les tubes coniques 15 mL.
    11. Laver les cellules deux fois avec du PBS en garnissant le tube conique 15 mL et centrifugation à 400 g pendant 7 min. éliminer le surnageant. Entre les deux lavages, calculer le nombre total de cellules viables par le bleu trypan exclusion9.
    12. Resuspendre le c-kit + cellules à une concentration de 106 viablecells par 100 µL de milieu de culture pour murins HSPCs additionné de 2 % FBS, facteur des cellules souches de souris ng/mL 50 (SCF), 50 ng/mL souris thrombopoïétine (TPO), 10 ng/mL souris IL-3 et la souris IL-6 de 10 ng/mL.
    13. Incuber les cellules à 37 ° C, 5 % de CO2 pendant au moins 1 h pour un maximum de 24 h avant l’électroporation.
  2. Culture et isolement de HSPCs humaine
    Remarque : Ces étapes doivent être effectuées dans une hotte à flux laminaire.
    1. Filtrer les cellules sanguines de la moelle osseuse/cordon à travers un tamis de cellule de 40 µm.
    2. Diluer 1:2 les cellules de sang de moelle osseuse/cordon filtré avec du PBS additionné de 1 mM EDTA (EDTA/PBS).
    3. Diluer 15 mL de milieu de gradient de densité dans un tube conique de 50 mL. Doucement, verser 30 mL du sang de cordon médullaire dilué sur la surface du gradient de densité moyenne. Si le volume de suspension cellulaire est supérieur à 30 mL préparer plusieurs tubes.
      Remarque : Assurez-vous de conserver l’interface entre le sang et le milieu de gradient de densité plus net possible.
    4. Faites tourner les tubes à 750 g pendant 30 min avec aucun ralentissement.
    5. Recueillir la couche de cellules mononucléées détectable à l’interface du médium et le transfert d’un tube conique propre de 50 mL. Remplir le tube avec PBS/EDTA et faire tourner les cellules à 280 g pendant 15 min. jeter le surnageant.
    6. Laver les cellules deux fois dans la filature de PBS/EDTA à 400 g pendant 7 min et jeter le surnageant.
    7. Incuber les cellules mononucléaires avec billes magnétiques anti-CD34, suivant les instructions du fabricant.
    8. Isoler les cellules CD34 + à l’aide de colonnes magnétiques ou trieurs magnétiques-lancée de cellules suivant les instructions du fabricant. Prélever des cellules CD34 + dans les tubes coniques 15 mL.
    9. Lavage recueillies cellules CD34 + deux fois par la garniture du tube avec du PBS et tournant à 400 g pendant 7 minutes et jeter le surnageant. Entre les deux lavages, calculer le nombre total de cellules viables par le bleu trypan exclusion9.
    10. Remettre en suspension les cellules dans un milieu de culture additionné de 100 ng/mL humaine SCF, 100 ligand de FLT3 humaine ng/mL (FLT3L), 100 ng/mL TPO humaine à une concentration de ~2.5 x 105 cellules viables / ml. Culture isolée de cellules CD34 + à 37 ° C, 5 % de CO2 pendant 24 h à une avant maximum 48 h d’électroporation.
      Remarque : Avant l’électroporation vérifier la pureté de population CD34 + enrichie par cytométrie en flux.

5. électroporation

Remarque : Le protocole suivant est optimisé pour les 10 conseils d’électroporation µL. Toutes les mesures doivent être effectuées sous une hotte à flux laminaire.

  1. Compter les cellules par le bleu trypan exclusion9. Recueillir les 2 x 105 cellules viables par réplicat (p.ex. frais virés 6 x 105 cellules pour 3 électroporations).
  2. Les cellules se laver deux fois avec du PBS, tournant à 300 x g pendant 7 min et soigneusement retirer le surnageant.
  3. En parallèle, préparer des complexes de Cas9-sgRNA RNP en incubant en tubes PCR pendant 20-30 min à RT 1,5 µg Cas9 avec 1 µg de sgRNA total pour chaque répétition, sauf le seul contrôle de Cas9.
    Remarque : Protéine de Cas9 est fournie à 10 µg/µl concentration. Afin de pipetage précis, diluer à 01:10 la quantité totale de protéines Cas9 nécessaire avec de l’eau exempte de nucléase (par exemple pour 10 électroporations prendre 1 µl de Cas9 protéine et diluez-la avec 9 µl d’eau exempte de nucléase et incuber 1 µl de Cas9 dilué par réplicat. Selon la concentration de la sgRNA, le volume total de Cas9 et sgRNA devrait être compris entre 1,7 et 2 µl par réplicat. Si vous utilisez deux sgRNAs incuber 500 ng de chaque sgRNA par réplicat ; Si vous utilisez 3 sgRNAs incuber 330 ng de chaque sgRNA par réplique et ainsi de suite.
  4. Calculer le volume total de resuspension T tampon nécessaire en multipliant 10 µL par le nombre de total réplique nécessaire (par exemple 30 µL de 3 répétitions). Remettre en suspension les cellules granulés avec le volume calculé du tampon T. s’assurer que la concentration finale de la suspension cellulaire est de 2 x 107 cellules/mL.
  5. Aliquote 10 µL de cellules/replicate resuspendue dans chaque tube PCR contenant le pre-complexé sgRNA/Cas9 RNP (par exemple un triple aliquote 30 μL de suspension de cellules dans un tube PCR contenant pré-complexé Cas9-sgRNA).
  6. De mettre en place le système d’électroporation mettre l’instrument sous tension et ajouter 3 mL de tampon E dans une cupule d’électroporation et glissez la cuvette dans le support de cuve.
  7. Défini les conditions d’électroporation désiré périphérique : HSPCs humaines (1600 V, 10 ms, 3 impulsions) ou HSPCs (1700 V, 20 ms, 1 impulsion) de la souris.
    Remarque : Si vous le souhaitez, avant d’effectuer des expériences de CD34 + HSPCs, sgRNA l’efficacité peut être testée sur des lignées de cellules de la leucémie myéloïde aiguë (AML) (p. ex. HL60) en utilisant la même stratégie (utilisation moyenne sans antibiotiques pour les lignées cellulaires AML) dans les conditions suivantes d’électroporation : Tampon R, V, 35 ms, 1 impulsion de 1350.
  8. L’électroporation est réalisée avec une pipette spéciale électroporation, qui a une griffe qui s’enclenche à l’embout de la pipette d’électroporation. Tenir la pipette d’électroporation, étendre la griffe, prenez le disque à l’intérieur de l’embout de la pipette et puis appuyez fermement sur la pipette pour fixer la pointe.
  9. Déposer l’échantillon de haut en bas 10 fois pour mélanger. Retirez 10 µL, assurant qu’il n’y a pas de bulles et insérer l’embout de la pipette directement dans le tampon électrolytique dans la cuvette d’électroporation. Essayez de ne pas toucher les parois de la cuve. Sur l’écran, appuyez sur « Démarrer ». Après que le message « terminé » s’affiche, retirer la pipette et verser le contenu dans le puits avec le nouveau milieu de culture HSPC.
  10. Répétez pour tous les échantillons. Pipette de changement conseils entre les échantillons, seulement si nécessaire.

Representative Results

Le but du présent protocole est d’effectuer des knockout (KO) de la gène chez la souris et HSPCs humains à l’aide de Cas9-sgRNA RNP. Le flux de travail est facile et rapide et permet à l’achèvement des expériences en moins d’une semaine de conception expérimentale pour l’évaluation de l’efficacité KO.

Par rapport aux approches à base de virus ou de plasmide, la réussite de notre protocole s’appuie sur la combinaison de sgRNA RNP et électroporation. Cette stratégie de clonage sans raccourcit considérablement le temps nécessaire pour obtenir les composants pour transfecter. En outre, électroporation permet pour la transfection jusqu'à 95 % des cellules, maximiser la livraison de la RNP. sgRNAs peut être synthétisée en laboratoire par le biais de in vitro de transcription (IVT), tandis que la protéine purifiée de Cas9 peut être acheté auprès de plusieurs sociétés ( Voir le protocole). sgRNA matrices d’ADN pour IVT sont obtenus en effectuant une courte PCR à l’aide de la sgRNA ta primer (Figure 1 a, B) et l’universel d’échafaudage Rev primer (Figure 1 b - Voir le protocole). Le produit PCR sert ensuite comme un modèle pour l’IVT (Figure 1). Complexes de Cas9-sgRNA RNP sont générés en incubant pendant 15-30 minutes, le sgRNAs et le Cas9 (Figure 1). Enfin, sgRNA RNP est électroporation dans les cellules. Édité HSPCs permet ensuite d’effectuer des expériences in vitro et in vivo .

Perturbation de gène dans les cellules de souris

Pour démontrer l’efficacité de la stratégie d’électroporation de RNP Cas9-sgRNA, c-kit + HSPCs isolés de souris exprimant ubiquitaire GFP ou tdTomato ont été électroporés avec sgRNA contre GFP ou tdTomato. Parmi les trois sgRNA conçu contre GFP, GFP sg1 effectuer efficacement, présentant environ 70-75 % de perturbation de l’expression de la GFP tel que déterminé par cytométrie en flux (Figure 2 a, B). Afin de quantifier la fréquence de rupture de gène au niveau génomique, l’ADN génomique des cellules électroporation a été isolé et T7 endonucléase j’ai (T7EI) analyse a été réalisée. Comme le montre la Figure 2, T7EI test détectée jusqu'à à 60 % indel formation. Notez que les dosages T7EI ont tendance à sous-estimer les fréquences des indels. Nous avons également généré sgRNA contre HSPCs tdTomato et électroporation exprimant tdTomato du locus Rosa26. Comme le montre la Figure 2D, tdTomato sg1 ablation efficacement l’expression de tdTomato.

Perturbation de gène dans les cellules humaines

Ici, la perturbation efficace obtenue avec une approche unique sgRNA ciblage CD45, un marqueur de surface cellulaire exprimé sur les cellules hématopoïétiques, est présentée. Trois sgRNAs ciblant différents exons de CD45 ont été conçus (CD45 sg1, sg2 et sg3). L’efficacité de la sgRNAs a été testée dans la lignée de cellules HL60 AML (Figure 3 a). Protéine KO a été mesurée par cytométrie à 5 jours après l’électroporation. CD45 sg1 a été la plus efficace (98 % KO efficacité - Figure 3 a) et a été utilisé pour d’autres expériences. Figure 3 b présente CD45 KO CD34 + progénitrices des cellules humaines primaires à l’aide de CD45 sg1, mesurée par cytométrie 5 jours après l’électroporation. Tandis que CD34 expression n’est pas affectée, expression de CD45 a été perdue à environ 80 % des cellules. 200,000 cellules CD34 + primaires édités ont été transplantées rétro-orbitalement souris NSG 6 heures après l’électroporation. La moelle osseuse et des cellules de la rate ont été récoltés à 3 mois après la transplantation. Cellules édités (HLA-ABC positive et négative de CD45, surligné en rouge) ne sont détectables que dans des échantillons de sgRNA traité et non chez Cas9 seuls témoins (Figure 3).

Si vous le souhaitez, ciblant les deux sgRNAs à proximité de séquences peut servir à générer des destructions. Cette approche permet une estimation rapide de l’efficacité d’édition avec un PCR et produit souvent une plus grande efficacité de perturbation. Figure 3D montre la production efficace d’une délétion de bp 58 dans l’exon 10 de DNMT3A. édité 200,000 cellules CD34 + ont été transplantés dans des souris NSG 6 heures après l’électroporation. La suppression de bp 58 était clairement détectés dans le sang périphérique de souris NSG implantées 5 mois après injections (Figure 3E) confirmant la modification de cellules CD34 + avec des capacités de prise de greffe à long terme.

Figure 1
Figure 1 : l’approche rapide et facile de générer sgRNA RNP. A) représentation de la sgRNA ta primer. La sgRNA ta primer est un oligonucléotide ADN contenant le promoteur T7, la séquence protospacer et une séquence de chevauchement avec l’échafaudage sgRNA. À la 3' extrémité, surlignée en rouge, est la séquence « ATAGC » qui doit être ajouté à la séquence d’amorce de Fwd sgRNA obtenue sur CRISPRscan. B) représentation schématique du chevauchement PCR réalisée pour obtenir le modèle IVT. Le chevauchement entre l’amorce de ta sgRNA et l’apprêt universel échafaudage Rev permet l’extension et l’amplification par PCR. C) bande dessinée décrivant la réaction d’IVT et le pré-complexants sgRNA RNP. Le produit PCR est purifié et utilisé comme modèle pour l’IVT. IVT génère une grande quantité de sgRNAs qui peut être utilisé en plusieurs exemplaires (voir le protocole). sgRNA RNP est générés en incubant le sgRNA purifiée à partir d’IVT et la protéine de Cas9 déjà achetée. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : disruption de génique efficace dans les cellules progénitrices hématopoïétiques souris. A) un sgRNA ciblage GFP (GFP sg1) ainsi que de la protéine Cas9 était électroporation dans murin c-kit + HSPCs exprimant la GFP et analysés par cytométrie en flux 24 heures après l’électroporation. B) quantité différente de GFP sg1 est complexée avec 1 µg de protéines Cas9 et électroporation. Aussi peu que 200 ng de GFP sg1 ablation efficacement d’expression de la GFP. C) T7EI test réalisé sur l’ADN génomique isolé de cellules utilisées dans A-B. PCR amplicon s’étendant sur le site de clivage de Cas9-sgRNA a été dilué 1:4 en 1 x tampon 2 et hybridée lentement dans un thermocycleur. Des fragments hybrides sont digérés puis avec 1,25 U de T7 endonucléase j’ai pendant 10 minutes à 37 ° C. Des fragments digérés sont séparés par électrophorèse sur gel de polyacrylamide. Intensités de bande ont été analysées à l’aide de logiciels ImageJ en traçant des intensités de bande de chaque couloir. clivage % a été calculé par le rapport entre les intensités des bandes clivées aux bandes clivés. D) c-kit + HSPCs isolés de souris exprimant tdTomato était électroporation avec protéine Cas9 complexé avec sgRNA contre tdTomato. Cytométrie en flux effectuées 24 heures après que électroporation a révélé qu’environ 74 % des cellules de supprimer tdTomato. R26 = Rosa26. * p < 0,05, ** p < 0,01, *** p < 0,001. Ce chiffre a été adapté de Gundry et al. 6 S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : disruption de génique efficace dans les cellules hématopoïétiques humaines. A) trois sgRNAs ciblage CD45 (CD45 sg1, sg2 et sg3) ont été conçus et testés dans la lignée de cellules HL60 AML (voir le protocole pour conditions d’électroporation). Cytométrie en flux a été réalisée 5 jours après l’électroporation. CD45 sg1 a été choisi comme le plus efficace entre les trois sgRNAs (KO efficacité de 98 %). B) CD45 KO en primaire homme cordon sang CD34 + HSPCs à l’aide de CD45 sg1. CD45 perte peut être détecté chez environ 80 % des cellules. Notez que l’expression CD34 est inchangée après la modification. C) sous la direction HSPCs humaines peuvent efficacement être greffés à des souris NSG. Des cellules nucléées humaines affichent le HLA normal + / CD45 + phénotype en Cas9 uniquement implanté des souris, alors que chez les souris greffés avec CD45-sg1 cellules CD34 +, les deux HLA + / CD45 + et HLA + / CD45-populations sont observées, indiquant la greffe de cellules humaines de CD45 KO. D) gel d’agarose 2 % montrant une délétion bp 58 générés par 2 sgRNAs (approche guide double) dans l’exon 10 de DNMT3A dans la HSPCs humaines, du sang de cordon différents 3 (CB1, CB2 et CB3). PCR a été réalisée 3 jours après l’électroporation. E) gel d’agarose de 2 % démontrant la persistance de la suppression de bp 58 5 mois après la transplantation chez des souris NSG. Ce chiffre a été adapté de Gundry et al. 6 S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Oligonucléotide Séquence Remarque
Apprêt universel Rev échafaudage gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct L’amorce universelle inverse pour chevaucher PCR
hCD45 sgRNA 1 taatacgactcactataGGTGCTGGTGTTGGGCGCACgttttagagctagaaatagc sgRNA séquence apprêt Fwd chevauchement PCR
hCD45 sgRNA 2 taatacgactcactataGGGAGCAAGTGAGGATCCTCgttttagagctagaaatagc sgRNA séquence apprêt Fwd chevauchement PCR
hCD45 sgRNA 3 taatacgactcactataGGGATGCTTGTTCCCTTCAGgttttagagctagaaatagc sgRNA séquence apprêt Fwd chevauchement PCR
hDNMT3A Ex10 sg1 taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA séquence apprêt Fwd chevauchement PCR
hDNMT3A Ex10 sg2 taatacgactcactataGGGTGGCCAGCAGCCGCGCGgttttagagctagaaatagc sgRNA séquence apprêt Fwd chevauchement PCR
Rosa26 sgRNA taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA séquence apprêt Fwd chevauchement PCR
GFP sg1 taatacgactcactataGGGCGAGGAGCTGTTCACCGgttttagagctagaaatagc sgRNA séquence apprêt Fwd chevauchement PCR
tdTomato sg1 taatacgactcactataGGGGTACAGGCGCTCGGTGGgtttaagagctagaaatagc sgRNA séquence apprêt Fwd chevauchement PCR

Tableau 1 : Toutes les séquences des amorces de Fwd sgRNA utilisés dans les expériences et l’apprêt universel Rev.

Discussion

L’approche de RNP décrite dans le présent protocole détaillé permet de knock-out du gène efficace en souris et primaire des cellules hématopoïétiques humaines ainsi que dans des lignées cellulaires de suspension. Bien que les rendements très élevés de KO sont souvent obtenus, plusieurs variables critiques doivent être examinées. Tout d’abord, choix exon correcte est essentielle afin de garantir que l’incorporation efficace indel correspond à Knock-out du gène. Deux facteurs importants liés au choix de l’exon sont conservation à travers les isoformes et exon position dans les transcriptions. Modèles d’expression de l’isoforme sont variables dans l’ensemble de types de cellules, donc si gène KO dans l’ensemble de types de cellules est souhaitée, les exons qui sont invariants entre cellule types devraient être ciblées. Isoforme patrons peuvent être vérifiées à l’aide de q-PCR ou données de RNA-sequencing. Pour poste exon dans les relevés de notes, il est préférable de cibler les premiers exons comme mutations de déphasage dans le terminal ou avant-dernière exon peut échapper à la désintégration induite par le non-sens10, produisant des protéines avec roman ou fonctions inconnues plutôt que de véritables valeurs NULL.

Déterminer l’indel fréquence est une étape cruciale pour évaluer l’efficacité de KO et d’interpréter correctement les résultats biologiques de l’expérience. Les tests d’endonucléases (p. ex. test d’arpenteur) ont l’avantage d’être relativement rapide et facile à exécuter. Cependant, ils ont tendance à être inexact en raison des signaux de fond importants et les résultats sont souvent difficiles à reproduire. En outre, ils ne fournissent pas d’informations sur la qualité des indels générée (par exemple la longueur des insertions et suppressions) dans l’expérience. Sanger séquençage offre une alternative intéressante aux déterminations de l’endonucléase. Plates-formes telles que TIDE11 (https://tide.nki.nl/) aident à décomposer les traces de sanger et produire des estimations précises de l’efficacité perturbation allélique, tout en offrant les fréquences des indels individuels. L’inconvénient majeur est une dépendance absolue sur les traces de séquençage Sanger haute qualité. Séquençage haut débit amplicon surmonte la plupart de ces questions. Bibliothèques de l’amplicon peuvent être préparés en commençant par le très faible niveau d’intrants ADN et la couverture élevée garantit des résultats fiables. Pour réduire le coût du séquençage de l’amplicon, nous doper habituellement dans les bibliothèques de l’amplicon dans les plus grandes pistes de séquençage (p. ex. RNA-sequencing) en utilisant seulement 1 à 1,5 % du total se lit. Enfin, pour confirmer le succès knockout, nous fortement recommande d’évaluer le niveau de protéine par transfert western ou cytométrie en flux, lorsque cela est possible.

Comme décrit précédemment, la méthode présentée ici est rapide et simple et représente un nouvel outil pour étudier le gène assommer dans les souris et les humains HSPCs. Alors que notre protocole fournit des instructions pour knock-out du gène avec un système d’électroporation axée sur la pointe, autres systèmes ont été démontrés pour être très efficace12,13.

Deux principales limites doivent être reconnus en ce qui concerne l’approche RNP. Tout d’abord, comme décrit par notre groupe, la viabilité de l’électroporation HSPCs avec in vitro transcrit sgRNAs peut être significativement compromise par électroporation, surtout lorsque les conditions ne sont pas optimales6. Si nécessaire, sgRNAs synthétisés dans le commerce (c.-à-d. éliminer in vitro le transcription) peut surmonter ce problème. Ceux-ci deviennent moins chers avec le temps et peuvent être achetés auprès de plusieurs fournisseurs. Dans ce scénario, in vitro de transcription pourrait être utilisée pour générer une piscine de sgRNA à l’écran pour l’efficacité, et puis le sgRNA(s) plus efficace peut être sélectionné pour la synthèse. La deuxième limitation majeure de la démarche de RNP est l’impossibilité d’effectuer le suivi des cellules transfectées avec succès, comme dans l’approche axée sur le viral. Toutefois, la haute efficacité de KO et montage rapide obtenu avec Cas9-sgRNA RNP peuvent l’emporter sur ces inconvénients dans de nombreux scénarios expérimentaux. Nous recommandons l’utilisation de séquençage haut débit amplicon pour déterminer exactement l’efficacité de la perturbation dans chaque expérience. Si l’entrée défonçable du gène d’intérêt est censée conférer un phénotype prolifératif (soit augmenté ou diminué par rapport aux cellules de type sauvage de la prolifération), déterminer la fréquence d’indel à plusieurs points dans le temps permet d’évaluer si KO cellules objet d’enrichissement (c.-à-d. indel fréquence augmente au fil du temps) ou sont surpassés (i.e. indel fréquence diminue avec le temps).

Des expériences in vivo ou in vitro afin de comprendre les effets biologiques de la perte de la fonction du gène nécessite les contrôles appropriés. Tel que mentionné précédemment, en vitro transcrit sgRNAs peuvent être toxiques pour les cellules, les cellules progénitrices surtout primaire6. En outre, cassures double brin de l’ADN provoquées par Cas9 protéine peuvent provoquer gène indépendant anti-prolifératives réponse14. Donc, nous avons souvent utilise un numéro de contrôle sgRNAs CRISPR expériences et recommander un marqueur de surface cellulaire exprimé sur votre type de cellule, mais aussi un second gène cible qui n’est pas exprimé.

Culture à court terme de la HSPCs humaines en présence de cytokines augmente le gène perturbation efficacité6 et est nécessaire pour atteindre la haute efficacité KO. Nous avons trouvé 36 à 48 heures à la période idéale de la culture avant l’électroporation6. Suite d’électroporation, les cellules peuvent être encore cultivés en gardant à l’esprit que plus la culture plus le risque de perdre la capacité de prise de greffe multilignée. Par conséquent, nous effectuons habituellement greffes 6heures après électroporation et jamais plus tard que 24 heures après l’électroporation.

CRISPR/Cas9 a considérablement amélioré la capacité des scientifiques pour modifier avec succès le génome des cellules de mammifères. Faisant interruption du gène plus faisable dans les cellules progénitrices hématopoïétiques primaire devrait pour rapidement améliorer les connaissances scientifiques dans le domaine des HSPCs et des maladies hématologiques. Ce qui est important, le protocole décrit ici permet également de générer simultanément plusieurs coups de grâce à haut rendement, permettant la modélisation des paysages génétiques complexes, souvent vu dans les maladies leucémiques.

Bien que les protocoles décrits dans les présentes sont axés sur la perturbation du gène, ils peuvent être facilement adaptées pour des expériences de gène knock-in. Ceci peut être accompli par le biais de la prestation conjointe de modèles d’oligonucléotides monocaténaires pour réparation axés sur l’homologie6,13 (HDR) ou par l’intermédiaire de la transduction des cellules post-électroporation avec AAV6 de vecteurs contenant les homologie modèle12. La capacité de réparer ou d’introduire des mutations spécifiques dans HSPCs facilitera de nouvelles stratégies thérapeutiques pour la thérapie génique et l’étude élargie des mutations cancer pilote AML et d’autres maladies hématologiques. Alors que le HDR dans la HSPCs humaines a été réussie6,12,13, souris HSPCs ont été difficiles à modifier à l’aide de cette stratégie6. Optimisation des protocoles HDR dans l’homme et particulièrement dans les HSPCs de souris permettra d’édition plus spécifiques et le développement d’outils pour suivre les cellules édités utilisant endogène, mais.

Enfin, il est prévu également que la perturbation des allèles mutants de gain de fonction pourrait constituer une approche thérapeutique potentielle pour troubles hématopoïétiques congénitales ou acquises. Dans ce scénario, une approche sans ADN est conseillée afin d’éviter des intégrations possibles qui pourraient favoriser la transformation. En outre, l’approche « hit and run » réduit la possibilité d’effets indésirables de hors-cible. Il faut plus d’efforts afin d’élaborer des systèmes de livraison spécifiques qui pourrait ouvrir de nouvelles avenues pour le traitement des hémopathies malignes et bénignes.

Disclosures

Aucun conflit d’intérêt à divulguer

Acknowledgments

Ce travail a été soutenu par la prévention du Cancer et l’Institut de recherches de Texas (RP160283, RP140001 et R1201), Angel Foundation de la Gabrielle pour la recherche sur le Cancer, la Fondation de Evans P. Edward et le NIH (DK092883, CA183252, CA125123, P50CA126752, CA193235 et DK107413). M.C.G. est pris en charge par Baylor recherche préconise pour les scientifiques étudiant. Cytométrie en flux a été partiellement prises en charge par le NIH (National Center for Research Resources grant S10RR024574, Institut National des allergies et AI036211 de maladies infectieuses et National Cancer Institute P30CA125123) pour le Baylor College of Medicine Cytométrie en flux et tri de noyau de cellule.

Materials

Name Company Catalog Number Comments
Tissue culture plates according to cell numbers
1.5 ml Eppendorf microtubes Sigma Z606340-1000EA
50ml Falcon tubes Corning 352070
Nuclease Free Water - DEPC treated ThermoFisher Scientific AM9915G
KAPA HiFi HotStart ReadyMix (2X) KAPA Biosystems KK2600
MinElute PCR purification Kit Qiagen 28004
RNAse Zap RNAse Decontamination Solution ThermoFisher Scientific AM9780
RNA Clean and Concentrator-25 Zymo R1017
HiScribe T7 High Yield RNA Synthesis Kit New England Biolabs E2040S
Alt-R S.p. Cas9 Nuclease 3NLS, 100 µg IDT 1074181
40 mm Cell Strainers VWR 352340
Dulbecco's Phosphate Buffered Saline (PBS) GenDEPOT CA008-050
Fetal Bovine Serum (FBS), Regular Corning 35010CV
AutoMACS Pro Separator or MACS manual Cell Separation columns Miltenyi
Neon Transfection System Device ThermoFisher Scientific
Neon Transfection System 10mL kit ThermoFisher Scientific MPK1025 For larger numbers of cells (see protocol) Neon Transfection System 100 mL kit (# MPK10025) can be used
Name Company Catalog Number Comments
UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific 15575020 For human experiments only
Lymphoprep Stem Cell Technologies 7851 For human experiments only
CD34 MicroBead Kit UltraPure human Miltenyi Biotec 130-100-453 For human experiments only
Stem Span SFEM II Stem Cell Technologies 9605 For human experiments only
Recombinant Human SCF Miltenyi Biotec 130-096-695 For human experiments only
Recombinant Human TPO Miltenyi Biotec 130-094-013 For human experiments only
Recombinant Human FLT3L Miltenyi Biotec 130-096-479 For human experiments only
Name Company Catalog Number Comments
Mouse dissection tools For mouse experiments only
Mortar and Pestle For mouse experiments only
Hank's Balanced Salt Solution (HBSS) Gibco 14170112 For mouse experiments only
Biotin-conjugated anti c-kit antibody eBioscience 13-1171-82 For mouse experiments only
Anti-Biotin MicroBeads Miltenyi Biotec 130-090-485 For mouse experiments only
X VIVO-15, with L-Glutamine, Genatmycin and Phenol Red Lonza 04-418Q For mouse experiments only
Mouse IL-6 Peprotech 216-16 For mouse experiments only
Mouse TPO Peprotech 315-14 For mouse experiments only
Mouse IL-3 Peprotech 213-13 For mouse experiments only
Mouse SCF Peprotech 250-03 For mouse experiments only

DOWNLOAD MATERIALS LIST

References

  1. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, 816-821 (2012).
  2. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  3. Sternberg, S. H., Doudna, J. A. Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell. 58, 568-574 (2015).
  4. Heckl, D., et al. Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 32, 941-946 (2014).
  5. Mandal, P. K., et al. Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell stem cell. 15, 643-652 (2014).
  6. Gundry, M. C., et al. Highly Efficient Genome Editing of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. Cell Rep. 17, 1453-1461 (2016).
  7. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24, 1012-1019 (2014).
  8. Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature methods. 12, 982-988 (2015).
  9. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Current protocols in immunology. 111, A3 B 1-3 (2015).
  10. Lykke-Andersen, S., Jensen, T. H. Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol. 16, 665-677 (2015).
  11. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 42, e168 (2014).
  12. Dever, D. P., et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells. Nature. 539, 384-389 (2016).
  13. DeWitt, M. A., et al. Selection-free genome editing of the sickle mutation in human adult hematopoietic stem/progenitor cells. Sci Transl Med. 8, 360ra134 (2016).
  14. Aguirre, A. J., et al. Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting. Cancer Discov. 6, 914-929 (2016).
Perturbation de gène hautement efficace des cellules progénitrices hématopoïétiques murins et humains par CRISPR/Cas9
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).More

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter