Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Hocheffiziente gen Störung der murinen und menschlichen hämatopoetischen Vorläuferzellen von CRISPR/Cas9

doi: 10.3791/57278 Published: April 10, 2018
* These authors contributed equally

Summary

Ein Protokoll für schnelle CRISPR/Cas9-vermittelte gen Störung bei Maus und humane primäre hämatopoetische Zellen wird in diesem Artikel beschrieben. Cas9-SgRNA Ribonucleoproteins sind über Elektroporation mit SgRNAs erzeugt durch in-vitro- Transkription und kommerzielle Cas9 eingeführt. Hohe Wirkungsgrade Bearbeitung werden mit wenig Zeit und finanziellem Aufwand erreicht.

Abstract

Fortschritte auf dem Gebiet der Hämatopoetischen Stammzellen (HSCs) haben durch Methoden unterstützt worden, um primäre Vorläuferzellen sowie Tiermodelle genetisch Ingenieur. Komplette gen Ablation in HSCs erforderlich, die Generation von Knockout-Mäusen aus dem HSCs isoliert werden konnte, und gen Ablation im primären menschlichen HSCs war nicht möglich. Virale Transduktion Knock-Down Ansätze genutzt werden, aber diese Variable Wirksamkeit litt. Im Allgemeinen, genetische Manipulation des menschlichen und Maus hämatopoetischen Zellen wurde durch niedrige Effizienz und viel Zeit und Kosten Verpflichtungen beeinträchtigt. Vor kurzem hat CRISPR/Cas9 die Fähigkeit, die DNA von Säugerzellen Ingenieur drastisch erweitert. Jedoch ist die Anwendung der CRISPR/Cas9 auf hämatopoetischen Zellen, vor allem wegen ihrer niedrigen Transfektion Effizienz der Toxizität von Plasmid-basierte Ansätze und die langsame Bearbeitungszeit für Virus-basierte Protokolle eine Herausforderung gewesen.

Eine schnelle Methode durchzuführen CRISPR/Cas9-vermittelte gen Bearbeitung in murinen und menschlichen hematopoietic Stammzellen und Vorläuferzellen Zellen mit Ko-Wirkungsgrade von bis zu 90 % wird in diesem Artikel bereitgestellt. Dieser Ansatz nutzt eine Bereitstellungsstrategie für Ribonucleoprotein (RNP) mit einem optimierten Dreitages-Workflow. Die Verwendung von Cas9-SgRNA RNP ermöglicht eine Fahrerflucht Ansatz, keine exogenen DNA-Sequenzen im Genom der bearbeiteten Zellen Einführung und Ziel folgen. Der RNP-basierte Methode ist schnell und unkompliziert: Klonen von SgRNAs, Virus Vorbereitung oder spezifische SgRNA chemische Modifikation ist nicht erforderlich. Mit diesem Protokoll sollten Wissenschaftler erfolgreich Knockouts von einem gen des Interesses an primären hämatopoetischen Zellen innerhalb einer Woche, einschließlich Ausfallzeiten für Oligonukleotid-Synthese generieren können. Dieser Ansatz ermöglicht eine viel breitere Gruppe von Benutzern, dieses Protokoll für ihre Bedürfnisse anzupassen.

Introduction

Das Aufkommen der CRISPR/Cas9 vereinfacht gen Bearbeitung in Säugerzellen radikal. Frühe CRISPR/Cas9 Protokolle verwendet Plasmid oder Virus-basierte Lieferung von Cas9 Protein und SgRNA1,2,3. Diese Ansätze revolutionär für die Entwicklung von zellulären und tierischen Modellen bewiesen und auch erfolgreich angewandt worden, um primäre Hämatopoetischen Stammzellen und Vorläuferzellen Zellen (HSPCs)4,5. Diese Methoden haben jedoch eine Reihe von Nachteilen. Erstens bleibt gen Störung Effizienz oft unter 50 %4,5. Während dies für die Erzeugung von Knockout (KO)-Klone in Zelllinien ausreicht, macht die Notwendigkeit einer kurzfristigen Kultur HSPCs eine solche Strategie nicht zugänglich. Zweitens: die Anforderung für das Klonen begrenzt die Menge der SgRNAs, die in den einzelnen Experimenten getestet werden können und erzeugt große, schwer zu transfizieren Konstrukte. Drittens, zwingen diese Ansätze Wissenschaftler um Durchlaufzeiten zu verlangsamen.

Um diese Einschränkungen zu überwinden, unsere Gruppe entwickelt und vor kurzem veröffentlicht einen alternativen Ansatz CRISPR/Cas9 in HSPCs mit Cas9-SgRNA Ribonucleoproteins (RNPs)-Lieferung6basiert. Bei dieser Strategie der rohkomponenten CRISPR (Cas9 Protein- und in-vitro- transkribiert SgRNA) sind Pre-komplexiert und direkt geliefert in Zielzellen über Elektroporation (Abbildung 1). Da die Halbwertszeit des Cas9-SgRNA RNP-Komplexes ist kürzer als die Zeit dieses Plasmid oder virale Nukleinsäure transkribiert wird, aus zielrate ist niedriger im Vergleich zu frühen Ansätze7. Darüber hinaus fügt der RNP-Ansatz den Vorteil der Beseitigung jeder Quelle der exogene DNA, die zufällig in das Ziel-Zelle-Genom führt zur zellulären Transformation integrieren können.

Dieses Protokoll basiert auf einer optimierten Workflow für RNP-basierte gen Störung Experimente, wie in Abbildung 1dargestellt. Der erste Schritt ist Gestaltung und Bestellung Zündkapseln für jedes SgRNA. Diese Primer werden genutzt, um SgRNA DNA-Vorlagen zu machen, die für in-vitro- Transkription (IVT) verwendet werden, um die SgRNAs zu erhalten. Gereinigten SgRNAs werden dann mit zuvor gekauften Cas9 Protein, um Form Cas9-SgRNA-RNP-komplexe inkubiert. Schließlich sind Pre-komplexiert Cas9-SgRNA RNPs elektroporiert in die Zellen. Nach Elektroporation, Bearbeitung Effizienz getestet werden kann und in Vitro/in Vivo Experimente gestartet werden können, je nach Bedarf. Eine detaillierte Beschreibung der diesen innovativen experimentellen Ansatz gefunden werden.

Protocol

Das Protokoll folgt den Richtlinien des Baylor College of Medicine menschliche Ethik-Kommission. Alle experimentellen Verfahren, die an Mäusen durchgeführt sind von Baylor College of Medicine institutionelle Animal Care and Use Committee genehmigt.

1. SgRNA Fwd-Design

  1. Navigieren Sie zu http://www.crisprscan.org/?page=track8 zu entwerfen SgRNAs von Interesse.
  2. Klicken Sie auf die "Maus" oder "Human" Schaltfläche Zelle je nach Interesse.
  3. Das Gen des Interesses in der UCSC-Suchfeld eingeben und Go drücken.
  4. Zoomen und verschieben Sie in der Region des Gens (dh. eine bestimmte Exon), das ist von Interesse für Ziel.
    Hinweis: Um effiziente gen Störungen zu erreichen, ist es empfehlenswert auf präsentieren die frühesten Exon(s) in allen transkribierten Isoformen in Ihrem spezifischen Zelltyp.
  5. Sicherzustellen, dass die potenziellen SgRNA-Zielsequenzen unter einer "CRISPRscan Vorhersagen, die auf Gene (CDS)" aufgeführt sind Überschrift.
  6. Klicken Sie auf ein Ziel-Sequenz mit einer relativ hohen Punktzahl und einige off-Ziele-(grün markiert). Die vollständige Sequenz angezeigt im Abschnitt "Oligo-Sequenz" Kopieren und in ein Textdokument einfügen. Die 3'-Ende der Sequenz "ATAGC" hinzufügen. Abschluss, erteilen Sie den Auftrag für die Full-Length-Sequenz.
    Hinweis: Für jedes Ziel-Sequenz CRISPRscan8 bietet eine "integrierte" nach vorne SgRNA Grundierung, die der T7-Promotor, der Protospacer (Ziel)-Sequenz und universal Gerüst Überlappung Sequenz umfasst (siehe Abbildung 1A). Eine durchgehende Sequenz besteht aus 56 oder 57 Nukleotide abhängig von der Länge des Protospacer.

2. SgRNA DNA-Template-Synthese

  1. Lösen Sie auf und verdünnen Sie der SgRNA Fwd und universal Rev Primer (siehe Tabelle 1 für die komplette Sequenz). Um eine Endkonzentration von 10 µM zu erhalten, folgen Sie den Anweisungen des Herstellers zum Verdünnen Primer bis 100 µM, dann machen Sie eine 01:10 Verdünnung mit Nuklease-freies Wasser.
  2. Überlappende PCR durchzuführen (siehe Abbildung 1 b), mischen die folgenden PCR-Streifen Röhren: 2 µL vorwärts SgRNA Primer (10 µM), 2 µL Universal Rev Gerüst Grundierung (HPLC gereinigt) (10 µM), 10 µL High Fidelity DNA-Polymerase master-Mix (2 X) und 6 µL Nuklease-freies Wasser.
  3. Führen Sie die PCR mit dem folgenden Programm: 95 ° C für 3 min, 98 ° C für 5 s, 60 ° C für 5 s, 72 ° C für 10 s, gehe zu 2 für 6 Zyklen, 72 ° C für 1 min, 4 ° C für immer.
  4. Reinigen Sie das PCR-Produkt mit DNA Reinigung Spalten (siehe Tabelle der Materialien). Befolgen Sie die Anweisungen des Herstellers und eluieren mit 11,5 µL Elution Puffer.
  5. Messen Sie die Konzentration von der PCR-Produkte auf einem Spektralphotometer. Das Instrument mit Elution Buffer leer.
    Hinweis: Die DNA-Konzentration sollte zwischen ca. 50 und ~ 120 ng/µL liegen.

3. in Vitro Transkription von SgRNA

  1. Mischen Sie die folgenden Komponenten in PCR-Streifen Röhren (Reagenzien sind in der RNA-Synthese-Kit zur Verfügung gestellt): 4 µL eluierten DNA, 4 µL von dNTPs und 1 µL 10 x Reaktion Puffer 1 µL der T7 RNA-Polymerase-Enzym-Mix.
  2. Inkubieren Sie die Proben bei 37 ° C für mindestens 4 h.
  3. Gelten Sie die RNase Reinigungsmittel um RNase aus behandschuhten Händen zu entfernen.
  4. Bringen Sie jede RNA-Probe bis zu einem Gesamtvolumen von 50 µL mit Nuklease-freies Wasser (erste Stufe des RNA-Reinigung nach Herstellerangaben).
  5. Gehen Sie mit RNA-Reinigung nach Herstellerangaben und eluieren in 50 µL vorausgesetzt-Kit Nuklease-freies Wasser.
  6. Messen Sie die Konzentration der eluierten SgRNA auf einem Spektralphotometer. Das Instrument mit Nuklease-freies Wasser leer.
    Hinweis: Der zu erwartende Ertrag nach der Reinigung ist 50-80 µg RNA (d. h. Konzentration von 1,0-1,5 µg/µL).
  7. Die gereinigten SgRNA sofort verwenden oder Lagern in Aliquote von 2-4 µL bei-80 ° C für die langfristige.

4. HSPC Isolation und Kultur

  1. Murine HSPCs Isolation und Kultur
    Hinweis: Männliche und weibliche Ubc-GFP-Mäuse (JAX004353) und Rosa26-LSL-TdTomato (JAX007914) kreuzten sich mit Vav-iCre (JAX008610) im Alter von 2-6 Monaten wurden verwendet, um die unten gezeigten Ergebnisse zu erzielen.
    1. Einschläfern Sie narkotisierten Mäuse durch zervikale Dislokation.
      Hinweis: Zwei ausgebildete Personen sollten unabhängig zu überprüfen, erfolgreichen Euthanasie mit der Feststellung mangelnder Atmung und Herzschlag für mindestens 5 Minuten, entfernen Sie die Haut von Tieren.
    2. Sezieren Sie Tibien, Oberschenkelknochen und Beckenkamm Wappenbuch von Mäusen und entfernen Sie alle Muskeln und Bindegewebe um die sezierten Knochen. Legen Sie intakte Knochen in einer Gewebekultur Schale auf Eis mit HBSS ergänzt mit 2 % FBS (HBSS +). Bewegen Sie um eine laminare Strömung Kapuze sobald al die Knochen wurden gereinigt und in der Kulturschale Gewebe übertragen.
    3. Transfer gereinigt Knochen zu sterilen Mörtel, mit 2 mL eiskaltes HBSS + pro 3 Knochen. Mit dem Stößel, crush Knochen in Knochenfragmente, Knochenmark aus in die Freigabe. Weiter pestling bis Knochen knacken unter den Stößel zu stoppen.
    4. Sammeln Sie überstand von Mörtel und Filter in ein 50 mL konische Röhrchen mit einem 40 µm Zelle Sieb. Spülen Sie die restlichen Knochenfragmente mit 5 mL eiskaltes HBSS + und Filter in der gleichen 50 mL konische Rohr mit der gleichen 40 µm-Sieb.
    5. Waschen Sie die Zellen zweimal durch das Rohr mit eiskalten HBSS + Belag und Zentrifugieren bei 400 X g für 7 min. überstand verwerfen.
    6. Nach der zweiten Wäsche Aufschwemmen der Zelle-Pellets in 20 mL Eis kaltem PBS. Rechnen Sie entwicklungsfähigen Zellen durch Trypan blau Ausgrenzung9.
    7. Inkubieren Sie 1 x 108 lebensfähige Zellen pro 1 mL eiskaltes HBSS + mit Biotin-konjugierten c-Kit-Antikörper bei 1: 100 Verdünnung für 45 min auf Eis.
    8. Waschen Sie die Zellen mit eiskalten HBSS + indem 400 X g für 7 min zentrifugieren und den überstand verworfen.
    9. Inkubieren Sie die Zellen mit magnetischen Beads Anti-Biotin nach Anweisungen des Herstellers.
    10. C-Kit positive Zellen mittels magnetischer Spalten oder magnetische-activated Cell Sorter nach Anweisungen des Herstellers zu isolieren. C-Kit-positiven Zellen in 15 mL konische Röhrchen zu sammeln.
    11. Waschen Sie die Zellen zweimal mit PBS von topping aus den 15 mL konische Rohr und Zentrifugieren bei 400 X g für 7 min. Überstands verwerfen. Zwischen den zwei Wäschen berechnen Sie die Gesamtzahl der lebensfähigen Zellen durch Trypan blau Ausgrenzung9.
    12. Aufschwemmen c-Kit +-Zellen in einer Konzentration von bis zu 106 Viablecells pro 100 µL Kulturmedium für murine HSPCs ergänzt mit 2 % FBS, 50 ng/mL Maus Stammzellen Faktor (SCF) 50 ng/mL Maus Thrombopoetin (TPO), 10 ng/mL Maus IL-3 und 10 ng/mL Maus IL-6.
    13. Inkubieren Sie die Zellen bei 37 ° C, 5 % CO2 für mindestens 1 h bis zu 24 h vor der Elektroporation.
  2. Menschlicher HSPCs Isolation und Kultur
    Hinweis: Diese Schritte müssen in einem Laminar-Flow-Abzug durchgeführt werden.
    1. Filtern Sie Knochenmark/Nabelschnurblutzellen durch ein 40 µm Zelle Sieb.
    2. Verdünnen Sie 1:2 die gefilterte Knochenmark/Nabelschnurblutzellen mit PBS mit 1 mM EDTA (PBS/EDTA) ergänzt.
    3. 15 mL Dichte Gradienten Medium in ein 50 mL konische Röhrchen zu verzichten. Gießen Sie 30 mL der verdünnten Knochenmark/Nabelschnurblut sanft auf die Dichte Gradienten mittlere Oberfläche. Ist das Volumen der Zellsuspension größer als 30 mL bereiten mehrere Rohre.
      Hinweis: Achten Sie auf die Schnittstelle zwischen dem Blut und das Dichte-Gradienten-Medium so scharf wie möglich zu halten.
    4. Drehen Sie die Rohre bei 750 X g für 30 min mit keine Verzögerung.
    5. Sammeln Sie die mononukleären Zellschicht nachweisbar am Medium der Schnittstelle und Transfer zu einer sauberen 50 mL konische Rohr. Füllen Sie den Schlauch mit PBS/EDTA und drehen Sie den Zellen bei 280 g für 15 min. verwerfen des Überstands.
    6. Waschen Sie die Zellen zweimal in PBS/EDTA Spinning bei 400 X g für 7 min und den überstand verworfen.
    7. Inkubieren Sie die mononukleären Zellen mit Anti-CD34 magnetische Beads nach Anweisungen des Herstellers.
    8. CD34 + Zellen mittels magnetischer Spalten oder magnetische-activated Cell Sorter nach Anweisungen des Herstellers zu isolieren. CD34 + Zellen in 15 mL konische Röhrchen zu sammeln.
    9. Wash gesammelten CD34 + Zellen zweimal durch topping aus der Röhre mit PBS und dreht bei 400 X g für 7 min und den überstand verworfen. Zwischen den zwei Wäschen berechnen Sie die Gesamtzahl der lebensfähigen Zellen durch Trypan blau Ausgrenzung9.
    10. Aufschwemmen der Zellen in Kulturmedium mit 100 ng/mL ergänzt menschlichen SCF, 100 ng/mL menschlichen FLT3 Ligand (FLT3L), 100 ng/mL menschlichen TPO in einer Konzentration von ~2.5 X 105 lebensfähige Zellen / ml. Kultur isoliert CD34 + Zellen bei 37 ° C, 5 % CO2 für 24 h zu einem maximal 48 Stunden vor zur Elektroporation.
      Hinweis: Prüfen Sie vor Elektroporation Reinheit der angereicherten CD34 + Bevölkerung durch Durchflusszytometrie.

(5) Elektroporation

Hinweis: Das folgende Protokoll ist für 10 µL Elektroporation Tipps optimiert. Alle Schritte sollten in einem Laminar-Flow-Abzug durchgeführt werden.

  1. Anzahl Zellen durch Trypan blau Ausgrenzung9. 2 x 105 lebensfähige Zellen pro replizieren (z.B. sammeln 6 x 105 Zellen für 3 Electroporations) zu sammeln.
  2. Waschen Zellen zweimal mit PBS, spinning im 300 X g für 7 min und sorgfältig entfernen den überstand.
  3. Parallel bereiten Sie Cas9 SgRNA RNP-komplexe durch Inkubation in PCR-Röhrchen für 20-30 min bei RT 1,5 µg Cas9 mit 1 µg des gesamten SgRNA für jede replizieren, außer das einzige Steuerelement Cas9.
    Hinweis: Cas9 Protein ist bei 10 µg/µl Konzentration zur Verfügung gestellt. Dafür ein genaues pipettieren, 01:10 verdünnen den Gesamtbetrag des Cas9 Proteins mit Nuklease-freies Wasser benötigt (z.B. für 10 Electroporations 1 µl des Cas9 Proteins zu nehmen und mit 9 µl Nuklease-freies Wasser verdünnen und inkubieren Sie 1 µl verdünnter Cas9 pro replizieren. Abhängig von der Konzentration der SgRNA sollte das Gesamtvolumen der Cas9 und SgRNA zwischen 1,7 und 2 µl pro replizieren bestehen. Wenn zwei SgRNAs inkubieren 500 ng pro SgRNA pro replizieren; Wenn 3 mit SgRNAs inkubieren 330 ng pro SgRNA pro replizieren, und So weiter.
  4. Berechnen Sie das Gesamtvolumen der Wiederfreisetzung, die Puffer T mit 10 µL multipliziert die Anzahl der insgesamt benötigten repliziert (z. B. 30 µL für 3 Wiederholungen) benötigt. Aufschwemmen Sie gebeizte Zellen mit der berechneten Menge an Puffer T. sicherzustellen, dass die Endkonzentration der Zellsuspension 2 x 107 Zellen/mL.
  5. Aliquoten 10 µL resuspendierte Zellen/replizieren in jedem PCR-Röhrchen mit der Pre-komplexiert SgRNA/Cas9 RNP (z. B. ein dreifacher aliquoten 30 μl Zellsuspension in einer PCR-Röhrchen mit Pre-komplexiert Cas9-SgRNA).
  6. Einrichten der Elektroporation-System schalten Sie das Gerät hinzufügen 3 mL Puffer E in eine Küvette Elektroporation und schieben Sie die Küvette in den Küvettenhalter.
  7. Legen Sie die gewünschten Elektroporation Bedingungen auf Gerät: menschliche HSPCs (1600 V, 10 ms, 3 Pulse) oder Maus HSPCs (1700 V, 20 ms, 1 Impuls).
    Hinweis: Wenn gewünscht, vor der Durchführung von Experimenten auf CD34 + HSPCs, SgRNA Effizienz auf akute myeloische Leukämie (AML) Zelllinien (z. B. HL60) verwenden die gleiche Strategie (Verwendung antibiotikafreien mittlere für AML-Zell-Linien) mit folgenden Elektroporation Bedingungen getestet werden kann: Der Puffer ist 1350 V, R, 1 Impuls, 35 ms.
  8. Die Elektroporation erfolgt mit einer speziellen Elektroporation-Pipette mit einer Klaue, die auf die Elektroporation PIPETTENSPITZE Riegel. Halten die Elektroporation-Pipette, erweitern die Kralle, schnappen Sie sich die Scheibe in die Pipettenspitze und dann fest drücken Sie der Pipette auf sichere die Spitze.
  9. Pipette die Probe nach oben und unten 10 Mal zu mischen. Nehmen Sie 10 µL, dafür, dass es gibt keine Bläschen, und setzen Sie die PIPETTENSPITZE direkt in den elektrolytischen Puffer in die Elektroporation-Küvette. Versuchen Sie nicht, die Wände der Küvette berühren. Drücken Sie die Taste "start" auf dem Bildschirm. Nachdem die Meldung "abgeschlossen" angezeigt wird, entfernen Sie die Pipette, und verzichten Sie Inhalte in Brunnen mit neuen HSPC Kulturmedium zu.
  10. Wiederholen Sie für alle Proben. Änderung Pipette Tipps zwischen Proben, nur bei Bedarf.

Representative Results

Das Ziel dieses Protokolls ist gen Knockout (KO) in Maus und menschlichen HSPCs mit Cas9-SgRNA RNPs durchführen. Der Workflow ist einfach und schnell und ermöglicht die Durchführung von Experimenten in weniger als einer Woche vom experimentellen Design zur Beurteilung der Effizienz von KO.

Im Vergleich zu Plasmid oder Virus-basierte Ansätze, baut der Erfolg unserer Protokoll auf die Kombination von SgRNA RNPs und Elektroporation. Diese Klonen-freie Strategie verkürzt erheblich die Zeit erforderlich, um die Komponenten zu transfizieren. Darüber hinaus Elektroporation ermöglicht die Transfektion von bis zu 95 % der Zellen, kann Maximierung der Lieferung von RNPs. SgRNAs sein können im Labor durch in-vitro- Transkription (IVT), während gereinigtes Protein Cas9 kann, aus mehreren Unternehmen erworben werden ( (siehe Protokoll). SgRNA DNA-Templates für IVT stammen Durchführung einer kurzen PCR unter Verwendung der SgRNA Fwd Grundierung (Abb. 1A, B) und die Universal Gerüst Rev Primer (Abbildung 1 b - siehe Protokoll). Das PCR-Produkt dient dann als Vorlage für das IVT (Abbildung 1). Cas9-SgRNA-RNP-komplexe entstehen Inkubation für 15-30 Minuten, die SgRNAs und die Cas9 (Abbildung 1). Schließlich sind SgRNA RNPs elektroporiert in die Zellen. Bearbeitete HSPCs können dann verwendet werden, sowohl in Vitro und in Vivo Experimente durchführen.

Gen Störung in Mauszellen

Um die Wirksamkeit der Cas9-SgRNA RNP Elektroporation Strategie, C-Kit + HSPCs isoliert von Mäusen ubiquitär auszudrücken GFP oder TdTomato wurden elektroporiert mit SgRNA gegen die GFP oder TdTomato. Unter den drei SgRNA gegen GFP entwickelt durchgeführt GFP sg1 am effizientesten ausstellenden ca. 70-75 % Störung der GFP Ausdruck Durchflusszytometrie (Abb. 2A, B) bestimmt. Zur Quantifizierung der Genfrequenz Störung auf genomebene genomischer DNA aus den elektroporiert Zellen wurde isoliert und T7 Endonuklease-basierte (T7EI) Assay durchgeführt wurde. Wie in Abbildung 2dargestellt, erkannt T7EI Assay bis zu 60 % Indel Bildung. Beachten Sie, dass T7EI Tests neigen dazu, die Frequenzen der Indels unterschätzen. Wir generiert auch SgRNA gegen TdTomato und elektroporiert HSPCs TdTomato von den Rosa26 Locus zum Ausdruck zu bringen. Wie in Abb. 2Ddargestellt, abgetragen TdTomato sg1 effizient die Expression von TdTomato.

Gen Störung in den menschlichen Zellen

Hier zeigt effiziente Störung mit einem einzigen SgRNA Konzept für CD45, eine Zelle Oberfläche Marker auf hämatopoetischen Zellen ausgedrückt erhalten. Drei SgRNAs auf verschiedenen Exons von CD45 waren entworfene (CD45 sg1, sg2 und sg3). Die Effizienz der SgRNAs wurde in die Zellinie HL60 AML (Abbildung 3A) getestet. Protein KO wurde 5 Tage nach der Elektroporation von Durchflusszytometrie bewertet. CD45 sg1 war die effizienteste (KO Wirkungsgrad von 98 % - Abbildung 3A) und diente für weitere Experimente. Abbildung 3 b zeigt CD45 KO in primären menschlichen CD34 + Vorläuferzellen mit CD45 sg1, 5 Tage nach der Elektroporation von Durchflusszytometrie bewertet. Während CD34 Expression nicht betroffen war, war in etwa 80 % der Zellen CD45 Ausdruck verloren. 200,000 bearbeitete primäre CD34 + Zellen wurden 6 Stunden nach Electroporation Retro-Orbital in NSG Mäuse transplantiert. Knochenmark und milzzellen wurden geerntet 3 Monate nach Transplantation. Bearbeitete Zellen (HLA-ABC positiv, CD45 negativ, rot markiert) sind nachweisbar nur in SgRNA behandelt Proben und nicht in Cas9 nur Steuerelemente (Abbildung 3).

Falls gewünscht, kann zwei SgRNAs gezielt in der Nähe Sequenzen verwendet werden, um Löschungen zu generieren. Dieser Ansatz ermöglicht eine schnelle Schätzung der Bearbeitung Effizienz mit einer PCR und erzeugt häufig höheren Effizienz der Störung. 3D Abbildung zeigt die effiziente Erzeugung von einer 58 bp Deletion in Exon 10 des DNMT3A. 200,000 bearbeitete CD34 + Zellen wurden 6 Stunden nach Electroporation in NSG Mäuse transplantiert. Die 58 bp Löschung wurde klar im peripheren Blut eingepflanzt NSG Mäuse 5 Monate nach Injektionen (Abbildung 3E) bestätigt, die Bearbeitung von CD34 + Zellen mit langfristigen Engraftment Fähigkeiten erkannt.

Figure 1
Abbildung 1: die schnelle und einfache Ansatz, SgRNA RNPs zu generieren. (A) Darstellung des SgRNA Fwd Grundierung. Die SgRNA Fwd Primer ist ein DNA-Oligonukleotid mit der T7-Promotor, der Protospacer-Sequenz und eine Überlappung Sequenz mit dem SgRNA-Gerüst. An die 3' ist Ende, in rot hervorgehoben der "ATAGC"-Sequenz, die auf CRISPRscan erhaltene SgRNA Fwd Primer Sequenz hinzugefügt werden muss. B) schematische Darstellung der Überlappung PCR durchgeführt um die IVT-Vorlage zu erhalten. Die Überlappung zwischen den SgRNA Fwd Zündkapsel und die Universal Gerüst Rev Zündkapsel ermöglicht die Erweiterung und Verstärkung durch PCR. C) Cartoon beschreiben die IVT-Reaktion und die SgRNA RNP Pre-Komplexbildner. Das PCR-Produkt ist gereinigt und als Vorlage für das IVT verwendet. IVT erzeugt ein hohes Maß an SgRNAs, die verwendet werden können in mehreren Wiederholungen (siehe Protokoll). SgRNA RNPs entstehen Inkubation der SgRNA von IVT und das zuvor gekauften Cas9 Protein gereinigt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: effiziente gen Störung Maus hämatopoetischen Vorläuferzellen. (A) eine SgRNA Ausrichtung auf GFP (GFP sg1) zusammen mit Cas9 Protein wurde elektroporiert in murinen c-Kit + HSPCs GFP zum Ausdruck zu bringen, und 24 Stunden nach der Elektroporation von Durchflusszytometrie analysiert. B) unterschiedliche Höhe der GFP sg1 war komplexiert mit 1 µg Cas9 Protein-und elektroporiert. Weniger als 200 ng der GFP sg1 abgetragen effizient GFP Ausdruck. C) T7EI-Assay durchgeführt auf genomische DNA isoliert von Zellen in A-B. PCR-Amplifikate überspannt die Cas9-SgRNA-spaltstelle wurde verdünnt 1:4-in-1 x Buffer 2 und langsam in einem Thermocycler hybridisiert. Hybridisierten Fragmente wurden dann mit 1,25 U T7 Endonuklease verdaut ich für 10 Minuten bei 37 ° C. Verdaute Fragmente wurden durch Polyacrylamid-Gelelektrophorese getrennt. Band-Intensitäten wurden analysiert mit ImageJ-Software durch Plotten Band Intensitäten der einzelnen Fahrspuren. % Spaltung errechnete sich aus dem Verhältnis der Intensitäten der gespalten Bands uncleaved Bands. D) c-Kit + HSPCs isoliert von Mäusen, die mit dem Ausdruck TdTomato war elektroporiert mit Cas9 Protein komplexiert mit SgRNA gegen TdTomato. Durchflusszytometrie durchgeführt rund um die Uhr nach Electroporation ergab, dass etwa 74 % der Zellen TdTomato gelöscht. R26 = Rosa26. * p < 0,05, ** p < 0,01, *** p < 0,001. Diese Zahl wurde angepasst von Gundry Et Al. 6 Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3: effiziente gen Störung in humanen hämatopoetischen Zellen. (A) drei SgRNAs targeting CD45 (CD45 sg1, sg2 und sg3) wurden entwickelt und getestet in der Zelllinie HL60 AML (siehe Protokoll für die Elektroporation Bedingungen). Durchflusszytometrie wurde 5 Tage nach der Elektroporation durchgeführt. CD45 sg1 wurde ausgewählt als die effizienteste unter den drei SgRNAs (KO Effizienz 98 %). (B) CD45 KO in der primären menschlichen Blut CD34 + HSPCs mit CD45 sg1 cord. CD45 Verlust kann in etwa 80 % der Zellen nachgewiesen werden. Beachten Sie, dass nach der Bearbeitung CD34 Ausdruck unverändert ist. C) bearbeitet menschliche HSPCs können effizient in NSG Mäuse aufgeprägt werden. Menschliche kernhaltigen Zellen anzeigen die normalen HLA + / CD45 + Phänotyp in nur Cas9 pfropfte Mäuse, während bei Mäusen mit CD45-sg1 pfropfte CD34 + Zellen, beide HLA behandelt + / CD45 + und HLA + / CD45-Populationen Angabe Engraftment humaner CD45 KO Zellen beobachtet werden. (D) 2 % Agarosegel zeigt eine 58 bp Deletion von 2 SgRNAs (dual Reiseführer Ansatz) im Exon 10 des DNMT3A in menschlichen HSPCs aus 3 verschiedenen Nabelschnurblut (CB1, CB2 und CB3) erzeugt. PCR wurde 3 Tage nach der Elektroporation durchgeführt. (E) 2 % Agarosegel demonstrieren die Persistenz der 58 bp Deletion 5 Monate nach der Transplantation in NSG-Mäuse. Diese Zahl wurde angepasst von Gundry Et al. 6 Bitte klicken Sie hier für eine größere Version dieser Figur.

Oligonukleotid Sequenz Hinweis
Universal Rev Gerüst Grundierung gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct Universal-rückwärts-Primer für überlappen PCR
hCD45 SgRNA 1 taatacgactcactataGGTGCTGGTGTTGGGCGCACgttttagagctagaaatagc SgRNA Fwd Primer Sequenz Überlappung PCR
hCD45 SgRNA 2 taatacgactcactataGGGAGCAAGTGAGGATCCTCgttttagagctagaaatagc SgRNA Fwd Primer Sequenz Überlappung PCR
hCD45 SgRNA 3 taatacgactcactataGGGATGCTTGTTCCCTTCAGgttttagagctagaaatagc SgRNA Fwd Primer Sequenz Überlappung PCR
hDNMT3A Ex10 sg1 taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc SgRNA Fwd Primer Sequenz Überlappung PCR
hDNMT3A Ex10 sg2 taatacgactcactataGGGTGGCCAGCAGCCGCGCGgttttagagctagaaatagc SgRNA Fwd Primer Sequenz Überlappung PCR
Rosa26 sgRNA taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc SgRNA Fwd Primer Sequenz Überlappung PCR
GFP-sg1 taatacgactcactataGGGCGAGGAGCTGTTCACCGgttttagagctagaaatagc SgRNA Fwd Primer Sequenz Überlappung PCR
TdTomato sg1 taatacgactcactataGGGGTACAGGCGCTCGGTGGgtttaagagctagaaatagc SgRNA Fwd Primer Sequenz Überlappung PCR

Tabelle 1: Komplette Sequenzen von SgRNA Fwd Einführungen in die Experimente und Universal Rev Primer verwendet.

Discussion

In diesem ausführlichen Protokoll beschriebene RNP-Ansatz ermöglicht effiziente gen Knockout Maus und menschliche primäre blutbildenden Zellen ebenso wie in Zelle Fangleinen. Obwohl oft sehr hohe KO Wirkungsgrade erzielt werden, müssen mehrere kritische Variablen berücksichtigt werden. Erste, richtige Exon Wahl ist der Schlüssel für die Gewährleistung, dass effiziente Indel Einbeziehung gen Knockout entspricht. Zwei wichtige Faktoren, die im Zusammenhang mit Exon Wahl sind Erhaltung über Isoformen und Exon Stellung in Abschriften. Isoform Expressionsmuster sind variabel in Zelltypen, also ggf. Gen KO über Zelltypen Exons, die invariante zwischen Zelle Arten ausgerichtet sein sollte. Isoform Muster können mit Q-PCR oder RNA-Sequenzierung Daten überprüft werden. Exon Position innerhalb Transkripte es empfiehlt sich, früh Exons als Frameshift-Mutationen im Terminal Ziel oder vorletzten Exon Unsinn-vermittelte Zerfall10, Herstellung von Proteinen mit Roman oder unbekannte Funktionen als wahre Nullen entweichen kann.

Bestimmung der Indel ist Frequenz ein entscheidender Schritt für die KO-Effizienz schätzen und die biologische Ergebnis des Experiments richtig zu interpretieren. Jedoch-Assays (z. B. Surveyor Assay) haben den Vorteil, relativ schnell und einfach durchzuführen. Aber sie neigen dazu, aufgrund der erheblichen Hintergrund Signale ungenau und Ergebnisse sind oft schwer zu reproduzieren. Darüber hinaus bieten sie keine Informationen über die Qualität der Indels generiert (z.B. Länge der Einfügungen und Löschungen) im Experiment. Sanger Sequenzierung bietet eine wertvolle Alternative zu Endonuklease Assays. Plattformen wie Gezeiten11 (https://tide.nki.nl/) helfen, zersetzen Sanger Spuren und genaue Schätzungen der Allele Störung Effizienz, während gleichzeitig die Frequenzen der einzelnen Indels zu produzieren. Die Hauptbeeinträchtigung ist eine absolute Abhängigkeit von qualitativ hochwertigen Sanger-Sequenzierung Spuren. Hochdurchsatz-Amplifikate Sequenzierung überwindet die meisten dieser Probleme. Amplifikate Bibliotheken zubereitet werden, beginnend mit sehr niedrigen DNA-Eingänge und die hohe Deckkraft sorgt für zuverlässige Ergebnisse. Um die Senkung der Amplifikate Sequenzierung spike wir in der Regel in Amplikons Bibliotheken in größeren Sequenzierung läuft (z. B. RNA-Sequenzierung) mit nur 1-1,5 % des gesamten lautet. Schließlich, um erfolgreiche ko bestätigen, wir stark empfehlen Bewertung proteingehalte durch westliche Flecken oder flow Cytometry, wenn möglich.

Wie zuvor beschrieben die hier vorgestellte Methode ist schnell und unkompliziert und stellt ein neues Tool um gen Knockout Maus und menschlichen HSPCs zu studieren. Während unser Protokoll Anweisungen für gen-Knockout mit einem Tipp-basierte Elektroporation-System zur Verfügung stellt, haben andere Systeme nachgewiesen hochwirksame12,13Jahre alt sein.

Zwei wesentliche Einschränkungen in Bezug auf die RNP Ansatz bestätigt werden müssen. Zunächst, wie von unserer Gruppe beschrieben, die Lebensfähigkeit des HSPCs elektroporiert mit in-vitro-transkribiert SgRNAs können durch Elektroporation, erheblich beeinträchtigt werden, vor allem, wenn die Bedingungen nicht optimal6sind. Bei Bedarf kann kommerziell synthetisierte SgRNAs (d.h. Beseitigung in Vitro Transkription) dieses Problem umgehen. Diese werden immer weniger teuer mit der Zeit und können von verschiedenen Anbietern gekauft werden. In diesem Szenario in Vitro Transkription genutzt werden, um einen Pool von SgRNA auf Bild zur Wirksamkeit zu erzeugen, und dann ist die effizienteste SgRNA(s) wählbar, für die Synthese. Die zweite große Einschränkung des RNP-Ansatzes ist die Unfähigkeit, erfolgreich transfected Zellen, wie viral-basierte Ansätze zu verfolgen. Jedoch können der hohe KO-Effizienz und schnelle Bearbeitung mit Cas9-SgRNA RNPs erhalten diese in vielen experimentellen Szenarien überwiegen. Wir empfehlen Amplikons Hochdurchsatz-Sequenzierung die Störung Effizienz in jedem Experiment genau zu bestimmen. Wenn die Knock-out-das Gen des Interesses wird voraussichtlich einen proliferativen Phänotyp verleihen (d.h. entweder reduziert oder erhöht Verbreitung im Vergleich zu Wildtyp Zellen), Bestimmung der Indel Frequenz zu mehreren Zeitpunkten kann man beurteilen ob KO Zellen Anreicherung (d.h. Indel Frequenz steigt im Laufe der Zeit) zu unterziehen oder outcompeted sind (zB. Indel sinkt im Laufe der Zeit).

Durchführung von in-vivo oder in vitro Experimenten um die biologischen Wirkungen des Verlustes der Genfunktion zu verstehen, erfordert die entsprechenden Steuerelemente. Wie bereits erwähnt, in-vitro- transkribiert SgRNAs möglicherweise giftig für Zellen, vor allem primäre Progenitor-Zellen6. Darüber hinaus können DNA-Doppel-strangbrüchen verursacht durch Cas9 Protein gen unabhängigen Anti-proliferative Reaktion14verursachen. Daher wir oft eine Anzahl von Kontrolle SgRNAs in CRISPR Experimente verwenden und empfehlen einen Zelle Oberfläche Marker zum Ausdruck auf Ihrem Zelltyp sowie ein zweites Zielgen, das nicht zum Ausdruck kommt.

Kurzfristige Kultur des menschlichen HSPCs in Anwesenheit von Zytokinen gen Störung Effizienz6 erhöht und ist notwendig, eine hocheffiziente KO zu erzielen. Wir haben 36-48 Stunden, um die ideale Periode der Kultur vor der Elektroporation6gefunden. Nach Elektroporation, können die Zellen werden weiter kultiviert unter Berücksichtigung, dass je länger die Kultur, desto höher das Risiko des Verlustes multilineage Engraftment Kapazität. Daher führen wir in der Regel Transplantationen 6 Stunden nach Electroporation und niemals später als 24 Stunden nach der Elektroporation.

CRISPR/Cas9 hat sich verbessert die Fähigkeit der Wissenschaftler, das Genom von Säugerzellen erfolgreich zu bearbeiten. Gen Störung im primären hämatopoetischen Vorläuferzellen praktikabler zu machen wird vorausgesagt, um die wissenschaftlichen Erkenntnisse auf dem Gebiet der HSPCs und hämatologischen Krankheiten schnell zu verbessern. Wichtig ist, macht das hier beschriebene Protokoll es auch möglich, gleichzeitig mehrere Knockouts mit hohem Wirkungsgrad, so dass für die Modellierung von komplexen genetischen Landschaften, häufig gesehen bei leukämischen Erkrankungen zu generieren.

Obwohl die hier beschriebenen Protokolle auf Gen Störung ausgerichtet sind, können sie für gen-Knock-in-Experimente leicht angepasst werden. Kann dies durch die Co-Delivery einsträngige Oligonukleotid-Vorlagen für Homologie gerichtete Reparatur6,13 (HDR) oder durch die Signalweiterleitung Zellen Post-Elektroporation mit AAV6 Vektoren, enthält die Homologie Vorlage12. Die Fähigkeit zu reparieren oder stellen bestimmte Mutationen im HSPCs wird neue therapeutische Strategien für die Gentherapie und die erweiterte Studie von Krebs Fahrer Mutationen in AML und anderen hämatologischen Krankheiten erleichtern. Zwar HDR in menschlichen HSPCs erfolgreiche6,12,13, Maus HSPCs schwierig gewesen, mit dieser Strategie6zu bearbeiten. Optimierung der HDR-Protokolle in der Human- und insbesondere der Maus HSPCs ermöglicht genauere Bearbeitung und die Entwicklung von Werkzeugen, bearbeitete Zellen unter Verwendung von endogenen tagging zu verfolgen.

Schließlich ist es auch vorgesehen, dass die Unterbrechung der mutierten Allele der Gewinn der Funktion einen möglichen Therapieansatz für angeborene und erworbene Störungen der blutbildenden darstellen könnte. In diesem Szenario wird ein DNA-freie Ansatz geraten, um mögliche Integrationen zu vermeiden, die Transformation zu fördern könnte. Darüber hinaus reduziert die "hit and run" Ansatz die Möglichkeit unerwünschte Ziel folgen. Mehr Aufwand ist erforderlich, um bestimmte Delivery-Systeme zu entwickeln, die neue Wege für die Behandlung von malignen und nicht-malignen hämatologischen Erkrankungen öffnen würde.

Disclosures

Keine Interessenkonflikte offenlegen

Acknowledgments

Diese Arbeit wurde unterstützt durch die Krebsprävention und Forschungsinstitut von Texas (RP160283, RP140001 und R1201), die Gabrielle Angel Foundation für Krebsforschung, Edward P. Evans Foundation und der NIH (DK092883, CA183252, CA125123, P50CA126752, CA193235 und DK107413). M.C.G Baylor Forschung befürwortet für Student Wissenschaftler unterstützt. Durchflusszytometrie wurde teilweise durch das NIH (National Center for Research Resources Grant S10RR024574, Nationales Institut der Allergie und ansteckende Krankheiten AI036211 und nationales Krebs-Institut P30CA125123) am Baylor College of Medicine unterstützt Zytometrie und Zelle Kern sortieren.

Materials

Name Company Catalog Number Comments
Tissue culture plates according to cell numbers
1.5 ml Eppendorf microtubes Sigma Z606340-1000EA
50ml Falcon tubes Corning 352070
Nuclease Free Water - DEPC treated ThermoFisher Scientific AM9915G
KAPA HiFi HotStart ReadyMix (2X) KAPA Biosystems KK2600
MinElute PCR purification Kit Qiagen 28004
RNAse Zap RNAse Decontamination Solution ThermoFisher Scientific AM9780
RNA Clean and Concentrator-25 Zymo R1017
HiScribe T7 High Yield RNA Synthesis Kit New England Biolabs E2040S
Alt-R S.p. Cas9 Nuclease 3NLS, 100 µg IDT 1074181
40 mm Cell Strainers VWR 352340
Dulbecco's Phosphate Buffered Saline (PBS) GenDEPOT CA008-050
Fetal Bovine Serum (FBS), Regular Corning 35010CV
AutoMACS Pro Separator or MACS manual Cell Separation columns Miltenyi
Neon Transfection System Device ThermoFisher Scientific
Neon Transfection System 10mL kit ThermoFisher Scientific MPK1025 For larger numbers of cells (see protocol) Neon Transfection System 100 mL kit (# MPK10025) can be used
Name Company Catalog Number Comments
UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific 15575020 For human experiments only
Lymphoprep Stem Cell Technologies 7851 For human experiments only
CD34 MicroBead Kit UltraPure human Miltenyi Biotec 130-100-453 For human experiments only
Stem Span SFEM II Stem Cell Technologies 9605 For human experiments only
Recombinant Human SCF Miltenyi Biotec 130-096-695 For human experiments only
Recombinant Human TPO Miltenyi Biotec 130-094-013 For human experiments only
Recombinant Human FLT3L Miltenyi Biotec 130-096-479 For human experiments only
Name Company Catalog Number Comments
Mouse dissection tools For mouse experiments only
Mortar and Pestle For mouse experiments only
Hank's Balanced Salt Solution (HBSS) Gibco 14170112 For mouse experiments only
Biotin-conjugated anti c-kit antibody eBioscience 13-1171-82 For mouse experiments only
Anti-Biotin MicroBeads Miltenyi Biotec 130-090-485 For mouse experiments only
X VIVO-15, with L-Glutamine, Genatmycin and Phenol Red Lonza 04-418Q For mouse experiments only
Mouse IL-6 Peprotech 216-16 For mouse experiments only
Mouse TPO Peprotech 315-14 For mouse experiments only
Mouse IL-3 Peprotech 213-13 For mouse experiments only
Mouse SCF Peprotech 250-03 For mouse experiments only

DOWNLOAD MATERIALS LIST

References

  1. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, 816-821 (2012).
  2. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  3. Sternberg, S. H., Doudna, J. A. Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell. 58, 568-574 (2015).
  4. Heckl, D., et al. Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 32, 941-946 (2014).
  5. Mandal, P. K., et al. Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell stem cell. 15, 643-652 (2014).
  6. Gundry, M. C., et al. Highly Efficient Genome Editing of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. Cell Rep. 17, 1453-1461 (2016).
  7. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24, 1012-1019 (2014).
  8. Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature methods. 12, 982-988 (2015).
  9. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Current protocols in immunology. 111, A3 B 1-3 (2015).
  10. Lykke-Andersen, S., Jensen, T. H. Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol. 16, 665-677 (2015).
  11. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 42, e168 (2014).
  12. Dever, D. P., et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells. Nature. 539, 384-389 (2016).
  13. DeWitt, M. A., et al. Selection-free genome editing of the sickle mutation in human adult hematopoietic stem/progenitor cells. Sci Transl Med. 8, 360ra134 (2016).
  14. Aguirre, A. J., et al. Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting. Cancer Discov. 6, 914-929 (2016).
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).More

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter