Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Murine और मानव टेम जनक कोशिकाओं के अत्यधिक कुशल जीन व्यवधान CRISPR द्वारा Cas9/

doi: 10.3791/57278 Published: April 10, 2018
* These authors contributed equally

Summary

माउस और मानव प्राथमिक टेम कक्षों में तीव्र CRISPR/Cas9-मध्यस्थता जीन व्यवधान के लिए एक प्रोटोकॉल इस आलेख में वर्णन किया गया है । Cas9-sgRNA ribonucleoproteins के माध्यम से electroporation के माध्यम से पेश कर रहे हैं sgRNAs के माध्यम से उत्पन्न इन विट्रो प्रतिलेखन और वाणिज्यिक Cas9. उच्च संपादन क्षमता सीमित समय और वित्तीय लागत के साथ प्राप्त कर रहे हैं ।

Abstract

टेम स्टेम सेल (HSCs) क्षेत्र में अग्रिमों आनुवंशिक रूप से इंजीनियर प्राथमिक जनक कोशिकाओं के रूप में के रूप में अच्छी तरह से पशु मॉडल के लिए तरीकों से सहायता प्राप्त किया गया है । HSCs में पूरा जीन पृथक को नॉकआउट चूहों की उस पीढ़ी की आवश्यकता है जिसमें से HSCs को पृथक किया जा सके, और प्राथमिक मानव HSCs में जीन पृथक संभव नहीं था. वायरल transduction दृष्टिकोण नीचे दस्तक के लिए इस्तेमाल किया जा सकता है, लेकिन इन चर प्रभावकारिता से सामना करना पड़ा । सामांय में, मानव और माउस टेम कोशिकाओं के आनुवंशिक हेरफेर कम क्षमता और व्यापक समय और लागत प्रतिबद्धताओं द्वारा बाधा थी । हाल ही में, CRISPR/Cas9 नाटकीय रूप से स्तनधारी कोशिकाओं के डीएनए इंजीनियर करने की क्षमता का विस्तार किया है । हालांकि, CRISPR/Cas9 के आवेदन टेम कोशिकाओं को चुनौती दी गई है, मुख्य रूप से उनके कम अभिकर्मक क्षमता, प्लाज्मिड की विषाक्तता आधारित दृष्टिकोण और वायरस आधारित प्रोटोकॉल की धीमी गति से बदलाव समय के कारण ।

CRISPR/Cas9-मध्यस्थता जीन संपादन murine और मानव टेम स्टेम और जनक कोशिकाओं में 90% तक की नॉकआउट क्षमता के साथ प्रदर्शन करने के लिए एक तीव्र विधि इस आलेख में प्रदान की गई है । यह दृष्टिकोण एक सुव्यवस्थित तीन दिन कार्यप्रवाह के साथ एक ribonucleoprotein (RNP) वितरण रणनीति का इस्तेमाल करता है । Cas9-sgRNA RNP का उपयोग एक हिट और चलाने के दृष्टिकोण के लिए अनुमति देता है, संपादित कोशिकाओं के जीनोम में कोई exogenous डीएनए दृश्यों का परिचय और बंद लक्ष्य प्रभाव को कम करने । RNP-आधारित विधि तेजी से और सीधा है: यह sgRNAs, वायरस तैयारी या विशिष्ट sgRNA रासायनिक संशोधन के क्लोनिंग की आवश्यकता नहीं है । इस प्रोटोकॉल के साथ, वैज्ञानिकों को सफलतापूर्वक oligonucleotide संश्लेषण के लिए डाउनटाइम सहित एक सप्ताह के भीतर प्राथमिक टेम कोशिकाओं में ब्याज की एक जीन की पीटकर पैदा करने में सक्षम होना चाहिए । इस दृष्टिकोण उपयोगकर्ताओं की एक बहुत व्यापक समूह अपनी आवश्यकताओं के लिए इस प्रोटोकॉल अनुकूलन करने की अनुमति देगा ।

Introduction

CRISPR/Cas9 के आगमन मौलिक स्तनधारी कोशिकाओं में जीन संपादन सरल है । अर्ली CRISPR/Cas9 प्रोटोकॉल का उपयोग प्लाज्मिड या Cas9 प्रोटीन और sgRNA1,2,3के वायरस आधारित डिलीवरी । इन दृष्टिकोण सेलुलर और पशु मॉडल के विकास के लिए क्रांतिकारी साबित कर दिया और भी सफलतापूर्वक प्राथमिक टेम स्टेम और जनक कोशिकाओं (HSPCs)4,5के लिए लागू किया गया है । हालांकि, इन पद्धतियों में कई कमियां हैं । सबसे पहले, जीन व्यवधान दक्षता अक्सर 50%4,5से नीचे रहता है । हालांकि इस सेल लाइनों में नॉकआउट (KO) क्लोन पैदा करने के लिए पर्याप्त है, अल्पकालिक संस्कृति के लिए आवश्यकता HSPCs ऐसी रणनीति के लिए उत्तरदाई नहीं बनाता है । दूसरा, सीमा क्लोनिंग के लिए आवश्यकता sgRNAs कि एकल प्रयोगों में परीक्षण किया जा सकता है और बड़े, transfect निर्माण करने के लिए मुश्किल उत्पंन की राशि । तीसरा, इन तरीकों वैज्ञानिकों बल बदलाव समय धीमी गति से ।

इन सीमाओं को दूर करने के लिए, हमारे समूह विकसित और हाल ही में प्रकाशित एक वैकल्पिक CRISPR/Cas9 दृष्टिकोण का उपयोग HSPCs में Cas9-sgRNA ribonucleoproteins (RNPs)-आधारित वितरण6। इस रणनीति में, CRISPR के कच्चे घटकों (Cas9 प्रोटीन और इन विट्रो लिखित sgRNA) पूर्व जटिल और सीधे electroporation (चित्रा 1) के माध्यम से लक्ष्य कोशिकाओं में दिया जाता है । Cas9-sgRNA RNP परिसर के आधे जीवन के रूप में समय है कि प्लाज्मिड या वायरल न्यूक्लिक एसिड प्रतिलिखित है की तुलना में कम है, बंद लक्ष्य दर जल्दी7दृष्टिकोण की तुलना में कम है । इसके अलावा, RNP दृष्टिकोण exogenous डीएनए के किसी भी स्रोत को नष्ट करने का लाभ जोड़ता है, जो बेतरतीब ढंग से सेलुलर परिवर्तन करने के लिए अग्रणी लक्ष्य सेल जीनोम में एकीकृत कर सकते हैं ।

यह प्रोटोकॉल RNP-आधारित जीन व्यवधान प्रयोगों के लिए एक सुव्यवस्थित कार्यप्रवाह पर आधारित है, जैसा कि चित्र 1में दर्शाया गया है । पहला कदम डिजाइन और प्रत्येक sgRNA के लिए प्राइमरों का आदेश है । इन प्राइमरों sgRNA डीएनए टेंपलेट है कि इन विट्रो प्रतिलेखन (IVT) के लिए sgRNAs प्राप्त करने के लिए इस्तेमाल कर रहे है बनाने के लिए उपयोग किया जाता है । शुद्ध sgRNAs तो पहले से खरीदा Cas9 प्रोटीन के साथ मशीन हैं, Cas9-sgRNA RNP परिसरों के रूप में । अंत में, पूर्व परिसर में Cas9-sgRNA RNPs कोशिकाओं में electroporated हैं । निम्नलिखित electroporation, संपादन दक्षता का परीक्षण किया जा सकता है और इन विट्रो में/vivo प्रयोगों में शुरू किया जा सकता है, जरूरतों के आधार पर. इस अभिनव प्रयोगात्मक दृष्टिकोण का एक विस्तृत वर्णन नीचे पाया जा सकता है ।

Protocol

प्रोटोकॉल Baylor कॉलेज ऑफ मेडिसिन मानव आचार समिति के दिशानिर्देशों का पालन करता है । चूहों पर निष्पादित सभी प्रायोगिक प्रक्रियाओं Baylor कॉलेज ऑफ मेडिसिन संस्थागत पशु देखभाल और उपयोग समिति द्वारा अनुमोदित कर रहे हैं ।

1. sgRNA Fwd डिजाइन

  1. http://www.crisprscan.org/?page=track8 पर नेविगेट करने के लिए ब्याज की sgRNAs डिजाइनिंग शुरू ।
  2. "माउस" या "मानव" बटन पर क्लिक करें ब्याज के सेल प्रकार के आधार पर ।
  3. UCSC खोज बॉक्स और प्रेस जाओ में ब्याज की जीन दर्ज करें ।
  4. में ज़ूम और जीन के क्षेत्र के लिए कदम (यानीएक विशिष्ट एक्सॉन) है कि ब्याज के लक्ष्य के लिए है ।
    नोट: कुशल जीन व्यवधान को प्राप्त करने के लिए यह अपने विशिष्ट कोशिका प्रकार में सभी प्रतिलिखित isoforms में वर्तमान एक्सॉन (ओं) को लक्षित करने की सिफारिश की है ।
  5. सुनिश्चित करें कि संभावित sgRNA लक्ष्य अनुक्रम "CRISPRscan भविष्यवाणियों पर जीन (CDS)" शीर्षक के अंतर्गत सूचीबद्ध हैं ।
  6. ढूँढें और एक अपेक्षाकृत उच्च स्कोर और कुछ ऑफ लक्ष्य के साथ एक लक्ष्य अनुक्रम पर क्लिक करें (उज्ज्वल हरे रंग में प्रकाश डाला). "Oligo अनुक्रम" अनुभाग के अंतर्गत प्रदर्शित पूर्ण अनुक्रम की प्रतिलिपि बनाएँ और इसे किसी पाठ दस्तावेज़ में चिपकाएँ । "ATAGC" को अनुक्रम के 3 ' अंत में जोड़ें । एक बार पूर्ण, पूरी लंबाई अनुक्रम के लिए आदेश जगह है ।
    नोट: प्रत्येक लक्ष्य अनुक्रम के लिए, CRISPRscan8 एक "एकीकृत" आगे sgRNA प्राइमर है कि T7 प्रमोटर, protospacer (लक्ष्य) अनुक्रम, और सार्वभौमिक पाड़ ओवरलैप अनुक्रम ( चित्र 1aदेखें) शामिल प्रदान करता है । एक पूर्ण-लंबाई अनुक्रम या तो 56 या 57 न्यूक्लियोटाइड protospacer की लंबाई के आधार पर किया जाता है ।

2. sgRNA डीएनए टेम्पलेट संश्लेषण

  1. भंग और sgRNA Fwd और यूनिवर्सल रेव प्राइमर (पूरा अनुक्रम के लिए 1 तालिका देखें) पतला । आदेश में एक 10 µ एम अंतिम एकाग्रता प्राप्त करने के लिए, कैसे 100 µ मीटर के लिए प्राइमरों को पतला करने के लिए पर निर्माता अनुदेश का पालन करें, तो nuclease मुक्त पानी के साथ एक 1:10 कमजोर पड़ने बनाते हैं ।
  2. ओवरलैपिंग पीसीआर प्रदर्शन करने के लिए ( चित्र 1bदेखें), पीसीआर स्ट्रिप ट्यूबों में निंनलिखित मिश्रण: 2 µ l आगे sgRNA प्राइमर (10 µ मीटर), 2 µ एल यूनिवर्सल रेव पाड़ प्राइमर (HPLC शुद्धि) (10 µ मीटर), 10 µ एल उच्च निष्ठा डीएनए पोलीमरेज़ मास्टर मिक्स (2x) और 6 µ एल nuclease-मुफ्त पानी ।
  3. निंनलिखित कार्यक्रम के साथ पीसीआर चलाने के लिए: 95 ° c के लिए 3 मिनट, 98 ° c के लिए 5 s, 60 ° c के लिए 5 s, 72 ° c के लिए 10 s, 6 चक्र के लिए 2, 72 ° c 1 मिनट के लिए, 4 ° c हमेशा के लिए जाओ ।
  4. डीएनए शुद्धि कॉलम का उपयोग कर पीसीआर उत्पाद शुद्ध (सामग्री की तालिका देखें) । का पालन करें निर्माता निर्देशों और elute के साथ 11.5 µ एल के रेफरेंस बफर.
  5. एक spectrophotometer पर पीसीआर उत्पादों की एकाग्रता को मापने । रिक्त उपकरण रेफरेंस बफर के साथ ।
    नोट: डीएनए एकाग्रता के बीच होना चाहिए ~ 50 और ~ 120 एनजी/µ एल

3. इन विट्रो sgRNA की प्रतिलेखनी

  1. पीसीआर पट्टी ट्यूबों में निम्नलिखित घटकों को मिलाएं (रिएजेंट आरएनए संश्लेषण किट में प्रदान की जाती हैं): eluted डीएनए के 4 µ एल, dNTPs के 4 µ एल, 10x प्रतिक्रिया बफर के 1 µ एल, और µ आरएनए T7 एंजाइम मिक्स के 1 पोलीमरेज़ एल.
  2. 37 डिग्री सेल्सियस से कम 4 घंटे के लिए नमूनों की मशीन ।
  3. दस्ताने हाथों से RNase हटाने के लिए RNase सफाई एजेंट लागू होते हैं ।
  4. nuclease-नि: शुल्क पानी के साथ 50 µ एल की कुल मात्रा तक प्रत्येक आरएनए नमूना लाओ (शाही सेना शुद्धि का पहला कदम निंनलिखित निर्माता निर्देश) ।
  5. आरएनए शुद्धि निम्नलिखित निर्माता निर्देश और किट के 50 µ एल में elute-प्रदान की nuclease-मुक्त पानी के साथ आगे बढ़ें ।
  6. एक spectrophotometer पर eluted sgRNA की एकाग्रता को मापने । nuclease-मुक्त पानी के साथ साधन रिक्त ।
    नोट: शुद्धि के बाद अपेक्षित उपज है 50-80 आरएनए के µ जी (यानी 1.0 की एकाग्रता-1.5 µ g/µ l) ।
  7. शुद्ध sgRNA तुरंत प्रयोग करें या 2-4 µ एल के aliquots में स्टोर-80 ° c लंबी अवधि के लिए ।

4. HSPC अलगाव और संस्कृति

  1. Murine HSPCs अलगाव और संस्कृति
    नोट: पुरुष और महिला Ubc-GFP चूहों (JAX004353) और Rosa26-LSL-tdTomato (JAX007914) के साथ पार Vav-iCre (JAX008610) उम्र के 2-6 महीने में नीचे दिखाए गए परिणामों को प्राप्त करने के लिए इस्तेमाल किया गया.
    1. सर्वाइकल विस्थापन के माध्यम से चूहों को Euthanize anesthetized ।
      नोट: दो प्रशिक्षित व्यक्तियों को स्वतंत्र रूप से एक श्वसन और दिल की धड़कन की कमी टिप्पण द्वारा सफल इच्छामृत्यु की पुष्टि करनी चाहिए कम 5 मिनट । जानवरों से त्वचा को हटा दें ।
    2. काटना tibias, femurs, और चूहों की श्रोणि शिखाएं और सभी मांसपेशी और संयोजी ऊतक के चारों ओर विच्छेदित हड्डियों को दूर । HBSS के साथ बर्फ पर एक ऊतक संस्कृति डिश में बरकरार हड्डियों प्लेस 2% FBS (HBSS +) के साथ पूरक । एक लामिना प्रवाह हूड में ले जाएं जैसे ही अल हड्डियों को साफ किया गया है और ऊतक संस्कृति डिश को हस्तांतरित ।
    3. 2 मिलीलीटर बर्फ ठंड HBSS + प्रति 3 हड्डियों से युक्त, बाँझ मोर्टार करने के लिए साफ हड्डियों स्थानांतरण । मूसल का प्रयोग, हड्डी के टुकड़ों में हड्डियों को कुचलने, भीतर से मज्जा जारी । जारी रखें pestling जब तक हड्डियों के नीचे दरार बंद मूसल ।
    4. एक 40 µm सेल छलनी का उपयोग कर एक 50 मिलीलीटर शंकु ट्यूब में मोर्टार और फिल्टर से supernatant लीजिए । शेष हड्डी के टुकड़ों को 5 मिलीलीटर बर्फ से कुल्ला करें-कोल्ड HBSS + और उसी में फिल्टर 50 मिलीलीटर शंकु ट्यूब का उपयोग कर एक ही 40 µm छलनी ।
    5. बर्फ ठंडा HBSS के साथ ट्यूब बंद टॉपिंग द्वारा दो बार कोशिकाओं को धोने + और 7 मिनट के लिए 400 x g पर केंद्रापसारक । supernatant को त्यागें ।
    6. दूसरा धोने के बाद बर्फ ठंडा पंजाबियों के 20 मिलीलीटर में सेल गोली reसस्पेंड । trypan द्वारा व्यवहार्य कोशिकाओं गिनती-नीले अपवर्जन9
    7. गर्मी 1 x 108 व्यवहार्य कोशिकाओं प्रति 1 मिलीलीटर बर्फ-शीत HBSS + के साथ बायोटिन-संयुग्मित सी-किट एंटीबॉडी बर्फ पर 45 मिनट के लिए 1:100 कमजोर पड़ने पर ।
    8. 7 मिनट के लिए 400 x g पर केंद्रापसारक द्वारा बर्फ ठंडा HBSS + के साथ कोशिकाओं को धो और supernatant त्याग ।
    9. निर्माता निर्देशों के बाद विरोधी बायोटिन चुंबकीय मोतियों के साथ कोशिकाओं को गर्मी ।
    10. चुंबकीय कॉलम या निर्माता निर्देशों का पालन चुंबकीय सक्रिय सेल सॉर्टर का उपयोग कर सी किट सकारात्मक कोशिकाओं को अलग । 15 मिलीलीटर शंकु ट्यूबों में सी किट सकारात्मक कोशिकाओं को इकट्ठा ।
    11. 15 मिलीलीटर शंकु ट्यूब बंद टॉपिंग और 7 मिनट के लिए 400 x g पर केंद्रापसारक द्वारा पंजाबियों के साथ दो बार कोशिकाओं को धो लें । supernatant को त्यागें । दो धोने के बीच trypan नीले अपवर्जन9द्वारा व्यवहार्य कोशिकाओं की कुल संख्या की गणना ।
    12. 2% FBS के साथ पूरक murine HSPCs के लिए संस्कृति माध्यम के 100 µ एल प्रति 106 viablecells करने के लिए ऊपर की एकाग्रता पर सी किट + कोशिकाओं reसस्पेंड, 50 एनजी/एमएल माउस स्टेम सेल फैक्टर (एससीएफ), 50 एनजी/एमएल माउस thrombopoietin (टीपीओ), 10 एनजी/एमएल माउस आईएल-3, और 10 एनजी/
    13. 37 डिग्री सेल्सियस पर कोशिकाओं की मशीन, 5% सह electroporation के लिए पहले से कम 1 घंटे के लिए 24 एच की एक अधिकतम करने के लिए2 .
  2. मानव HSPCs अलगाव और संस्कृति
    नोट: इन कदमों को एक लामिना फ्लो हुड में किया जाना चाहिए ।
    1. एक 40 µm सेल छलनी के माध्यम से अस्थि मज्जा/
    2. पतला 1:2 फ़िल्टर्ड अस्थि मज्जा/1 mM EDTA (पंजाब/EDTA) के साथ पूरक
    3. एक 50 मिलीलीटर शंकु ट्यूब में घनत्व ढाल मध्यम के 15 मिलीलीटर वितरण । धीरे घनत्व ढाल मध्यम सतह पर पतला अस्थि मज्जा/गर्भनाल रक्त के 30 मिलीलीटर डालना । यदि सेल सस्पेंशन की मात्रा 30 मिलीलीटर से अधिक है तो एकाधिक ट्यूबों तैयार करें ।
      नोट: के लिए रक्त और घनत्व ढाल माध्यम के रूप में संभव के रूप में तेज के बीच इंटरफेस रखने के लिए सुनिश्चित करें ।
    4. कोई मंदी के साथ 30 मिनट के लिए 750 x जी में ट्यूबों स्पिन ।
    5. मध्यम अंतरफलक पर mononuclear सेल परत detectable लीजिए और एक साफ 50 मिलीलीटर शंकु ट्यूब के लिए स्थानांतरण । EDTA के साथ ट्यूब भरें और 15 मिनट के लिए 280 जी पर कोशिकाओं स्पिन । supernatant को त्यागें ।
    6. पंजाब में दो बार कोशिकाओं को धो/EDTA कताई 400 x जी में 7 मिनट के लिए और supernatant त्याग ।
    7. निर्माता निर्देशों के बाद विरोधी CD34 चुंबकीय मोतियों के साथ mononuclear कोशिकाओं की मशीन ।
    8. CD34 + कोशिकाओं चुंबकीय कॉलम या चुंबकीय-सक्रिय सेल सॉर्टर का उपयोग कर निर्माता निर्देशों के बाद अलग । 15 मिलीलीटर शंकु ट्यूबों में CD34 + कोशिकाओं को इकट्ठा ।
    9. धो एकत्र CD34 + कोशिकाओं को दो बार बंद पंजाबियों के साथ ट्यूब टॉपिंग और 7 मिनट के लिए 400 x जी पर कताई और supernatant खारिज द्वारा । दो धोने के बीच trypan नीले अपवर्जन9द्वारा व्यवहार्य कोशिकाओं की कुल संख्या की गणना ।
    10. संस्कृति मध्यम में कोशिकाओं को reसस्पेंड के साथ पूरक 100 एनजी/एमएल मानव एससीएफ, 100 एनजी/एमएल मानव FLT3 ligand (FLT3L), 100 एनजी/एमएल मानव टीपीओ की एकाग्रता पर ~ 2.5 x 105 व्यवहार्य कोशिकाओं/संस्कृति पृथक CD34 + कोशिकाओं पर 37 ° c, 24 घंटे के लिए 5% CO2 एक अधिकतम 48 एच से पहले ते electroporation.
      नोट: प्रवाह cytometry द्वारा समृद्ध CD34 + जनसंख्या की शुद्धता electroporation जांच करने के लिए पहले ।

5. Electroporation

नोट: निम्नलिखित प्रोटोकॉल 10 µ l electroporation युक्तियों के लिए ऑप्टिमाइज़ किया गया है. सभी कदम एक लामिना प्रवाह हुड में प्रदर्शन किया जाना चाहिए ।

  1. trypan नीले बहिष्करण9द्वारा कक्षों की गणना । जमा 2 एक्स 105 व्यवहार्य कोशिकाओं को दोहराने प्रति (उदा इकट्ठा 6 x 105 कोशिकाओं के लिए 3 electroporations) ।
  2. पंजाबियों के साथ दो बार कोशिकाओं को धोने, 7 मिनट के लिए 300 x जी में कताई और ध्यान से supernatant हटा दें ।
  3. समानांतर में, Cas9-sgRNA RNP परिसरों को पीसीआर ट्यूबों में 20-30 मिनट के लिए आरटी 1.5 µ जी Cas9 के साथ तैयार करने के लिए प्रत्येक दोहराने के लिए कुल µ के 1 sgRNA जी के साथ, Cas9 केवल नियंत्रण को छोड़कर ।
    नोट: Cas9 प्रोटीन पर 10 µ g/µ l एकाग्रता प्रदान की जाती है । सटीक pipetting सुनिश्चित करने के लिए, 1:10 पतला Cas9 प्रोटीन की कुल राशि nuclease-मुफ्त पानी के साथ की जरूरत है (उदाहरण के लिए 10 electroporations ले µ प्रोटीन के 1 Cas9 एल और यह µ के 9 nuclease एल के साथ पतला-मुक्त पानी और गर्मी की 1 µ l के साथ पतला Cas9 के प्रति दोहराने । sgRNA की एकाग्रता के आधार पर, Cas9 और sgRNA की कुल मात्रा दोहराने के प्रति 1.7 और 2 µ एल के बीच शामिल किया जाना चाहिए । यदि दो sgRNAs मशीन का उपयोग कर एक दोहराने प्रति sgRNA के 500 एनजी; यदि 3 sgRNAs मशीन का उपयोग कर 330 नकल प्रति sgRNA के एनजी, और इतने पर ।
  4. की कुल मात्रा की गणना करने के लिए 10 µ l गुणा द्वारा की जरूरत कुल प्रतिकृति (30 µ एल के लिए 3 दोहराने की जरूरत है). की गणना की वॉल्यूम बफ़र T. सुनिश्चित करें कि सेल निलंबन के अंतिम एकाग्रता 2 x 107 कोशिकाओं/एमएल है के साथ छर्रों कोशिकाओं reसस्पेंड ।
  5. reसस्पैंड कोशिकाओं के Aliquot 10 µ एल/पूर्व परिसर sgRNA युक्त एक पीसीआर ट्यूब में दोहराने/Cas9 RNP (जैसे एक तपसिल Aliquot सेल निलंबन के 30 μL के लिए पूर्व परिसर में Cas9-sgRNA युक्त एक पीसीआर ट्यूब में) ।
  6. स्थापित करने के लिए electroporation प्रणाली के साधन पर बारी और एक electroporation cuvette में बफर ई के 3 मिलीलीटर जोड़ने के लिए, और cuvette धारक में cuvette स्लाइड ।
  7. डिवाइस पर वांछित electroporation शर्तें सेट करें: मानव HSPCs (1600 v, 10 ms, 3 दालें) या माउस HSPCs (1700 v, 20 ms, 1 पल्स).
    नोट: यदि वांछित, CD34 पर प्रयोग करने से पहले + HSPCs, sgRNA दक्षता तीव्र माइलॉयड ल्यूकेमिया (एएमएल) सेल लाइनों (जैसे HL60) का उपयोग कर एक ही रणनीति (एएमएल सेल लाइनों के लिए एंटीबायोटिक मुक्त माध्यम का उपयोग) निम्नलिखित electroporation शर्तों के साथ पर परीक्षण किया जा सकता है: आर, 1350 वी, 35 ms, 1 पल्स बफर ।
  8. electroporation एक विशेष electroporation पिपेट के साथ प्रदर्शन किया है, जो एक पंजा है कि electroporation पिपेट टिप पर कुंडी है । electroporation पिपेट पकड़ो, पंजा का विस्तार, पिपेट टिप के अंदर डिस्क पकड़ो, और फिर दृढ़ता से पिपेट नीचे प्रेस को सुरक्षित टिप ।
  9. पिपेट नमूना ऊपर और नीचे 10 बार मिश्रण करने के लिए । बाहर ले 10 µ एल, यकीन है कि वहां कोई बुलबुले कर रहे हैं, और पिपेट टिप सीधे electroporation cuvette में इलेक्ट्रोलाइटिक बफर में डालें । cuvette की दीवारों को छूने की कोशिश न करें । प्रेस "प्रारंभ" स्क्रीन पर । "पूरा" संदेश प्रकट होता है के बाद, पिपेट निकालें, और सामग्री में अच्छी तरह से नए HSPC संस्कृति माध्यम के साथ वितरण ।
  10. सभी नमूनों के लिए दोहराएँ । नमूनों के बीच पिपेट युक्तियां बदलें, केवल यदि आवश्यक हो ।

Representative Results

इस प्रोटोकॉल का लक्ष्य जीन नॉकआउट प्रदर्शन करने के लिए है (KO) माउस और मानव HSPCs में Cas9-sgRNA RNPs का उपयोग कर । कार्यप्रवाह आसान और तेज है और प्रयोगात्मक डिजाइन से एक सप्ताह से भी कम समय में प्रयोगों के पूरा करने के लिए दक्षता के आकलन के लिए अनुमति देता है ।

प्लाज्मिड-या वायरस आधारित दृष्टिकोण की तुलना में, हमारे प्रोटोकॉल की सफलता sgRNA RNPs और electroporation के संयोजन पर बनाता है । इस क्लोनिंग मुक्त रणनीति काफी समय transfect को घटकों को प्राप्त करने की जरूरत को छोटा करता है । इसके अलावा, electroporation कोशिकाओं के 95% तक की अभिकर्मक के लिए अनुमति देता है, RNPs. sgRNAs के वितरण को अधिकतम करने के माध्यम से प्रयोगशाला में synthetized जा सकता है इन विट्रो प्रतिलेखन (IVT), जबकि शुद्ध Cas9 प्रोटीन कई कंपनियों से खरीदा जा सकता है ( प्रोटोकॉल देखें) । IVT के लिए sgRNA डीएनए टेम्पलेट्स sgRNA Fwd प्राइमर का उपयोग कर एक छोटी पीसीआर प्रदर्शन प्राप्त कर रहे हैं (चित्र 1a, बी) और यूनिवर्सल पाड़ रेव प्राइमर (आंकड़ा 1b -देखें प्रोटोकॉल). इसके बाद पीसीआर प्रोडक्ट को IVT (फिगर 1C) के लिए टेम्पलेट के तौर पर इस्तेमाल किया जाता है । Cas9-sgRNA RNP परिसरों 15-30 मिनट sgRNAs और Cas9(चित्रा 1C) के लिए तैयार कर रहे हैं । अंत में, sgRNA RNPs कोशिकाओं में electroporated हैं । संपादित HSPCs तो दोनों में इन विट्रो और vivo प्रयोगों में प्रदर्शन किया जा सकता है ।

माउस कोशिकाओं में जीन व्यवधान

Cas9-sgRNA RNP electroporation रणनीति की प्रभावकारिता को प्रदर्शित करने के लिए, सी-किट + चूहों से पृथक HSPCs बैरे व्यक्त GFP या tdTomato electroporated के खिलाफ sgRNA या GFP के साथ tdTomato गया है. GFP के खिलाफ डिजाइन तीन sgRNA के अलावा, GFP sg1 सबसे कुशलता से प्रदर्शन किया, लगभग 70 प्रदर्शन GFP अभिव्यक्ति के 75% विघटन के रूप में प्रवाह cytometry द्वारा निर्धारित (चित्र 2a, बी) । जीनोमिक स्तर पर जीन व्यवधान आवृत्ति को बढ़ाता है, electroporated कोशिकाओं से जीनोमिक डीएनए अलग किया गया था और T7 endonuclease मैं आधारित (T7EI) परख किया गया था । जैसा कि चित्र 2cमें दिखाया गया है, T7EI परख 60% indel गठन तक पता चला । ध्यान दें कि T7EI परख indels की आवृत्तियों को मूल्यवान समझना करते हैं । हमने भी tdTomato Rosa26 से tdTomato और electroporated HSPCs व्यक्त लोकस के खिलाफ sgRNA उत्पन्न की. जैसा कि चित्र 2dमें दिखाया गया है, tdTomato sg1 कुशलता से tdTomato की अभिव्यक्ति ablated ।

मानव कोशिकाओं में जीन व्यवधान

यहां, कुशल व्यवधान एक एकल sgRNA दृष्टिकोण लक्ष्यीकरण CD45, टेम कोशिकाओं पर व्यक्त की एक कोशिका सतह मार्कर के साथ प्राप्त किया, दिखाया गया है । तीन sgRNAs लक्ष्यीकरण CD45 के विभिंन exons (CD45 sg1, sg2, और sg3) डिजाइन किए गए थे । sgRNAs की दक्षता HL60 एएमएल सेल लाइन (चित्रा 3ए) में परीक्षण किया गया था । प्रोटीन KO electroporation के बाद प्रवाह cytometry द्वारा मूल्यांकन किया गया था 5 दिन । CD45 sg1 सबसे कुशल था (98% को दक्षता- चित्रा 3) और आगे के प्रयोगों के लिए इस्तेमाल किया गया था । चित्रा 3 बी प्राथमिक मानव CD34 में CD45 KO दिखाता है + जनक CD45 sg1 का उपयोग कर कोशिकाओं, प्रवाह cytometry द्वारा मूल्यांकन 5 दिनों के बाद electroporation । जबकि CD34 अभिव्यक्ति अप्रभावित थी, CD45 अभिव्यक्ति के बारे में 80% कोशिकाओं में खो गया था । २००.००० संपादित प्राथमिक CD34 + कोशिकाओं electroporation के बाद 6 घंटे में एनएसजी चूहों में रेट्रो-कक्षा में प्रत्यारोपित किया गया । अस्थि मज्जा और तिल्ली की कोशिकाओं को प्रत्यारोपण के बाद 3 महीने काटा गया । संपादित कोशिकाओं (एचएलए-एबीसी सकारात्मक, CD45 नकारात्मक, लाल रंग में प्रकाश डाला) केवल sgRNA इलाज नमूनों में और नहीं Cas9 केवल नियंत्रण (चित्रा 3सी) में detectable हैं ।

यदि चाहें, तो पास के दृश्यों को टार्गेट करने वाले दो sgRNAs हटाए जाने के लिए उपयोग किए जा सकते हैं । इस दृष्टिकोण एक पीसीआर के साथ संपादन दक्षता का एक तेजी से अनुमान के लिए अनुमति देता है और अक्सर उच्च व्यवधान दक्षता पैदा करता है । चित्रा 3 डी DNMT3Aके एक्सॉन 10 में एक 58 बीपी विलोपन के कुशल पीढ़ी से पता चलता है । २००.००० संपादित CD34 + कोशिकाओं electroporation के बाद एनएसजी चूहों में 6 घंटे प्रत्यारोपण किया गया । 58 बीपी विलोपन engrafted एनएसजी चूहों के परिधीय रक्त में स्पष्ट रूप से पाया गया इंजेक्शन के बाद 5 महीने (चित्रा 3E) लंबी अवधि engraftment क्षमताओं के साथ CD34 + कोशिकाओं के संपादन की पुष्टि.

Figure 1
चित्रा 1: तेजी से और आसान दृष्टिकोण sgRNA RNPs उत्पन्न करने के लिए । एक) sgRNA Fwd प्राइमर का प्रतिनिधित्व । sgRNA Fwd प्राइमर एक डीएनए T7 प्रमोटर, protospacer अनुक्रम और sgRNA पाड़ के साथ एक ओवरलैप अनुक्रम युक्त oligonucleotide है । 3 ' अंत में, लाल रंग में प्रकाश डाला, "ATAGC" अनुक्रम की जरूरत है कि sgRNA Fwd प्राइमर अनुक्रम CRISPRscan पर प्राप्त करने के लिए जोड़ा जा करने के लिए है । ख) पर ओवरलैप की योजनाबद्ध प्रतिनिधित्व पीसीआर IVT टेम्पलेट प्राप्त करने के लिए प्रदर्शन किया. sgRNA Fwd प्राइमर और यूनिवर्सल पाड़ रेव प्राइमर के बीच ओवरलैप विस्तार और पीसीआर द्वारा प्रवर्धन के लिए अनुमति देता है । ग) IVT प्रतिक्रिया और sgRNA RNP पूर्व जटिल का वर्णन कार्टून । पीसीआर उत्पाद शुद्ध और IVT के लिए एक टेम्पलेट के रूप में इस्तेमाल किया जाता है । IVT एकाधिक प्रतिकृति (देखें प्रोटोकॉल) में उपयोग किया जा सकता sgRNAs की एक उच्च मात्रा जनरेट करता है । sgRNA RNPs IVT से शुद्ध sgRNA और पहले से खरीदा Cas9 प्रोटीन की मशीन तैयार कर रहे हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: माउस टेम जनक कोशिकाओं में कुशल जीन व्यवधान । क) एक sgRNA लक्ष्यीकरण GFP (GFP sg1) Cas9 प्रोटीन के साथ एक साथ electroporated सी किट + murine व्यक्त HSPCs में GFP, और cytometry के बाद 24 घंटे के प्रवाह electroporation द्वारा विश्लेषण किया गया । ख) GFP sg1 की विभिन्न राशि Cas9 प्रोटीन और electroporated के 1 µ g के साथ जटिल थी । के रूप में कम के रूप में 200 GFP sg1 कुशलतापूर्वक ablated GFP अभिव्यक्ति की एनजी । ग) T7EI परख जीनोमिक डीएनए पर प्रदर्शन किया कोशिकाओं से पृथक A-B में प्रयुक्त । पीसीआर amplicon फैले Cas9-sgRNA दरार साइट 1x बफर 2 में 1:4 पतला था और एक थर्मल साइकिल चालक में धीरे से संकर । संकरित टुकड़े तो T7 endonuclease मैं 37 डिग्री सेल्सियस पर 10 मिनट के लिए 1.25 यू के साथ पचा रहे थे । पचा टुकड़े polyacrylamide जेल ट्रो द्वारा अलग किया गया । बैंड तीव्रता प्रत्येक लेन के बैंड तीव्रता की साजिश रचने के द्वारा ImageJ सॉफ्टवेयर का उपयोग कर विश्लेषण किया गया । % क्लीवेज की गणना सट बैंड्स की तीव्रता के अनुपात से अनसट बैंड्स तक की गई थी । घ) सी-किट + चूहों से पृथक HSPCs व्यक्त tdTomato sgRNA के खिलाफ tdTomato के साथ जटिल Cas9 प्रोटीन के साथ electroporated था । प्रवाह cytometry 24 घंटे प्रदर्शन के बाद electroporation से पता चला कि कोशिकाओं के लगभग 74% tdTomato नष्ट कर दिया । R26 = Rosa26. * p < 0.05, * * p < 0.01, * * * p < ०.००१ । यह आंकड़ा Gundry एट अलसे अनुकूलित किया गया है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3: मानव टेम कोशिकाओं में कुशल जीन व्यवधान । क) तीन sgRNAs लक्ष्यीकरण CD45 (CD45 sg1, sg2, और sg3) HL60 एएमएल सेल लाइन में डिजाइन और परीक्षण किए गए (electroporation स्थितियों के लिए प्रोटोकॉल देखें) । प्रवाह cytometry 5 दिन electroporation के बाद प्रदर्शन किया गया । CD45 sg1 तीन sgRNAs (को दक्षता 98%) के बीच सबसे कुशल के रूप में चुना गया था । ख) प्राथमिक मानव नाल रक्त CD34 + HSPCs में CD45 KO CD45 sg1 का प्रयोग. CD45 हानि लगभग 80% कोशिकाओं में पता लगाया जा सकता है । ध्यान दें कि संपादन के बाद CD34 व्यंजक अपरिवर्तित है । ग) संपादित मानव HSPCs को एनएसजी चूहों में कुशलता से engrafted जा सकता है. मानव nucleated कोशिकाओं को प्रदर्शित सामान्य एचएलए +/CD45 + phenotype Cas9-केवल engrafted चूहों में, जबकि engrafted के साथ चूहों CD45 में sg1 इलाज CD34 + कोशिकाओं, दोनों एचएलए +/CD45 + और एचएलए +/CD45-आबादी मानव engraftment KO कोशिकाओं के CD45 का संकेत मनाया जाता है. घ) 2% agarose जेल 2 sgRNAs (दोहरी गाइड दृष्टिकोण) के एक्सॉन 10 में मानव HSPCs में 3 अलग गर्भनाल रक्त (CB1, CB2, और CB3) से DNMT3A के द्वारा उत्पंन एक 58 बीपी विलोपन दिखा । पीसीआर 3 दिन electroporation के बाद प्रदर्शन किया था । ई) 2% agarose जेल एनएसजी चूहों में प्रत्यारोपण के बाद 58 बीपी विलोपन 5 महीने के हठ का प्रदर्शन । यह आंकड़ा Gundry एट अल से अनुकूलित किया गया है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Oligonucleotide अनुक्रम नोट
यूनिवर्सल रेव पाड़ प्राइमर gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct यूनिवर्सल रिवर्स प्राइमर के लिए ओवरलैप पीसीआर
hCD45 sgRNA 1 taatacgactcactataGGTGCTGGTGTTGGGCGCACgttttagagctagaaatagc sgRNA Fwd प्राइमर अनुक्रम के लिए ओवरलैप पीसीआर
hCD45 sgRNA २ taatacgactcactataGGGAGCAAGTGAGGATCCTCgttttagagctagaaatagc sgRNA Fwd प्राइमर अनुक्रम के लिए ओवरलैप पीसीआर
hCD45 sgRNA ३ taatacgactcactataGGGATGCTTGTTCCCTTCAGgttttagagctagaaatagc sgRNA Fwd प्राइमर अनुक्रम के लिए ओवरलैप पीसीआर
hDNMT3A Ex10 sg1 taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd प्राइमर अनुक्रम के लिए ओवरलैप पीसीआर
hDNMT3A Ex10 sg2 taatacgactcactataGGGTGGCCAGCAGCCGCGCGgttttagagctagaaatagc sgRNA Fwd प्राइमर अनुक्रम के लिए ओवरलैप पीसीआर
Rosa26 sgRNA taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd प्राइमर अनुक्रम के लिए ओवरलैप पीसीआर
GFP sg1 taatacgactcactataGGGCGAGGAGCTGTTCACCGgttttagagctagaaatagc sgRNA Fwd प्राइमर अनुक्रम के लिए ओवरलैप पीसीआर
tdTomato sg1 taatacgactcactataGGGGTACAGGCGCTCGGTGGgtttaagagctagaaatagc sgRNA Fwd प्राइमर अनुक्रम के लिए ओवरलैप पीसीआर

तालिका 1: प्रयोगों और यूनिवर्सल रेव प्राइमर में इस्तेमाल sgRNA Fwd प्राइमरों का पूरा अनुक्रम ।

Discussion

इस विस्तृत प्रोटोकॉल में वर्णित RNP दृष्टिकोण दोनों माउस और मानव प्राथमिक टेम कोशिकाओं के रूप में के रूप में अच्छी तरह से निलंबन सेल लाइनों में कुशल जीन नॉकआउट में सक्षम बनाता है । हालांकि बहुत उच्च KO क्षमता अक्सर प्राप्त कर रहे हैं, कई महत्वपूर्ण चर पर विचार करने की आवश्यकता है । सबसे पहले, उचित एक्सॉन विकल्प की गारंटी में महत्वपूर्ण है कि कुशल indel निगमन जीन नॉकआउट से मेल खाती है । दो महत्वपूर्ण एक्सॉन विकल्प से संबंधित कारकों isoforms और टेप के भीतर एक्सॉन स्थिति भर में संरक्षण कर रहे हैं । Isoform अभिव्यक्ति प्रतिमान कक्ष प्रकार में चर रहे हैं, इसलिए यदि कक्ष प्रकारों में जीन KO वांछित है, तो exons जो कक्ष प्रकारों के बीच अपरिवर्तनीय है लक्षित किया जाना चाहिए । Isoform पैटर्न क्यू पीसीआर या आरएनए-अनुक्रमण डेटा का उपयोग कर सत्यापित किया जा सकता है । टेप के भीतर एक्सॉन स्थिति के लिए, यह सबसे अच्छा है के लिए टर्मिनल या अंत एक्सॉन में frameshift उत्परिवर्तनों के रूप में जल्दी exons लक्ष्य बकवास-मध्यस्थता क्षय10से बच सकते हैं, उपंयास या अज्ञात कार्यों के बजाय सच नल के साथ प्रोटीन का निर्माण ।

indel आवृत्ति का निर्धारण करने के लिए एक महत्वपूर्ण कदम है करने के लिए दक्षता का अनुमान है और सही ढंग से प्रयोग के जैविक परिणाम की व्याख्या । Endonucleases परख (जैसे सर्वेयर परख) का लाभ है अपेक्षाकृत तेजी से और आसान प्रदर्शन किया जा रहा है । हालांकि, वे महत्वपूर्ण पृष्ठभूमि संकेतों के कारण गलत हो जाते हैं और परिणाम अक्सर पुन: पेश करने के लिए मुश्किल हैं. इसके अलावा, वे उत्पंन indels की गुणवत्ता के बारे में जानकारी प्रदान नहीं करते है (जैसे सम्मिलन और विलोपन की लंबाई) प्रयोग में । सैंज अनुक्रमण endonuclease परख करने के लिए एक मूल्यवान विकल्प प्रदान करता है । ऐसे टाइड11 (https://tide.nki.nl/) के रूप में प्लेटफार्मों को सैंज निशान विघटित और allelic व्यवधान क्षमता का सटीक अनुमान है, जबकि भी व्यक्तिगत indels की आवृत्तियों प्रदान करने में मदद करते हैं । प्रमुख दोष उच्च गुणवत्ता वाले सैंज अनुक्रमण निशान पर एक निरपेक्ष निर्भरता है । उच्च-प्रवाह amplicon अनुक्रमण इन समस्याओं से अधिकांश पर काबू पाता है । Amplicon पुस्तकालयों बहुत कम डीएनए आदानों के साथ शुरू करने के लिए तैयार किया जा सकता है और उच्च कवरेज विश्वसनीय परिणाम सुनिश्चित करता है । amplicon अनुक्रमण की लागत को कम करने के लिए, हम आम तौर पर कुल पढ़ता का केवल 1-1.5% का उपयोग कर बड़ा sequencing रन (जैसे आरएनए-अनुक्रमण) में amplicon पुस्तकालयों में स्पाइक । अंत में, सफल नॉकआउट की पुष्टि करने के लिए, हम दृढ़ता से पश्चिमी दाग या प्रवाह cytometry, जब संभव द्वारा प्रोटीन के स्तर का आकलन करने की सिफारिश ।

जैसा कि पहले वर्णित है, यहां प्रस्तुत विधि तेजी से और सीधा है और एक नया करने के लिए जीन दस्तक माउस और मानव HSPCs में अध्ययन उपकरण का प्रतिनिधित्व करता है । जबकि हमारे प्रोटोकॉल एक टिप आधारित electroporation प्रणाली के साथ जीन नॉकआउट के लिए निर्देश प्रदान करता है, अंय प्रणालियों के लिए अत्यधिक प्रभावी हो प्रदर्शन किया गया है12,13

दो प्रमुख सीमाएं RNP दृष्टिकोण के संबंध में स्वीकार करने की जरूरत है । सबसे पहले, के रूप में हमारे समूह द्वारा वर्णित है, HSPCs electroporated की व्यवहार्यता के साथ में-इन विट्रो sgRNAs काफी electroporation द्वारा समझौता किया जा सकता है, खासकर जब शर्तों इष्टतम नहीं कर रहे है6। यदि आवश्यक हो, व्यावसायिक संश्लेषित sgRNAs (यानी इन विट्रो प्रतिलेखन को नष्ट करने) इस मुद्दे को दूर कर सकते हैं । ये समय के साथ कम खर्चीले होते जा रहे है और कई विक्रेताओं से खरीदा जा सकता है । इस परिदृश्य में, इन विट्रो प्रतिलेखन में sgRNA की एक पूल प्रभावकारिता के लिए स्क्रीन उत्पंन करने के लिए इस्तेमाल किया जा सकता है, और फिर सबसे कुशल sgRNA (ओं) संश्लेषण के लिए चुना जा सकता है । RNP दृष्टिकोण की दूसरी प्रमुख सीमा को सफलतापूर्वक transfected कोशिकाओं को ट्रैक करने में असमर्थता है, के रूप में वायरल आधारित दृष्टिकोण में । हालांकि, उच्च KO दक्षता और तेजी से संपादन Cas9-sgRNA RNPs के साथ प्राप्त कई प्रयोगात्मक परिदृश्यों में इन कमियों पल्ला झुकना हो सकता है । हम वास्तव में प्रत्येक प्रयोग में व्यवधान दक्षता निर्धारित करने के लिए उच्च प्रवाह amplicon अनुक्रमण का उपयोग करने की सलाह देते हैं । यदि दस्तक-बाहर ब्याज की जीन के लिए एक प्रफलन phenotype प्रदान की उंमीद है (या तो कम या वृद्धि हुई जंगली प्रकार की कोशिकाओं की तुलना में प्रसार), एकाधिक समय अंक पर indel आवृत्ति का निर्धारण एक का आकलन करने की अनुमति देता है कि क्या कोशिकाओं समय के साथ संवर्धन (यानी indel आवृत्ति बढ़ जाती है) से गुजरना या (यानीindel आवृत्ति समय के साथ कम हो जाती है) प्रतिस्पर्धा कर रहे हैं ।

vivo में या इन विट्रो प्रयोगों में जीन समारोह के नुकसान के जैविक प्रभावों को समझने के लिए प्रदर्शन उचित नियंत्रण की आवश्यकता है । के रूप में पहले उल्लेख किया है, इन विट्रो में लिखित sgRNAs कोशिकाओं को विषाक्त हो सकता है, विशेष रूप से प्राथमिक जनक कोशिकाओं6. इसके अतिरिक्त, डीएनए डबल-कतरा Cas9 प्रोटीन की वजह से टूटता जीन स्वतंत्र विरोधी प्रफलन प्रतिक्रिया14पैदा कर सकता है । इसलिए, हम अक्सर CRISPR प्रयोगों में नियंत्रण sgRNAs के एक नंबर का उपयोग करें और अपने सेल प्रकार पर व्यक्त की एक सेल सतह मार्कर के साथ ही एक दूसरे लक्ष्य जीन है कि व्यक्त नहीं है की सिफारिश ।

साइटोकिंस की उपस्थिति में मानव HSPCs की अल्पकालिक संस्कृति जीन विघटन क्षमता को बढ़ाता है6 और उच्च दक्षता को प्राप्त करने के लिए आवश्यक है KO । हमने पाया है 36-48 घंटे संस्कृति के आदर्श अवधि के लिए पहले electroporation6। electroporation के बाद, कोशिकाओं को और अधिक ध्यान में रखते हुए कि लंबे समय तक संस्कृति multilineage engraftment क्षमता खोने का खतरा अधिक कल्चरित किया जा सकता है । इसलिए, हम आमतौर पर प्रत्यारोपण 6 घंटे electroporation के बाद और कभी नहीं बाद में 24 घंटे से electroporation के बाद प्रदर्शन करते हैं ।

CRISPR/Cas9 ने नाटकीय रूप से स्तनधारी कोशिकाओं के जीनोम को सफलतापूर्वक संपादित करने के लिए वैज्ञानिकों की क्षमता में सुधार किया है. प्राथमिक टेम जनक कोशिकाओं में जीन व्यवधान को अधिक व्यवहार्य बनाना HSPCs और hematologic रोगों के क्षेत्र में वैज्ञानिक ज्ञान को तेजी से बढ़ाने के लिए भविष्यवाणी की है । महत्वपूर्ण बात, प्रोटोकॉल यहां वर्णित यह भी एक साथ उच्च दक्षता के साथ कई नॉकआउट उत्पंन संभव बनाता है, जटिल आनुवंशिक परिदृश्य की मॉडलिंग के लिए अनुमति देता है, अक्सर ल्यूकेमिया से प्रभावित रोगों में देखा ।

हालांकि यहां वर्णित प्रोटोकॉल जीन व्यवधान पर ध्यान केंद्रित कर रहे हैं, वे आसानी से जीन दस्तक के लिए अनुकूलित किया जा सकता है प्रयोगों में । यह समरूपता के लिए एकल-असहाय oligonucleotide टेम्पलेट्स के सह-वितरण के माध्यम से पूरा किया जा सकता है-निर्देशित मरंमत6,13 (HDR) या transduction के माध्यम से कोशिकाओं के बाद AAV6 युक्त वैक्टर के साथ electroporation समरूपता टेम्पलेट12। मरंमत करने के लिए या HSPCs में विशिष्ट उत्परिवर्तनों परिचय की क्षमता जीन थेरेपी के लिए नए चिकित्सीय रणनीतियों और एएमएल और अंय hematologic रोगों में कैंसर चालक उत्परिवर्तनों का विस्तार अध्ययन की सुविधा होगी । जबकि मानव HSPCs में HDR गया है सफल6,12,13, माउस HSPCs इस रणनीति6का उपयोग कर संपादित करने के लिए मुश्किल हो गया है. मानव में HDR प्रोटोकॉल का अनुकूलन और विशेष रूप से माउस HSPCs में और अधिक विशिष्ट संपादन और उपकरणों के विकास के लिए संपादित अंतर्जात टैगिंग का उपयोग कर कोशिकाओं को ट्रैक सक्षम हो जाएगा ।

अंत में, यह भी है कि उत्परिवर्ती लाभ के विघटन-समारोह alleles जंमजात और टेम विकारों के लिए एक संभावित चिकित्सीय दृष्टिकोण का प्रतिनिधित्व कर सकता है अनुरूप है । इस परिदृश्य में, एक डीएनए मुक्त दृष्टिकोण परिवर्तन को बढ़ावा देने सकता है कि संभव एकीकरण से बचने के क्रम में सलाह दी है । इसके अलावा, "हिट और भागो" दृष्टिकोण अवांछित ऑफ लक्ष्य प्रभाव की संभावना कम कर देता है । अधिक प्रयास के लिए विशिष्ट वितरण प्रणालियों है कि घातक और गैर घातक hematologic रोगों के उपचार के लिए नए रास्ते खुल जाएगा विकसित करने के लिए की जरूरत है ।

Disclosures

हितों के टकराव का नहीं हुआ खुलासा

Acknowledgments

इस काम के कैंसर की रोकथाम और अनुसंधान टेक्सास के संस्थान (RP160283, RP140001, और R1201), कैंसर अनुसंधान के लिए है Gabrielle एंजेल फाउंडेशन, एडवर्ड पी इवांस फाउंडेशन, और NIH (DK092883, CA183252, CA125123, P50CA126752 द्वारा समर्थित किया गया था, CA193235, और DK107413) । M.C.G. छात्र वैज्ञानिकों के लिए Baylor रिसर्च एडवोकेट द्वारा समर्थित है । फ्लो cytometry आंशिक रूप से NIH द्वारा समर्थित किया गया था (राष्ट्रीय अनुसंधान संसाधन अनुदान S10RR024574, राष्ट्रीय एलर्जी और संक्रामक रोगों के संस्थान के लिए केंद्र AI036211, और राष्ट्रीय कैंसर संस्थान P30CA125123) चिकित्सा के Baylor कॉलेज के लिए Cytometry और सेल छँटाई कोर.

Materials

Name Company Catalog Number Comments
Tissue culture plates according to cell numbers
1.5 ml Eppendorf microtubes Sigma Z606340-1000EA
50ml Falcon tubes Corning 352070
Nuclease Free Water - DEPC treated ThermoFisher Scientific AM9915G
KAPA HiFi HotStart ReadyMix (2X) KAPA Biosystems KK2600
MinElute PCR purification Kit Qiagen 28004
RNAse Zap RNAse Decontamination Solution ThermoFisher Scientific AM9780
RNA Clean and Concentrator-25 Zymo R1017
HiScribe T7 High Yield RNA Synthesis Kit New England Biolabs E2040S
Alt-R S.p. Cas9 Nuclease 3NLS, 100 µg IDT 1074181
40 mm Cell Strainers VWR 352340
Dulbecco's Phosphate Buffered Saline (PBS) GenDEPOT CA008-050
Fetal Bovine Serum (FBS), Regular Corning 35010CV
AutoMACS Pro Separator or MACS manual Cell Separation columns Miltenyi
Neon Transfection System Device ThermoFisher Scientific
Neon Transfection System 10mL kit ThermoFisher Scientific MPK1025 For larger numbers of cells (see protocol) Neon Transfection System 100 mL kit (# MPK10025) can be used
Name Company Catalog Number Comments
UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific 15575020 For human experiments only
Lymphoprep Stem Cell Technologies 7851 For human experiments only
CD34 MicroBead Kit UltraPure human Miltenyi Biotec 130-100-453 For human experiments only
Stem Span SFEM II Stem Cell Technologies 9605 For human experiments only
Recombinant Human SCF Miltenyi Biotec 130-096-695 For human experiments only
Recombinant Human TPO Miltenyi Biotec 130-094-013 For human experiments only
Recombinant Human FLT3L Miltenyi Biotec 130-096-479 For human experiments only
Name Company Catalog Number Comments
Mouse dissection tools For mouse experiments only
Mortar and Pestle For mouse experiments only
Hank's Balanced Salt Solution (HBSS) Gibco 14170112 For mouse experiments only
Biotin-conjugated anti c-kit antibody eBioscience 13-1171-82 For mouse experiments only
Anti-Biotin MicroBeads Miltenyi Biotec 130-090-485 For mouse experiments only
X VIVO-15, with L-Glutamine, Genatmycin and Phenol Red Lonza 04-418Q For mouse experiments only
Mouse IL-6 Peprotech 216-16 For mouse experiments only
Mouse TPO Peprotech 315-14 For mouse experiments only
Mouse IL-3 Peprotech 213-13 For mouse experiments only
Mouse SCF Peprotech 250-03 For mouse experiments only

DOWNLOAD MATERIALS LIST

References

  1. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, 816-821 (2012).
  2. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  3. Sternberg, S. H., Doudna, J. A. Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell. 58, 568-574 (2015).
  4. Heckl, D., et al. Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 32, 941-946 (2014).
  5. Mandal, P. K., et al. Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell stem cell. 15, 643-652 (2014).
  6. Gundry, M. C., et al. Highly Efficient Genome Editing of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. Cell Rep. 17, 1453-1461 (2016).
  7. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24, 1012-1019 (2014).
  8. Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature methods. 12, 982-988 (2015).
  9. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Current protocols in immunology. 111, A3 B 1-3 (2015).
  10. Lykke-Andersen, S., Jensen, T. H. Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol. 16, 665-677 (2015).
  11. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 42, e168 (2014).
  12. Dever, D. P., et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells. Nature. 539, 384-389 (2016).
  13. DeWitt, M. A., et al. Selection-free genome editing of the sickle mutation in human adult hematopoietic stem/progenitor cells. Sci Transl Med. 8, 360ra134 (2016).
  14. Aguirre, A. J., et al. Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting. Cancer Discov. 6, 914-929 (2016).
Murine और मानव टेम जनक कोशिकाओं के अत्यधिक कुशल जीन व्यवधान CRISPR द्वारा Cas9/
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).More

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter