Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Rottura del Gene altamente efficiente di cellule progenitrici ematopoietiche Murine ed umane di CRISPR/Cas9

doi: 10.3791/57278 Published: April 10, 2018
* These authors contributed equally

Summary

Un protocollo per la veloce rottura CRISPR/Cas9-mediata del gene nel topo ed emopoietici umani primari è descritto in questo articolo. Cas9-sgRNA ribonucleoproteine vengono introdotti tramite elettroporazione con sgRNAs generato tramite trascrizione in vitro e commerciale Cas9. Alta efficienza di editing si ottiene con tempo limitato e costi finanziari.

Abstract

Progressi nel campo delle cellule staminali ematopoietiche (HSCs) sono stato favoriti da metodi di ingegnere geneticamente cellule progenitrici primario così come modelli animali. Gene completa ablazione in HSCs necessaria la generazione di topi knockout da cui HSCs potrebbe essere isolato e ablazione genica nelle HSC umane primarie non era possibile. Trasduzione virale potrebbe essere utilizzato per approcci knock-down, ma questi soffriva di efficacia variabile. In generale, genetica manipolazione dell'essere umano e cellule ematopoietiche del mouse è state ostacolate da minor efficienza e tempo esteso e impegni di costo. Recentemente, CRISPR/Cas9 ha ampliato notevolmente la capacità di progettare il DNA delle cellule di mammiferi. Tuttavia, l'applicazione di CRISPR/Cas9 a cellule ematopoietiche è stato impegnativo, principalmente a causa della loro efficienza di trasfezione basso, la tossicità di approcci basati su plasmide e il tempo di risposta lento di protocolli basati su virus.

In questo articolo viene fornito un metodo rapido per eseguire CRISPR/Cas9-mediata del gene editing in cellule progenitrici e staminali ematopoietiche murine ed umane celle con efficienze di knockout fino al 90%. Questo approccio utilizza una strategia di consegna della ribonucleoproteina (RNP) con un flusso di lavoro ottimizzato di tre giorni. L'uso di Cas9-sgRNA RNP consente un approccio mordi e fuggi, non introducendo nessun sequenze di DNA esogene nel genoma di celle modificate e riducendo gli effetti fuori bersaglio. Il metodo basato su RNP è veloce e semplice: non richiede la clonazione di sgRNAs, preparazione di virus o modificazione chimica sgRNA specifici. Con questo protocollo, gli scienziati dovrebbero essere in grado di generare correttamente Ko di un gene di interesse in cellule ematopoietiche primarie entro una settimana, compresi i tempi di fermo per la sintesi del oligonucleotide. Questo approccio permetterà un gruppo molto più ampio di utenti di adattare questo protocollo per le loro esigenze.

Introduction

L'avvento di CRISPR/Cas9 ha radicalmente semplificato gene editing in cellule di mammifero. Primi CRISPR/Cas9 protocolli utilizzati plasmide o virus-ha basato la consegna di Cas9 proteina e sgRNA1,2,3. Questi approcci si è rivelata rivoluzionari per lo sviluppo di modelli cellulari e animali e sono stati applicati con successo anche al primario ematopoietiche staminali e progenitrici cellule (HSPCs)4,5. Tuttavia, questi metodi hanno una serie di svantaggi. In primo luogo, l'efficienza di rottura del gene rimane spesso di sotto 50%4,5. Mentre questo è sufficiente per la generazione di cloni di knockout (KO) in linee cellulari, la necessità per la coltura di breve durata rende HSPCs non destinabili a tale strategia. In secondo luogo, il requisito per la clonazione limita la quantità di sgRNAs che possono essere testati in singoli esperimenti e genera grandi, difficili a transfect costrutti. In terzo luogo, questi approcci forzare gli scienziati a rallentare i tempi di consegna.

Per superare queste limitazioni, il nostro gruppo ha sviluppato e pubblicato di recente un approccio alternativo di CRISPR/Cas9 in HSPCs utilizzando Cas9-sgRNA ribonucleoproteine (RNP)-base di consegna6. In questa strategia, i componenti grezzi di CRISPR (Cas9 proteina e in vitro trascritto sgRNA) pre-complessati che viene consegnato direttamente in cellule bersaglio tramite elettroporazione (Figura 1). Come l'emivita del complesso Cas9-sgRNA RNP è inferiore al tempo che plasmide o dell'acido nucleico virale è trascritto, il tasso di fuori bersaglio è inferiore rispetto ai primi approcci7. Inoltre, l'approccio di RNP aggiunge il vantaggio di eliminare qualsiasi fonte di DNA esogeno, che casualmente può integrare nel genoma della cellula bersaglio che conduce alla trasformazione cellulare.

Questo protocollo è basato su un flusso di lavoro ottimizzato per gli esperimenti di rottura del gene RNP-basato, come rappresentato nella Figura 1. Il primo passo è progettare e ordinare i primers per ogni sgRNA. Questi iniettori sono utilizzati per fare modelli di DNA sgRNA che vengono utilizzati per trascrizione in vitro (IVT) per ottenere il sgRNAs. SgRNAs purificata sono poi incubate con proteina Cas9 acquistata in precedenza, per formare Cas9-sgRNA RNP. Infine, pre-complessati Cas9-sgRNA RNP sono individulamente nelle cellule. A seguito di elettroporazione, editing efficiente può essere testato e in vitro/in vivo esperimenti possono essere avviati, a seconda delle esigenze. Qui di seguito una descrizione dettagliata di questo innovativo approccio sperimentale può essere trovata.

Protocol

Il protocollo segue le linee guida del Comitato di etica umana del Baylor College of Medicine. Tutte le procedure sperimentali effettuate sui topi sono approvate dal comitato di uso e Baylor College di medicina istituzionali cura degli animali.

1. sgRNA Fwd Design

  1. Navigare a http://www.crisprscan.org/?page=track8 per iniziare a progettare sgRNAs di interesse.
  2. Fare clic sul pulsante "Umano" a seconda del tipo di cella di interesse o "Mouse".
  3. Inserire il gene di interesse nella casella di ricerca UCSC e premere go.
  4. Ingrandire e spostare la regione del gene (cioè. un esone specifico) che è di interesse per destinazione.
    Nota: Per raggiungere la rottura del gene efficiente che è consigliabile il più in anticipo exon(s) presente in tutte le isoforme trascritte nel tuo tipo specifico delle cellule di targeting.
  5. Garantire che le potenziali sequenze bersaglio sgRNA sono elencate in una "CRISPRscan previsioni sui geni (CD)" voce.
  6. Individuare e fare clic su una sequenza di destinazione con un punteggio relativamente alto e qualche off-target (evidenziato in verde brillante). Copiare la sequenza visualizzata sotto la sezione "Oligo sequenza" e incollarlo in un documento di testo. Aggiungi "ATAGC" all'estremità 3' della sequenza. Una volta completato, è possibile effettuare l'ordine per la sequenza di Full-Length.
    Nota: Per ogni sequenza di destinazione, CRISPRscan8 fornisce un primer sgRNA avanti "integrato" che comprende il promotore T7, la sequenza protospacer (destinazione) e la sequenza di sovrapposizione dell'impalcatura universale (Vedi Figura 1A). Una figura intera sequenza è costituita da nucleotidi o 56 o 57 a seconda della lunghezza del protospacer.

2. sgRNA sintesi modello del DNA

  1. Sciogliere e diluire il sgRNA Fwd e primer universale Rev (Vedi tabella 1 per la sequenza completa). Al fine di ottenere una concentrazione finale di 10 µM, seguire le istruzioni del produttore su come diluire gli iniettori a 100 µM, quindi fare un 01:10 diluizione con acqua priva di nucleasi.
  2. Per eseguire la sovrapposizione PCR mix (Vedi Figura 1B), seguito in provette per PCR striscia: 2 µ l sgRNA Forward primer (10 µM), primer di 2 µ l universale Rev impalcatura (HPLC purificato) (10 µM), 10 µ l ad alta fedeltà della polimerasi del DNA master mix (2x) e acqua priva di nucleasi 6 µ l.
  3. Eseguire la PCR con il seguente programma: 95 ° C per 3 min, 98 ° C per 5 s, 60 ° C per 5 s, 72 ° C per 10 s, vai a 2 per 6 cicli, 72 ° C per 1 min, 4 ° C per sempre.
  4. Purificare il prodotto PCR utilizzando colonne di purificazione del DNA (vedere tabella materiali). Seguire le istruzioni del produttore ed eluire con 11,5 µ l di tampone di eluizione.
  5. Misurare la concentrazione dei prodotti di PCR su uno spettrofotometro. Vuoto dello strumento con tampone di eluizione.
    Nota: La concentrazione di DNA dovrebbe essere tra 50 ~ e ~ 120 ng / µ l.

3. trascrizione in Vitro di sgRNA

  1. Miscelare i componenti seguenti in tubi in striscia PCR (reagenti sono forniti nel kit di sintesi di RNA): 4 µ l di DNA eluito, 4 µ l di dNTPs, 1 µ l di tampone di reazione 10x e 1 µ l di miscela di T7 RNA polimerasi enzima.
  2. Incubare i campioni a 37 ° C per almeno 4 ore.
  3. Applicare il detergente RNasi per rimuovere RNasi da mani inguantate.
  4. Portare ogni campione di RNA fino ad un volume totale di 50 µ l con acqua priva di nucleasi (prima fase della Purificazione RNA seguendo le istruzioni del produttore).
  5. Procedere con la purificazione di RNA seguendo le istruzioni del produttore ed eluire in 50 µ l di acqua priva di nucleasi fornito dal kit.
  6. Misurare la concentrazione della sgRNA eluito su uno spettrofotometro. Spegnete lo strumento con acqua priva di nucleasi.
    Nota: Il rendimento atteso dopo la purificazione è 50-80 µ g di RNA (cioè la concentrazione di 1,0-1,5 µ g / µ l).
  7. Utilizzare il sgRNA purificata immediatamente o conservare in aliquote di 2-4 µ l a-80 ° C per il lungo termine.

4. HSPC isolamento e coltura

  1. Cultura e murino HSPCs isolamento
    Nota: Topi di Ubc-GFP maschii e femminili (JAX004353) e Rosa26-LSL-tdTomato (JAX007914) attraversato con Vav-iCre (JAX008610) a 2-6 mesi di età sono stati utilizzati per ottenere i risultati mostrati sotto.
    1. Eutanasia topi anestetizzati con dislocazione cervicale.
      Nota: Due persone addestrate dovrebbero verificare in modo indipendente l'eutanasia successo notando la mancanza di respirazione e battito cardiaco per almeno 5 min, togliere la pelle dagli animali.
    2. Sezionare le tibie, femori e creste iliache di topi e rimuovere tutti i muscoli e tessuto connettivo intorno le ossa dissecate. Inserire una piastra di coltura del tessuto sul ghiaccio ossa intatte con HBSS completata con 2% FBS (HBSS +). Spostare una cappa a flusso laminare più presto alle ossa sono state pulite e trasferite alla piastra di coltura del tessuto.
    3. Trasferimento pulito bones a mortaio sterile, contenenti 2 mL HBSS ghiacciata + al 3 ossa. Usando il pestello, schiacciare le ossa in frammenti di ossa, rilasciando del midollo all'interno. Continuare la frangitura fino alla fermata di ossa fessurazione sotto il pestello.
    4. Raccogliere il surnatante dal mortaio e filtrare in una provetta conica da 50 mL utilizzando un colino di cella di 40 µm. Sciacquare i rimanenti frammenti ossei con 5 mL ghiacciata HBSS + e filtro nella stesso provetta conica 50 mL utilizzando il colino stesso 40 µm.
    5. Lavare le cellule due volte di rabbocco il tubo con HBSS + ghiacciata e centrifugazione a 400 x g per 7 min. scartare il surnatante.
    6. Dopo il secondo lavaggio risospendere il pellet cellulare in 20 mL di PBS freddo ghiaccio. Di esclusione del trypan blu9, conteggio cellule vitali.
    7. Incubare 1 x 108 cellule vitali per 1 mL HBSS + ghiacciata con anticorpo di c-kit biotina-coniugato a una diluizione 1: 100 per 45 min sul ghiaccio.
    8. Lavare le cellule con HBSS + ghiacciata di centrifugazione a 400 x g per 7 min e scartare il surnatante.
    9. Incubare le cellule con i branelli magnetici anti-biotina, seguendo le istruzioni del produttore.
    10. Isolare le cellule c-kit positive utilizzando colonne magnetiche o sorter magnetici-attivato delle cellule seguendo le istruzioni del produttore. Raccogliere le cellule c-kit positive in provette coniche da 15 mL.
    11. Lavare le cellule due volte con PBS di rabbocco la provetta conica da 15 mL e centrifugazione a 400 x g per 7 min. scartare il surnatante. Tra i due lavaggi per calcolare il numero totale di cellule vitali di esclusione del blu di trypan9.
    12. Risospendere c-kit + cellule ad una concentrazione di fino a 106 viablecells a 100 µ l di terreno di coltura per HSPCs murino completati con 2% FBS, fattore di 50 ng/mL del mouse cellule staminali (SCF), 50 ng/mL del mouse trombopoietina (TPO), mouse di 10 ng/mL IL-3 e 10 ng/mL mouse IL-6.
    13. Incubare le cellule a 37 ° C, 5% CO2 per almeno 1 h ad un massimo di 24 h prima dell'elettroporazione.
  2. Cultura e isolamento di HSPCs umano
    Nota: Questi passaggi devono essere eseguiti in una cappa a flusso laminare.
    1. Filtrare i globuli di midollo osseo/cavo attraverso un colino di cella di 40 µm.
    2. Rapporto di diluizione 1:2 le cellule del sangue filtrato del midollo osseo/cavo con PBS completati con 1 mM EDTA (PBS/EDTA).
    3. Pipettare 15 mL di terreno di gradienti di densità in una provetta conica da 50 mL. Delicatamente versare 30 mL di sangue del midollo osseo/cordone diluito sulla superficie di medio gradiente di densità. Se il volume della sospensione cellulare è maggiore di 30 mL preparare tubi multipli.
      Nota: Assicurarsi di mantenere l'interfaccia tra il sangue ed il mezzo di gradienti di densità tagliente come possibile.
    4. Girare i tubi a 750 x g per 30 min con nessun rallentamento.
    5. Raccogliere lo strato di cellule mononucleari rilevabile all'interfaccia e il trasferimento di medie in una provetta conica pulito 50 mL. Riempire la provetta con EDTA/PBS e girare le cellule a 280 g per 15 min. scartare il surnatante.
    6. Lavare le cellule due volte in PBS/EDTA spinning a 400 x g per 7 min e scartare il surnatante.
    7. Incubare le cellule mononucleari con i branelli magnetici anti-CD34, seguendo le istruzioni del produttore.
    8. Isolare le cellule CD34 + usando colonne magnetiche o sorter magnetici-attivato delle cellule seguendo le istruzioni del produttore. Raccogliere le cellule CD34 + in provette coniche da 15 mL.
    9. Lavare raccolte cellule CD34 + due volte da rabbocco il tubo con PBS e filatura a 400 x g per 7 min e scartare il surnatante. Tra i due lavaggi per calcolare il numero totale di cellule vitali di esclusione del blu di trypan9.
    10. Risospendere le cellule in cultura supplementato con 100 ng/mL umano SCF, ligando di 100 ng/mL umano FLT3 (FLT3L), 100 ng/mL TPO umana ad una concentrazione di cellule vitali di5 ~2.5 x 10 / ml. cultura isolato cellule CD34 + a 37 ° C, 5% CO2 per 24 h per un massimo 48 h prima per elettroporazione.
      Nota: Prima elettroporazione Verifica purezza della popolazione CD34 + arricchita da citometria a flusso.

5. elettroporazione

Nota: Il seguente protocollo è ottimizzato per le punte di elettroporazione 10 µ l. Ogni procedura deve essere eseguita in una cappa a flusso laminare.

  1. Contare le celle di trypan blu esclusione9. Raccogliere 2 x 105 cellule vitali per replica (es. raccogliere 6 x 105 celle per 3 elettroporazioni).
  2. Le cellule lavare due volte con PBS, filatura a 300 x g per 7 min e attentamente rimuovere il surnatante.
  3. In parallelo, è possibile preparare complessi Cas9-sgRNA RNP incubando in provette per PCR per 20-30 min a RT 1,5 µ g Cas9 con 1 µ g di sgRNA totale per ogni replica, tranne l'unico controllo Cas9.
    Nota: Cas9 proteina viene fornita alla concentrazione di 10 µ g / µ l. Per garantire il pipettaggio accurata, diluire 01:10 la quantità totale di proteine Cas9 necessarie con acqua priva di nucleasi (ad es. per 10 elettroporazioni prendere 1 µ l di proteina Cas9 e diluirlo con 9 µ l di acqua priva di nucleasi e incubare 1 µ l di Cas9 diluito per replica. A seconda della concentrazione della sgRNA, il volume totale di Cas9 e sgRNA dovrebbe essere compreso tra 1,7 e 2 µ l per replica. Se utilizzando due sgRNAs Incubare 500 ng di ogni sgRNA per replica; Se utilizza 3 sgRNAs Incubare 330 ng di ogni sgRNA per replicare e così via.
  4. Calcolare il volume totale di risospensione Buffer T necessario moltiplicando 10 µ l per il numero totale di replica necessari (ad es. 30 µ l per 3 replicati). Risospendere le cellule pellettate con il volume calcolato di Buffer T. garantire che la concentrazione finale della sospensione delle cellule è di 2 x 107 cellule/mL.
  5. Aliquotare e 10 µ l di sedimento cellule/replicare in ciascuna provetta PCR contenente i pre-complessati sgRNA/Cas9 RNP (ad es. per un triplice copia aliquota 30 μL della sospensione di cellule in una provetta PCR contenente pre-complessati Cas9-sgRNA).
  6. Per impostare il sistema di elettroporazione accendere lo strumento e aggiungere 3 mL di tampone E in una cuvetta di elettroporazione e far scorrere la cuvetta nel supporto per cuvette.
  7. Impostare le condizioni di elettroporazione desiderata sul dispositivo: HSPCs umano (1600 V, 10 ms, 3 impulsi) o del mouse HSPCs (1700 V, 20 ms, 1 impulso).
    Nota: Se lo si desidera, prima di eseguire esperimenti su cellule CD34 + HSPCs, sgRNA efficienza può essere testato su linee cellulari di leucemia mieloide acuta (AML) (ad es. HL60) utilizzando la stessa strategia (uso medio privo di antibiotico per linee cellulari AML) con le seguenti condizioni di elettroporazione: Buffer R, 1350, V. 35 ms, 1 impulso.
  8. L'elettroporazione è eseguita con una pipetta di elettroporazione speciale, che ha un artiglio che aggancia la punta della pipetta di elettroporazione. Tenere la pipetta di elettroporazione, estendere l'artiglio, afferrare il disco dentro la punta della pipetta e poi premere con forza la pipetta per fissare la punta.
  9. Dispensare il campione su e giù per 10 volte per mescolare. Prendere 10 µ l, assicurandosi che non ci sono nessun bolle e inserire la punta della pipetta direttamente nel buffer elettrolitico in cuvetta elettroporazione. Cercate di non toccare le pareti della provetta. Sullo schermo, premere "start". Dopo appare il messaggio "completo", rimuovere la pipetta e versare il contenuto in pozzetto con nuovo terreno di coltura HSPC.
  10. Ripetere per tutti i campioni. Cambiamento per puntali tra campioni, solo se necessario.

Representative Results

L'obiettivo del presente protocollo è quello di eseguire knockout (KO) di gene in mouse e HSPCs umano utilizzando Cas9-sgRNA RNP. Il flusso di lavoro è facile e veloce e consente per il completamento degli esperimenti in meno di una settimana dal disegno sperimentale per la valutazione dell'efficienza di KO.

Rispetto ad approcci basati su plasmide o virus, il successo del nostro protocollo si basa la combinazione di sgRNA RNP e l'elettroporazione. Questa strategia di clonazione-free riduce significativamente il tempo necessario per ottenere i componenti per transfect. Inoltre, permette di elettroporazione per la transfezione di fino a 95% delle cellule, massimizzando la consegna della RNP. sgRNAs può essere sintetizzato in laboratorio tramite trascrizione in vitro (IVT), mentre la proteina purificata Cas9 possa essere acquistata da diverse aziende ( Vedi protocollo). modelli del DNA sgRNA per IVT sono ottenuti eseguendo un breve PCR utilizzando il sgRNA primer Fwd (Figura 1A, B) e l'universale dell'impalcatura Rev primer (Figura 1B - Vedi protocollo). Il prodotto PCR viene quindi utilizzato come modello per il IVT (Figura 1). Complessi di Cas9-sgRNA RNP vengono generati in incubazione per 15-30 minuti il sgRNAs e il Cas9 (Figura 1). Infine, sgRNA RNP sono individulamente nelle cellule. HSPCs modificato consente poi di eseguire esperimenti sia in vitro che in vivo .

Rottura del gene in cellule di topo

Per dimostrare l'efficacia della strategia di elettroporazione Cas9-sgRNA RNP, c-kit + HSPCs isolate da topi ubiquistmente che esprimono GFP o tdTomato sono state elettroporate con sgRNA contro GFP o tdTomato. Tra i tre sgRNA progettato contro GFP, GFP sg1 eseguita in modo più efficiente, che esibiscono circa 70-75% di rottura di espressione di GFP come determinato mediante citometria a flusso (Figura 2A, B). Per quantificare la frequenza di rottura del gene a livello genomico, genomico DNA dalle cellule elettroporate è stato isolato e T7 endonucleasi io-base (T7EI) analisi è stata eseguita. Come illustrato nella Figura 2, T7EI analisi ha rilevato fino alla formazione di indel 60%. Si noti che T7EI saggi tendono a sottovalutare le frequenze di indels. Abbiamo anche generato sgRNA contro HSPCs tdTomato e individulamente esprimendo tdTomato dal locus Rosa26. Come illustrato nella Figura 2D, tdTomato sg1 ablazione efficientemente l'espressione di tdTomato.

Rottura del gene in cellule umane

Qui è mostrata efficiente rottura ottenuta con un approccio unico sgRNA CD45, un indicatore della superficie delle cellule espresso sulle cellule ematopoietiche, il targeting. Tre sgRNAs diversi esoni di CD45 di targeting sono stati progettati (CD45 sg1, sg2 e sg3). L'efficienza del sgRNAs è stato testato nella linea cellulare HL60 AML (Figura 3A). Proteina KO è stata valutata da citometria a flusso a 5 giorni dopo l'elettroporazione. CD45 sg1 era la più efficiente (98% KO efficienza - Figura 3A) ed è stato utilizzato per ulteriori esperimenti. Figura 3B Mostra CD45 KO in primaria umane cellule progenitrici CD34 + utilizzando CD45 sg1, valutate da citometria a flusso 5 giorni dopo l'elettroporazione. Mentre l'espressione CD34 era inalterata, espressione di CD45 è stato perso in circa l'80% delle cellule. 200,000 primario CD34 + celle modificate retrò-orbitally sono state trapiantate in topi NSG 6 ore dopo l'elettroporazione. Midollo osseo e cellule della milza sono state raccolte 3 mesi dopo trapianto. Celle modificate (HLA-ABC positiva, negativa CD45, evidenziato in rosso) sono rilevabili solo in campioni di sgRNA trattata e non in Cas9 solo i controlli (Figura 3).

Se lo si desidera, due sgRNAs targeting è vicino a sequenze può essere utilizzato per generare le eliminazioni. Questo approccio consente una stima veloce di efficienza di editing con un PCR e spesso produce una maggiore efficienza di rottura. Figura 3D Mostra la generazione efficiente di un'omissione di bp 58 in essone 10 di DNMT3A. 200,000 modificate cellule CD34 + sono state trapiantate in topi NSG a 6 ore dopo l'elettroporazione. L'eliminazione di bp 58 chiaramente è stato rilevato nell'anima periferica dei topi NSG engrafted 5 mesi dopo le iniezioni (Figura 3E) confermando l'editing delle cellule CD34 + con possibilità di attecchimento a lungo termine.

Figure 1
Figura 1: l'approccio semplice e veloce per generare sgRNA RNP. A) rappresentazione di sgRNA primer Fwd. SgRNA primer Fwd è un oligonucleotide di DNA contenente il promotore T7, la sequenza protospacer e una sequenza di sovrapposizione con il ponteggio sgRNA. Al 3' estremità, evidenziato in rosso, è la sequenza "ATAGC" che deve essere aggiunto alla sequenza del primer Fwd sgRNA ottenuta su CRISPRscan. B) rappresentazione schematica della sovrapposizione PCR effettuata per ottenere il modello IVT. La sovrapposizione tra il primer Fwd sgRNA e il primer universale patibolo Rev consente l'estensione e l'amplificazione di PCR. C) fumetto che descrive la reazione di IVT e il sgRNA RNP pre-complessanti. Il prodotto PCR è purificato e utilizzato come modello per il IVT. IVT genera una quantità elevata di sgRNAs che può essere utilizzato in più repliche (Vedi protocollo). sgRNA RNP vengono generati incubando il sgRNA purificata da IVT e la proteina Cas9 acquistata in precedenza. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: rottura del gene efficiente in cellule progenitrici ematopoietiche del topo. A) un sgRNA targeting GFP (GFP sg1) insieme a Cas9 proteina era individulamente in murino c-kit + HSPCs che esprimono GFP e analizzati tramite flusso cytometry 24 ore dopo l'elettroporazione. B) diverse quantità di GFP sg1 era complessato con 1 µ g di proteina Cas9 e individulamente. Appena 200 ng di GFP sg1 ha rimosso in modo efficiente espressione di GFP. C) T7EI analisi eseguita su DNA genomico isolato dalle cellule usate in A-B. PCR amplicone che attraversa il sito di clivaggio Cas9-sgRNA è stato diluito 1:4 in 1 x Buffer 2 e ibridati lentamente in un termociclatore. Ibridati frammenti erano poi digeriti con 1,25 U di T7 endonucleasi che per 10 minuti a 37 ° C. Frammenti digeriti sono stati separati mediante elettroforesi su gel di poliacrilammide. Intensità di banda sono stati analizzati utilizzando il software ImageJ riportando sull'intensità di banda di ogni corsia. clivaggio % è stato calcolato dal rapporto tra le intensità delle bande fendute a bande ApoAlert. D) c-kit + HSPCs isolate da topi che esprimono tdTomato era elettroporate con Cas9 proteina complessata con sgRNA contro tdTomato. Citometria a flusso effettuato 24 ore dopo l'elettroporazione ha rivelato che circa il 74% delle cellule eliminato tdTomato. R26 = Rosa26. * p < 0,05, * * p < 0.01, * * * p < 0,001. Questa figura è stata adattata da Gundry et al. 6 Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: rottura del gene efficiente in cellule ematopoietiche umane. A) tre sgRNAs targeting CD45 (CD45 sg1, sg2 e sg3) sono stati progettati e testati nella linea cellulare HL60 AML (Vedi il protocollo per l'elettroporazione condizioni). Citometria a flusso è stata effettuata 5 giorni dopo l'elettroporazione. Sg1 CD45 è stato selezionato come il più efficiente tra i tre sgRNAs (KO efficienza 98%). B) CD45 KO in essere umano primario cavo sangue CD34 + HSPCs utilizzando CD45 sg1. CD45 perdita può essere rilevata in circa l'80% delle cellule. Si noti che l'espressione di CD34 è invariata dopo la modifica. C) HSPCs umano Edited può essere efficientemente engrafted nei topi NSG. Cellule nucleate umane visualizzano l'HLA normale + CD45 + fenotipo in sola Cas9 engrafted topi, mentre nei topi innestati con CD45-sg1 trattati cellule CD34 +, entrambi HLA + CD45 + e HLA + / CD45-popolazioni si osservano che indica engraftment delle cellule umane di CD45 KO. D) gel di agarosio 2% che mostra un'omissione di bp 58 generato da 2 sgRNAs (approccio dual guida) in essone 10 di DNMT3A in HSPCs umano cordonali 3 differenti (CB1, CB2 e CB3). PCR è stata effettuata 3 giorni dopo l'elettroporazione. E) gel di agarosio 2% dimostrando la persistenza dell'eliminazione bp 58 5 mesi dopo il trapianto in topi NSG. Questa figura è stata adattata da Gundry et al. 6 Clicca qui per visualizzare una versione più grande di questa figura.

Oligonucleotide Sequenza Nota
Primer universale Rev impalcatura gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct Primer universale inversa per sovrapposizione PCR
hCD45 sgRNA 1 taatacgactcactataGGTGCTGGTGTTGGGCGCACgttttagagctagaaatagc sgRNA sequenza primer Fwd per sovrapposizione PCR
hCD45 sgRNA 2 taatacgactcactataGGGAGCAAGTGAGGATCCTCgttttagagctagaaatagc sgRNA sequenza primer Fwd per sovrapposizione PCR
hCD45 sgRNA 3 taatacgactcactataGGGATGCTTGTTCCCTTCAGgttttagagctagaaatagc sgRNA sequenza primer Fwd per sovrapposizione PCR
hDNMT3A Ex10 sg1 taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA sequenza primer Fwd per sovrapposizione PCR
hDNMT3A Ex10 sg2 taatacgactcactataGGGTGGCCAGCAGCCGCGCGgttttagagctagaaatagc sgRNA sequenza primer Fwd per sovrapposizione PCR
Rosa26 sgRNA taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA sequenza primer Fwd per sovrapposizione PCR
GFP sg1 taatacgactcactataGGGCGAGGAGCTGTTCACCGgttttagagctagaaatagc sgRNA sequenza primer Fwd per sovrapposizione PCR
tdTomato sg1 taatacgactcactataGGGGTACAGGCGCTCGGTGGgtttaagagctagaaatagc sgRNA sequenza primer Fwd per sovrapposizione PCR

Tabella 1: Completare sequenze dei primer Fwd sgRNA usati in esperimenti e primer universale Rev.

Discussion

L'approccio di RNP descritto in questo protocollo dettagliato consente ad eliminazione diretta efficiente gene in cellule ematopoietiche primarie umane così come in linee cellulari di sospensione sia il mouse. Anche se spesso si ottengono rendimenti molto elevati di KO, diverse variabili critiche devono essere considerati. In primo luogo, scelta corretta dell'essone è chiave nel garantire che indel efficiente incorporazione corrisponde a knockout del gene. Due fattori importanti legate alla scelta di essone sono conservazione attraverso isoforme e nell'esone posizione all'interno di trascrizioni. Modelli di espressione di isoforme sono variabili attraverso tipi di cellule, così se è desiderato il gene KO attraverso tipi di cellule, esoni che sono invarianti tra cella tipi dovrebbero essere mirati. Modelli di isoforma possono essere verificate utilizzando q-PCR o dati di sequenziamento di RNA. Per posizione di essone all'interno di trascrizioni, è preferibile di esoni precoce di destinazione come mutazioni frameshift nel terminale o penultima essone potrebbe fuoriuscire deperimento assurdità-mediato10, producendo proteine con romanzo o funzioni sconosciute, piuttosto che di veri valori null.

Determinare la indel frequenza è un passo fondamentale per valutare l'efficienza di KO e interpretare correttamente il risultato biologico dell'esperimento. Saggi di endonucleasi (ad es. analisi di surveyor) hanno il vantaggio di essere relativamente veloce e facile da eseguire. Tuttavia, essi tendono ad essere imprecisa a causa di segnali di fondo significativa e risultati sono spesso difficili da riprodurre. Inoltre, non forniscono informazioni sulla qualità del indels generato (ad es. lunghezza di inserimenti ed eliminazioni) nell'esperimento. Sanger sequenziamento fornisce una valida alternativa al endonucleasi saggi. Piattaforme come marea11 (https://tide.nki.nl/) aiutano a scomporre le tracce sanger e produrre stime accurate di efficienza rottura allelica, fornendo anche le frequenze dei singoli indels. Il principale svantaggio è una dipendenza assoluta sulle tracce di sequenziamento Sanger alta qualità. Sequenziamento degli ampliconi di alto-rendimento supera la maggior parte di questi problemi. Amplicon librerie possono essere preparate a partire con gli ingressi di DNA molto bassi e l'alta copertura assicura risultati affidabili. Per ridurre il costo del sequenziamento degli ampliconi, abbiamo solitamente spike in librerie amplicone nei funzionamenti di sequenziamento più grandi (per esempio RNA-sequenziamento) utilizzando solo l'1-1,5% del totale si legge. Infine, per confermare il successo ad eliminazione diretta, si fortemente consiglia di valutare i livelli della proteina dalle macchie occidentali o flusso cytometry, quando possibile.

Come descritto in precedenza, il metodo presentato qui è veloce e semplice e rappresenta un nuovo strumento per studiare il gene knock out in mouse e HSPCs umano. Mentre il nostro protocollo fornisce istruzioni per knockout del gene con un sistema basato su suggerimento di elettroporazione, altri sistemi sono stati dimostrati per essere altamente efficace12,13.

Due limitazioni principali devono essere riconosciuti per quanto riguarda l'approccio di RNP. In primo luogo, come descritto dal nostro gruppo, la redditività delle HSPCs elettroporate con in vitro trascritto sgRNAs può essere significativamente compromessa dall'elettroporazione, soprattutto quando le condizioni non sono ottimali6. Se necessario, sgRNAs commercialmente sintetizzato (cioè eliminando in vitro trascrizione) può superare questo problema. Questi stanno diventando sempre meno costosi con il tempo e possono essere acquistati da diversi fornitori. In questo scenario, trascrizione in vitro poteva essere utilizzati per generare un pool di sgRNA alla schermata per efficacia, e quindi il sgRNA(s) più efficiente può essere selezionato per la sintesi. La seconda limitazione principale dell'approccio RNP è l'incapacità di tenere traccia di cellule trasfettate con successo, come in approcci basati su virale. Tuttavia, l'elevata efficienza di KO e modifica rapida ottenuta con Cas9-sgRNA RNP possono superare questi inconvenienti in molti scenari sperimentali. Si consiglia di utilizzare il sequenziamento degli ampliconi di alto-rendimento per determinare esattamente l'efficienza di rottura in ogni esperimento. Se il knock-out del gene di interesse è previsto a conferire un fenotipo proliferativo (ossia, diminuita o aumentata proliferazione rispetto alle cellule wild-type), determinare la frequenza di indel a più punti di tempo permette di valutare se KO cellule sottoporsi ad arricchimento (cioè indel frequenza aumenta nel tempo) o sono outcompeted (cioè. indel frequenza diminuisce nel corso del tempo).

Esperimenti in vivo o in vitro per comprendere gli effetti biologici della perdita di funzione del gene richiede i controlli appropriati. Come precedentemente accennato, in vitro trascritto sgRNAs può essere tossico per le cellule, cellule progenitrici soprattutto primaria6. Inoltre, rotture a doppio filamento del DNA causate dalla proteina Cas9 possono causare gene indipendente risposta antiproliferativa14. Di conseguenza, abbiamo spesso utilizzare un numero di controllo sgRNAs in CRISPR esperimenti e consiglia un indicatore della superficie delle cellule espresso sul tuo tipo di cellulare, nonché un secondo gene di destinazione che non è espresso.

Coltura di breve durata di umana HSPCs in presenza di citochine aumenta il gene interruzione efficienza6 e necessario raggiungere KO ad alta efficienza. Abbiamo trovato 36-48 ore per essere il periodo ideale di coltura prima dell'elettroporazione6. A seguito di elettroporazione, le cellule possono essere ulteriormente coltivate tenendo presente che più lunga è la cultura più alto il rischio di perdere la capacità di attecchimento multilineare. Di conseguenza, di solito eseguire trapianti 6 ore dopo l'elettroporazione e mai oltre 24 ore dopo l'elettroporazione.

CRISPR/Cas9 ha migliorato notevolmente la capacità degli scienziati di modificare correttamente il genoma delle cellule di mammiferi. Rendendo più fattibile rottura del gene in cellule progenitrici ematopoietiche primario è preveduta per migliorare rapidamente le conoscenze scientifiche nel campo della HSPCs e malattie ematologiche. D'importanza, il protocollo descritto qui rende anche possibile generare contemporaneamente più forature con alta efficienza, che consente la modellazione di paesaggi genetici complessi, spesso visto nelle malattie leucemiche.

Anche se i protocolli descritti nel presente documento sono focalizzati sulla rottura del gene, possono essere facilmente adattati per gli esperimenti del gene knock-in. Questo può essere realizzato attraverso la veicolazione di modelli di singolo-incagliato oligonucleotide per omologia-diretto riparazione6,13 (HDR) o attraverso la trasduzione di cellule post-elettroporazione con AAV6 vettori contenenti il omologia modello12. La capacità di riparare o introdurre specifiche mutazioni in HSPCs faciliterà nuove strategie terapeutiche per la terapia genica e lo studio espanso di mutazioni di driver del cancro in AML e altre malattie ematologiche. Mentre HDR in HSPCs umano è stato successo6,12,13, mouse HSPCs sono stati difficili da modificare utilizzando questa strategia6. Ottimizzazione dei protocolli HDR in umani e in particolare del mouse HSPCs consentirà di editing più specifici e lo sviluppo di strumenti per tenere traccia celle modificate utilizzando la codifica endogeno.

Infine, è anche previsto che la rottura di alleli mutanti di guadagno di funzione potrebbe rappresentare un potenziale approccio terapeutico per disordini ematopoietici congeniti ed acquisiti. In questo scenario, è consigliato un approccio privo di DNA al fine di evitare possibili integrazioni che potrebbero promuovere la trasformazione. Inoltre, l'approccio "mordi e fuggi" riduce la possibilità di effetti indesiderati fuori bersaglio. È necessario un maggiore impegno al fine di sviluppare specifici sistemi di consegna che avrebbe aperto nuove strade per il trattamento delle malattie ematologiche maligne e benigne.

Disclosures

Nessun conflitto di interessi di divulgare

Acknowledgments

Questo lavoro è stato supportato dalla prevenzione del cancro e Istituto di ricerca del Texas (RP160283, RP140001 e R1201), Angel Foundation di Gabrielle per la ricerca sul cancro, la Fondazione di Edward P. Evans e il NIH (DK092883, CA183252, CA125123, P50CA126752, CA193235 e DK107413). M.C.G è supportato da Baylor sostiene la ricerca per gli scienziati dell'allievo. Citometria a flusso è stata parzialmente sostenuta dal NIH (centro nazionale per le risorse di ricerca grant S10RR024574, Istituto nazionale dell'allergia e AI036211 di malattie infettive e National Cancer Institute P30CA125123) per il Baylor College of Medicine Cytometry e Cell Sorting Core.

Materials

Name Company Catalog Number Comments
Tissue culture plates according to cell numbers
1.5 ml Eppendorf microtubes Sigma Z606340-1000EA
50ml Falcon tubes Corning 352070
Nuclease Free Water - DEPC treated ThermoFisher Scientific AM9915G
KAPA HiFi HotStart ReadyMix (2X) KAPA Biosystems KK2600
MinElute PCR purification Kit Qiagen 28004
RNAse Zap RNAse Decontamination Solution ThermoFisher Scientific AM9780
RNA Clean and Concentrator-25 Zymo R1017
HiScribe T7 High Yield RNA Synthesis Kit New England Biolabs E2040S
Alt-R S.p. Cas9 Nuclease 3NLS, 100 µg IDT 1074181
40 mm Cell Strainers VWR 352340
Dulbecco's Phosphate Buffered Saline (PBS) GenDEPOT CA008-050
Fetal Bovine Serum (FBS), Regular Corning 35010CV
AutoMACS Pro Separator or MACS manual Cell Separation columns Miltenyi
Neon Transfection System Device ThermoFisher Scientific
Neon Transfection System 10mL kit ThermoFisher Scientific MPK1025 For larger numbers of cells (see protocol) Neon Transfection System 100 mL kit (# MPK10025) can be used
Name Company Catalog Number Comments
UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific 15575020 For human experiments only
Lymphoprep Stem Cell Technologies 7851 For human experiments only
CD34 MicroBead Kit UltraPure human Miltenyi Biotec 130-100-453 For human experiments only
Stem Span SFEM II Stem Cell Technologies 9605 For human experiments only
Recombinant Human SCF Miltenyi Biotec 130-096-695 For human experiments only
Recombinant Human TPO Miltenyi Biotec 130-094-013 For human experiments only
Recombinant Human FLT3L Miltenyi Biotec 130-096-479 For human experiments only
Name Company Catalog Number Comments
Mouse dissection tools For mouse experiments only
Mortar and Pestle For mouse experiments only
Hank's Balanced Salt Solution (HBSS) Gibco 14170112 For mouse experiments only
Biotin-conjugated anti c-kit antibody eBioscience 13-1171-82 For mouse experiments only
Anti-Biotin MicroBeads Miltenyi Biotec 130-090-485 For mouse experiments only
X VIVO-15, with L-Glutamine, Genatmycin and Phenol Red Lonza 04-418Q For mouse experiments only
Mouse IL-6 Peprotech 216-16 For mouse experiments only
Mouse TPO Peprotech 315-14 For mouse experiments only
Mouse IL-3 Peprotech 213-13 For mouse experiments only
Mouse SCF Peprotech 250-03 For mouse experiments only

DOWNLOAD MATERIALS LIST

References

  1. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, 816-821 (2012).
  2. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  3. Sternberg, S. H., Doudna, J. A. Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell. 58, 568-574 (2015).
  4. Heckl, D., et al. Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 32, 941-946 (2014).
  5. Mandal, P. K., et al. Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell stem cell. 15, 643-652 (2014).
  6. Gundry, M. C., et al. Highly Efficient Genome Editing of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. Cell Rep. 17, 1453-1461 (2016).
  7. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24, 1012-1019 (2014).
  8. Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature methods. 12, 982-988 (2015).
  9. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Current protocols in immunology. 111, A3 B 1-3 (2015).
  10. Lykke-Andersen, S., Jensen, T. H. Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol. 16, 665-677 (2015).
  11. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 42, e168 (2014).
  12. Dever, D. P., et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells. Nature. 539, 384-389 (2016).
  13. DeWitt, M. A., et al. Selection-free genome editing of the sickle mutation in human adult hematopoietic stem/progenitor cells. Sci Transl Med. 8, 360ra134 (2016).
  14. Aguirre, A. J., et al. Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting. Cancer Discov. 6, 914-929 (2016).
Rottura del Gene altamente efficiente di cellule progenitrici ematopoietiche Murine ed umane di CRISPR/Cas9
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).More

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter