Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Högeffektiva gen störningar av murina och mänskliga hematopoetiska stamceller av CRISPR/Cas9

doi: 10.3791/57278 Published: April 10, 2018
* These authors contributed equally

Summary

Ett protokoll för snabb CRISPR/Cas9-medierad gen störningar i mus och människans primära hematopoetiska celler är beskrivs i denna artikel. Cas9-sgRNA ribonucleoproteins introduceras via elektroporation med sgRNAs genereras genom in vitro- transkription och kommersiella Cas9. Hög redigering effektivitetsvinster uppnås med begränsad tid och finansiella kostnaden.

Abstract

Framsteg i fältet hematopoetiska stamceller (Förenta) har varit hjälpt av metoder att genetiskt ingenjör primära stamceller samt djurmodeller. Komplett gen ablation i Förenta krävs för generering av knockoutmöss som Förenta kunde isoleras, och gen ablation i primära mänskliga Förenta inte var möjligt. Viral transduktion kunde användas för knock-down metoder, men dessa led från variabel effekt. I allmänt, genetisk manipulering av mänskliga och mus hematopoetiska celler hindrades av låg effektivitet och omfattande tid och kostnad åtaganden. Nyligen, CRISPR/Cas9 expanderat dramatiskt förmågan att ingenjör DNA i däggdjursceller. Dock har tillämpningen av CRISPR/Cas9 för hematopoetiska celler varit utmanande, främst på grund av deras låga transfection effektivitetsvinster, toxiciteten av plasmid-baserade metoder och långsam handläggningstid av virus-baserat protokoll.

En snabb metod att utföra CRISPR/Cas9-medierad gen redigering i murina och mänskliga hematopoetiska stamceller och stamceller celler med knockout effektivitetsvinsterna av upp till 90% finns i denna artikel. Denna strategi använder tredjeparts en ribonukleoprotein (RNP) leverans strategi med ett strömlinjeformat arbetsflöde för tre dagar. Användning av Cas9-sgRNA RNP möjliggör en hit-and-run förhållningssätt, att införa något EXOGEN DNA-sekvenser i genomet hos redigerade celler och minska off-target effekter. RNP-baserade metoden är snabb och enkel: det inte kräver kloning av sgRNAs, virus beredning eller specifika sgRNA kemisk modifiering. Med detta protokoll bör forskare kunna generera framgångsrikt knockouts av en gen av intresse i primära hematopoetiska celler inom en vecka, inklusive stilleståndstider för oligonukleotiden syntes. Detta tillvägagångssätt gör att en mycket bredare grupp av användare att anpassa detta protokoll för deras behov.

Introduction

Tillkomsten av CRISPR/Cas9 har radikalt förenklad gen redigering i däggdjursceller. Tidiga CRISPR/Cas9 protokoll utnyttjas plasmid eller virus-baserat leverans av Cas9 protein och sgRNA1,2,3. Dessa synsätt visat revolutionerande för utveckling av cellulära och djurs modeller och har också framgångsrikt tillämpat primära hematopoetiska stamceller och stamceller celler (HSPCs)4,5. Dessa metoder har dock ett antal nackdelar. Det första förblir gen avbrott effektivitet ofta under 50%4,5. Medan detta är tillräckligt för att generera knockout (KO) kloner i cellinjer, gör nödvändigheten för kortfristiga kultur HSPCs inte kan bli föremål för en sådan strategi. Det andra begränsar kravet för kloning mängden sgRNAs som kan provas i enda experiment och genererar stora, svårt att transfect konstruktioner. Tredje, dessa metoder tvinga forskare att sakta handläggningstider.

För att övervinna dessa begränsningar, vår grupp utvecklade och publicerade nyligen ett alternativt CRISPR/Cas9 tillvägagångssätt i HSPCs använder Cas9-sgRNA ribonucleoproteins (RNPs)-baserade leverans6. I denna strategi, rå komponenter av CRISPR (Cas9 protein och in vitro- transkriberat sgRNA) är pre-komplex och direkt levererade till målcellerna via elektroporation (figur 1). Halveringstiden för Cas9-sgRNA RNP komplexet är kortare än tid det plasmid eller viral nukleinsyra är transkriberas, off-target priset är lägre än tidiga metoder7. Dessutom lägger metoden RNP till förmån för att eliminera någon källa av exogent DNA, som slumpmässigt kan integrera i målet cellen genomet leder till cellulära omvandling.

Detta protokoll baseras på ett smidigt arbetsflöde för RNP-baserade gen störningar experiment, som representerade i figur 1. Det första steget utforma och beställa primers för varje sgRNA. Dessa primers används för att göra sgRNA DNA mallar som används för in vitro- transkription (IVT) för att få sgRNAs. Renade sgRNAs inkuberas därefter med tidigare köpta Cas9 protein, till form Cas9-sgRNA RNP komplex. Slutligen är pre-komplex Cas9-sgRNA RNPs electroporated in i celler. Efter elektroporation, redigering effektivitet kan testas och in vitro-/i vivo experiment kan startas, beroende på behov. Nedan en detaljerad beskrivning av detta innovativa experimentella tillvägagångssätt kan hittas.

Protocol

Protokollet följer riktlinjerna i Baylor College of Medicine mänskliga etiska kommittén. Alla experimentella procedurer utförs på möss är godkända av Baylor College av medicin institutionella djur vård och användning kommittén.

1. sgRNA Fwd Design

  1. Navigera till http://www.crisprscan.org/?page=track8 att börja utforma sgRNAs av intresse.
  2. Klicka på ”mus” eller ”Human” knapp cell beroende på intresse.
  3. Ange gen av intresse i UCSC sökrutan och tryck på gå.
  4. Zooma in och flytta till regionen av genen (dvs. en specifik exon) som är av intresse för målet.
    Obs: För att uppnå effektiv gen störningar rekommenderar inriktning den tidigaste exon(s) som är närvarande i alla transkriberas isoformer i din specifika celltyp.
  5. Se till att de potentiella sgRNA target sekvenserna visas under en ”CRISPRscan förutsägelser på gener (CDS)” rubrik.
  6. Hitta och klicka på en target sekvens med en relativt hög poäng och några off-mål (markerat med ljusgrön). Kopiera den fullständiga sekvensen visas under avsnittet ”Oligo sequence” och klistra in den i ett textdokument. Lägg till ”ATAGC” i 3' slutet av sekvensen. En gång fullständig, placera ordningen för fullängds sekvensen.
    Obs: För varje mål sekvens, CRISPRscan8 ger en ”integrerad” framåt sgRNA primer som innehåller T7 promotorn, sekvensen protospacer (mål) och universal byggnadsställning överlappning sekvensen (se figur 1A). En fullängds sekvens görs av antingen 56 eller 57 nukleotider beroende på protospacer längd.

2. sgRNA DNA mall-syntes

  1. Lös och späd sgRNA Fwd och universella Rev primer (se tabell 1 för komplett serie). För att erhålla en slutlig koncentration 10 µM, Följ instruktionen tillverkaren om hur späd grundfärger till 100 µM, sedan göra en 1:10 utspädning med nuclease-gratis vatten.
  2. Att utföra överlappande PCR (se figur 1B), blanda följande i PCR-strip rör: 2 µL framåt sgRNA primer (10 µM), 2 µL Universal Rev ställningen primer (HPLC renat) (10 µM), 10 µL High fidelity DNA-polymeras master mix (2 x) och 6 µL nuclease-gratis vatten.
  3. Köra PCR med följande program: 95 ° C i 3 min, 98 ° C i 5 s, 60 ° C för 5 s, 72 ° C under 10 s, gå till 2 i 6 cykler, 72 ° C i 1 min, 4 ° C för evigt.
  4. Rena PCR-produkten med hjälp av DNA rening kolumner (se tabell av material). Följ tillverkarens anvisningar och eluera med 11,5 µL av eluering buffert.
  5. Mätning av koncentrationen av PCR-produkter på en spektrofotometer. Tomma instrumentet med eluering buffert.
    Obs: Den DNA-koncentrationen ska vara mellan ~ 50 och ~ 120 ng/µL.

3. in Vitro transkription av sgRNA

  1. Blanda följande komponenter i PCR-strip rör (reagenser finns i RNA syntes kit): 4 µL av eluerade DNA, 4 µL av dNTP, 1 µL 10 x reaktion buffert och 1 µL T7 RNA-polymeras enzym mix.
  2. Inkubera proverna vid 37 ° C i minst 4 tim.
  3. Applicera det RNase rengöringsmedlet för att avlägsna RNase från handskar på händerna.
  4. Ta varje RNA-prov upp till en total volym på 50 µL med nuclease-fritt vatten (första steget av RNA rening efter tillverkarens anvisningar).
  5. Fortsätt med RNA rening efter tillverkarens anvisningar och eluera i 50 µL kit-förutsatt nuclease-gratis vatten.
  6. Mätning av koncentrationen av de eluerade sgRNA på en spektrofotometer. Tomma instrumentet med nuclease-gratis vatten.
    Obs: Den förväntade avkastningen efter rening är 50-80 µg av RNA (dvs. koncentration av 1,0-1,5 µg/µL).
  7. Använd den renade sgRNA genast eller förvara i alikvoter av 2-4 µL vid-80 ° C på lång sikt.

4. HSPC isolering och kultur

  1. Murina HSPCs isolering och kultur
    Obs: Manliga och kvinnliga Ubc-GFP möss (JAX004353) och Rosa26-LSL-tdTomato (JAX007914) korsat med Vav-iCre (JAX008610) vid 2-6 månaders ålder användes för att få de resultat som visas nedan.
    1. Euthanize sövda möss genom cervikal dislokation.
      Obs: Två utbildade personer bör självständigt kontrollera framgångsrika dödshjälp genom att notera brist på andning och hjärtslag i minst 5 min. ta bort huden från djuren.
    2. Dissekera förbenade, lårbenet och iliaca kammar av möss och ta bort alla muskler och bindväv runt dissekerade ben. Placera intakt ben i en vävnadskultur maträtt på is med HBSS kompletteras med 2% FBS (HBSS +). Flytta till en LAF så snart som al ben har rengjorts och överförs till vävnadsodling skålen.
    3. Överföring rengöras ben till sterila murbruk, innehållande 2 mL iskallt HBSS + per 3 ben. Med mortelstöten, krossa ben i benfragment, släppa märg från inom. Fortsätta pestling tills ben stoppar sprickbildning under mortelstöten.
    4. Samla in supernatanten från murbruk och filter i en 50 mL konisk slang med hjälp av en sil med 40 µm i cellen. Skölj de återstående benfragment med 5 mL iskallt HBSS + och filter i samma 50 mL koniska rör använder samma 40 µm Silen.
    5. Tvätta cellerna två gånger av fulladda röret med iskall HBSS + och centrifugering vid 400 x g för 7 min. Kassera supernatanten.
    6. Efter den andra tvätten Återsuspendera cellpelleten i 20 mL is kallt PBS. Räkna viabla celler av trypan-blå utslagning9.
    7. Inkubera 1 x 108 viabla celler per 1 mL iskallt HBSS + med c-kit-biotin-konjugerad antikropp på 1: 100 utspädning för 45 min på is.
    8. Tvätta cellerna med iskall HBSS + genom centrifugering vid 400 x g i 7 min och kasta bort supernatanten.
    9. Inkubera cellerna med anti biotin magnetiska pärlor efter tillverkarens anvisningar.
    10. Isolera c-kit positiva celler använder magnetiska kolumner eller magnetisk-aktiverad cell sorterare efter tillverkarens anvisningar. Samla in c-kit positiva celler i 15 mL koniska rör.
    11. Tvätta cellerna två gånger med PBS av fulladda 15 mL koniska röret och centrifugering vid 400 x g för 7 min. avlägsna supernatanten. Beräkna det totala antalet livskraftiga celler trypan blå utslagning9mellan de två tvättarna.
    12. Återsuspendera c-kit +-celler vid en koncentration på upp till 106 viablecells per 100 µL av odlingsmedium för murina HSPCs kompletterat med 2% FBS, 50 ng/mL mus stamceller faktor (SCF), 50 ng/mL mus trombopoetin (TPO), 10 ng/mL mus IL-3 och 10 ng/mL mus IL-6.
    13. Inkubera cellerna vid 37 ° C, 5% CO2 för minst 1 h till högst 24 h innan elektroporation.
  2. Mänskliga HSPCs isolering och kultur
    Obs: Dessa åtgärder måste utföras i en LAF.
    1. Filtrera celler benmärg/navelsträngsblod genom en sil med 40 µm i cellen.
    2. Späd 1:2 celler filtrerade benmärg/navelsträngsblod med PBS kompletteras med 1 mM EDTA (PBS/EDTA).
    3. Fördela 15 mL täthet lutning medium i en 50 mL konisk slang. Häll försiktigt 30 mL av den utspädda benmärg/navelsträngsblod på täthet lutning medium yta. Om volymen av cellsuspensionen är större än 30 mL förbereda flera rör.
      Obs: Se till att hålla gränssnittet mellan blodet och täthet lutning medium så skarp som möjligt.
    4. Snurra rören på 750 x g i 30 min med ingen inbromsning.
    5. Samla det mononukleära celllagrar som är påvisbara på mediets gränssnitt och överföring till en ren 50 mL koniska tub. Fyll röret med PBS/EDTA och snurra cellerna vid 280 g i 15 min. Kassera supernatanten.
    6. Tvätta cellerna två gånger i PBS/EDTA spinning vid 400 x g i 7 min och kasta bort supernatanten.
    7. Inkubera mononukleära celler med anti-CD34 magnetiska pärlor efter tillverkarens anvisningar.
    8. Isolera CD34 + celler med hjälp av magnetiska kolumner eller magnetisk-aktiverad cell sorterare efter tillverkarens anvisningar. Samla CD34 + celler i 15 mL koniska rör.
    9. Tvätta samlas CD34 + celler två gånger av fulladda röret med PBS och spinning vid 400 x g i 7 min och kasta bort supernatanten. Beräkna det totala antalet livskraftiga celler trypan blå utslagning9mellan de två tvättarna.
    10. Att resuspendera cellerna i odlingsmedium som kompletteras med 100 ng/mL mänskliga SCF, 100 ng/mL mänskliga FLT3 ligand (FLT3L), 100 ng/mL mänskliga TPO vid en koncentration på ~2.5 x 105 viabla celler / ml. kultur isolerade CD34 +-celler vid 37 ° C, 5% CO2 för 24 h vid ett maximalt 48 h före till elektroporation.
      Obs: Kontrollera renhet av berikade CD34 + befolkningen av flödescytometri före elektroporation.

5. elektroporation

Obs: Följande protokoll är optimerad för 10 µL elektroporation tips. Alla åtgärder ska utföras i en LAF.

  1. Räkna celler av trypan blå utslagning9. Samla 2 x 105 viabla celler per replikat (e.g. samla 6 x 105 celler för 3 electroporations).
  2. Tvätta cellerna två gånger med PBS, spinning på 300 x g för 7 min och noggrant avlägsna supernatanten.
  3. Parallellt, förbereda Cas9-sgRNA RNP komplex genom ruvning i PCR-rören för 20-30 min på RT 1,5 µg Cas9 med 1 µg av totala sgRNA för varje replikat, utom den enda Cas9-kontrollen.
    Obs: Cas9 protein tillhandahålls på 10 µg/µl koncentration. För att säkerställa korrekt pipettering, späd 1:10 den totala mängden Cas9 protein behövs med nuclease-fritt vatten (t.ex. för 10 electroporations ta 1 µl Cas9 protein och späd med 9 µl nuclease-gratis vatten och inkubera 1 µl utspädda Cas9 per replikat. Beroende på sgRNA, bör den totala mängden Cas9 och sgRNA bestå mellan 1,7 och 2 µl per replikat. Om du använder två sgRNAs Inkubera 500 ng av varje sgRNA per replikat; Om du använder 3 sgRNAs Inkubera 330 ng av varje sgRNA per replikera och så vidare.
  4. Beräkna den totala volymen av resuspension buffert T behövs 10 µL multipliceras med antalet totalt replikerar behövs (t.ex. 30 µL för 3 replikat). Återsuspendera pelleterat celler med den beräknade volymen buffert T. säkerställa att den slutliga koncentrationen av cellsuspensionen 2 x 107 celler/mL.
  5. Alikvotens 10 µL återsuspenderad celler/replikera i varje PCR-röret som innehåller den pre-komplex sgRNA/Cas9 RNP (t.ex. för däcktypen alikvotens 30 μl cellsuspension i en PCR-röret som innehåller pre-komplex Cas9-sgRNA).
  6. Ställa in systemets elektroporation slå på instrumentet tillsätts 3 mL buffert E till en elektroporation kyvetten och skjut kyvetten i kyvetten hållaren.
  7. Ange önskad elektroporation villkoren på enhet: mänskliga HSPCs (1600 V, 10 ms, 3 pulser) eller mus HSPCs (1700 V, 20 ms, 1 puls).
    Obs: Om önskas, innan du utför experiment på CD34 + HSPCs, sgRNA effektivitet kan testas på akut myeloisk leukemi (AML) cellinjer (t.ex. HL60) med samma strategi (Använd antibiotika-fri medium för AML cellinjer) med följande elektroporation villkor: Buffert R, 1350 V, 35 ms, 1 puls.
  8. Elektroporation utförs med en speciell elektroporation pipett, som har en klo som spärrar på elektroporation pipettspetsen. Håll pipetten elektroporation, utöka claw, greppa skivan inuti pipettspetsen och ordentligt tryck på pipetten ner säkert toppen.
  9. Pipettera provet upp och ner 10 gånger för att blanda. Ta ut 10 µL, se till att det finns inga bubblor, och infoga pipettspetsen direkt i det elektrolytiska buffert i den elektroporation kyvetten. Försök att inte röra vid väggarna av kyvetten. Tryck på ”start” på skärmen. När meddelandet ”komplett” visas, avlägsna pipetten och fördela innehållet i brunn med nya HSPC odlingsmedium.
  10. Upprepa för alla prover. Förändring pipett tips mellan prover, om endast nödvändigt.

Representative Results

Målet med detta protokoll är att utföra gen knockout (KO) mus och mänskliga HSPCs använder Cas9-sgRNA RNPs. Arbetsflödet är enkelt och snabbt och möjliggör slutförandet av experiment i mindre än en vecka från experimentell design till bedömning av KO effektivitet.

Jämfört med plasmid - eller virus-baserat tillvägagångssätt, bygger framgången för våra protokoll på kombinationen av sgRNA RNPs och elektroporation. Denna kloning-gratis strategi förkortar avsevärt den tid som behövs för att hämta komponenter för transfect. Dessutom elektroporation möjliggör transfection upp till 95% av celler, maximera leveransen av den RNPs. sgRNAs kan vara synthetized i labbet genom in vitro- transkription (IVT), medan renat Cas9 protein kan köpas från flera företag ( (se protokoll). sgRNA DNA mallar för IVT erhålls utför en kort PCR använder sgRNA Fwd primer (figur 1A, B) och universella schavotten Rev primer (figur 1B - se protokoll). PCR-produkten används sedan som mall för IVT (figur 1 c). Cas9-sgRNA RNP komplex genereras inkubation i 15-30 minuter i sgRNAs och Cas9 (figur 1 c). Slutligen är sgRNA RNPs electroporated in i celler. Redigerade HSPCs kan sedan användas för att utföra både in vitro- och in-vivo -experiment.

Gen störningar i mus celler

Att påvisa effekten av Cas9-sgRNA RNP elektroporation strategin, c-kit + HSPCs isolerade från möss ubiquitously uttrycker GFP eller tdTomato har varit electroporated med sgRNA mot GFP eller tdTomato. Bland de tre sgRNA utformade mot GFP, GFP sg1 utförs mest effektivt, uppvisar ungefär 70-75% störningar av GFP uttryck som bestäms av flödescytometri (figur 2A, B). För att kvantifiera gen störningar frekvensen på genomisk nivå, genomisk DNA från electroporated cellerna var isolerad och T7 Amiiiiin I-baserade (T7EI) analysen utfördes. Som visas i figur 2 c, T7EI assay upptäckt upp till 60% ditsatta bildning. Observera att T7EI analyser tenderar att underskatta frekvenserna av indels. Vi har också genererat sgRNA mot tdTomato och electroporated HSPCs uttrycka tdTomato från det Rosa26 locus. Som visas i figur 2D, uppföljningsstudien tdTomato sg1 effektivt uttrycket av tdTomato.

Gen störningar i mänskliga celler

Här, visas effektiv störningar uppnås med en enda sgRNA strategi inriktning CD45, en cell surface markör uttryckt på hematopoetiska celler. Tre sgRNAs inriktning olika exoner av CD45 var designad (CD45 sg1, sg2 och sg3). Effektiviteten i sgRNAs testades i HL60 AML cell linje (figur 3A). Protein KO bedömdes av flödescytometri 5 dagar efter elektroporation. CD45 sg1 var den mest effektiva (98% KO effektiviteten - figur 3A) och användes för ytterligare experiment. Figur 3B visar CD45 KO i primära mänskliga CD34 + stamceller använder CD45 sg1, bedömas av flödescytometri 5 dagar efter elektroporation. Medan CD34 uttryck var opåverkad, förlorade CD45 uttryck i cirka 80% av cellerna. 200.000 redigerade primära CD34 + celler transplanterade retro-orbitally i NSG möss 6 timmar efter elektroporation. Benmärg och mjältceller var avverkat 3 månader efter transplantation. Redigerade celler (HLA-ABC positiv, CD45 negativa, markerade i rött) kan påvisas endast i sgRNA behandlade prover och inte i Cas9 endast kontroller (figur 3 c).

Om så önskas, kan två sgRNAs inriktning i närheten sekvenser användas för att generera borttagningar. Detta tillvägagångssätt möjliggör en snabb uppskattning av redigering effektivitet med en PCR och ger ofta högre avbrott effektivitet. Figur 3D visar effektiv generering av en 58 bp-borttagning i exon 10 av DNMT3A. 200.000 redigerade CD34 + celler transplanterade i NSG möss 6 timmar efter elektroporation. Bp 58 borttagningen upptäcktes klart i perifert blod rekonstituerades NSG möss 5 månader efter injektioner (figur 3E) bekräftar för redigering av CD34 + celler med långsiktiga engraftment kapacitet.

Figure 1
Figur 1: den snabb och enkel metoden att generera sgRNA RNPs. (A) Representation av sgRNA Fwd primer. SgRNA Fwd primer är en DNA oligonukleotiden innehållande T7 promotorn, protospacer sekvensen och en överlappning sekvens med sgRNA ställningen. På 3na ' är slutet, markerat med rött, den ”ATAGC”-sekvens som måste läggas till sgRNA Fwd primer sekvensen erhålls på CRISPRscan. B) Schematisk framställning av överlappningen PCR utfört för att erhålla mallen IVT. Överlappningen mellan sgRNA Fwd primer och Universal byggnadsställning Rev primern möjliggör utbyggnad och förstärkning av PCR. C) tecknad film som beskriver IVT reaktionen och den sgRNA RNP pre-komplexbildare. PCR-produkten renas och används som mall för IVT. IVT genererar en stor mängd sgRNAs som kan användas i flera replikat (se protokoll). sgRNA RNPs genereras ruvar den sgRNA som renats från IVT och tidigare köpta Cas9 protein. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: effektiv gen störningar i mus hematopoetiska progenitorceller. (A) en sgRNA inriktning GFP (GFP sg1) tillsammans med Cas9 protein var electroporated in murina c-kit + HSPCs uttrycker GFP och analyseras med flödescytometri 24 timmar efter elektroporation. B) olika mängd GFP sg1 var komplex med 1 µg Cas9 protein och electroporated. Så lite som 200 ng av GFP sg1 avlägsnas effektivt GFP uttryck. C) T7EI assay utförs på genomisk DNA isolerade från cellerna som används i A-B. PCR-amplikon som spänner över Cas9-sgRNA klyvning platsen var utspädd 1:4 i 1 x buffert 2 och hybridiserade långsamt i en termocykel. Hybridiserade fragment var sedan smält med 1,25 U av T7 Amiiiiin jag i 10 minuter vid 37 ° C. Smält fragment var åtskilda av polyakrylamid gelelektrofores. Band stödnivåer analyserades med hjälp av ImageJ programvara genom att plotta bandet intensiteter av varje körfält. % klyvning beräknades genom förhållandet mellan banden klyvs uncleaved band stödnivåerna. D) c-kit + HSPCs isolerade från möss som uttrycker tdTomato var electroporated med Cas9 protein komplex med sgRNA mot tdTomato. Flödescytometri utförs 24 timmar efter elektroporation visade att cirka 74% av cellerna bort tdTomato. R26 = Rosa26. * p < 0,05, ** p < 0,01, *** p < 0,001. Denna siffra har anpassats från Gundry et al. 6 Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: effektiv gen störningar i mänskliga hematopoetiska celler. (A) tre sgRNAs inriktning CD45 (CD45 sg1, sg2 och sg3) har utformats och testats i HL60 AML cell linje (se protokoll för elektroporation villkor). Flödescytometri utfördes 5 dagar efter elektroporation. CD45 sg1 valdes som den mest effektiva bland de tre sgRNAs (KO effektivitet 98%). (B) CD45 KO i primära mänskliga sladd blod CD34 + HSPCs använder CD45 sg1. CD45 förlust kan upptäckas i ungefär 80% av cellerna. Observera att CD34 uttryck är oförändrad efter redigering. C) redigerad mänskliga HSPCs kan vara effektivt rekonstituerades till NSG möss. Mänskliga kärnförsedda celler visar den normala HLA +/ CD45 + fenotyp i Cas9-bara rekonstituerades möss, medan möss rekonstituerades med CD45-sg1 behandlades CD34 + celler, båda HLA +/ CD45 + och HLA +/ CD45-populationer observeras som anger engraftment av mänskliga CD45 KO celler. (D) 2% agarosgel visar en 58 bp borttagning genereras av 2 sgRNAs (dubbla guide strategi) i exon 10 av DNMT3A i mänskliga HSPCs från 3 olika navelsträngsblod (CB1, CB2 och CB3). PCR utfördes 3 dagar efter elektroporation. (E) 2% agarosgel visar varaktigheten av 58 bp borttagningen 5 månader efter transplantation i NSG möss. Denna siffra har anpassats från Gundry o.a. 6 Klicka här för att se en större version av denna siffra.

Oligonukleotid Sekvens Obs
Universal Rev ställningen primer gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct Universell reverse primer för överlappar PCR
hCD45 sgRNA 1 taatacgactcactataGGTGCTGGTGTTGGGCGCACgttttagagctagaaatagc sgRNA Fwd primer sekvens för överlappning PCR
hCD45 sgRNA 2 taatacgactcactataGGGAGCAAGTGAGGATCCTCgttttagagctagaaatagc sgRNA Fwd primer sekvens för överlappning PCR
hCD45 sgRNA 3 taatacgactcactataGGGATGCTTGTTCCCTTCAGgttttagagctagaaatagc sgRNA Fwd primer sekvens för överlappning PCR
hDNMT3A Ex10 sg1 taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd primer sekvens för överlappning PCR
hDNMT3A Ex10 sg2 taatacgactcactataGGGTGGCCAGCAGCCGCGCGgttttagagctagaaatagc sgRNA Fwd primer sekvens för överlappning PCR
Rosa26 sgRNA taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd primer sekvens för överlappning PCR
GFP sg1 taatacgactcactataGGGCGAGGAGCTGTTCACCGgttttagagctagaaatagc sgRNA Fwd primer sekvens för överlappning PCR
tdTomato sg1 taatacgactcactataGGGGTACAGGCGCTCGGTGGgtttaagagctagaaatagc sgRNA Fwd primer sekvens för överlappning PCR

Tabell 1: Komplett sekvenser av sgRNA Fwd primers används i experiment och Universal Rev primer.

Discussion

Den RNP-strategi som beskrivs i detta detaljerade protokoll möjliggör effektiv gen knockout i både mus och mänskliga primära hematopoetiska celler samt som i suspension cellinjer. Även om mycket hög KO effektivitetsvinster erhålls ofta, måste flera kritiska variabler beaktas. Först, ordentlig exon val är nyckeln till att garantera att effektiv ditsatta inkorporering motsvarar gen knockout. Två viktiga faktorer relaterade till exon val är bevarande över isoformer och exon position inom avskrifter. Isoform uttrycksmönster är variabel över celltyper, så om genen KO över celltyper önskas, exoner som är oföränderliga mellan cell typer bör riktas. Isoform mönster kan verifieras via q-PCR eller RNA-sekvensering data. Exon position inom avskrifter, det är bäst att rikta tidiga exoner som frameshift mutationer i terminalen eller näst sista exon kan undgå nonsens-medierad sönderfall10, producerar proteiner med romanen eller okända funktioner i stället för sann nullvärden.

Bestämma ditsatta är frekvens ett kritiskt steg att uppskatta KO effektivitet och korrekt tolka biologiska resultatet av experimentet. Endonucleases analyser (t.ex. surveyor assay) har fördelen att vara relativt snabbt och enkelt att utföra. Dock tenderar de att vara felaktig på grund av betydande bakgrund signaler och resultaten är ofta svårt att reproducera. Dessutom ger de inte information om kvaliteten på indels som genereras (t.ex. längd infogningar och borttagningar) i experimentet. Sanger sekvensering ger ett värdefullt alternativ till Amiiiiin analyser. Plattformar såsom TIDE11 (https://tide.nki.nl/) hjälper till att sönderdela sanger spår och producera exakta uppskattningar av alleliska avbrott effektivitet, samtidigt som frekvensen av enskilda indels. Den stora nackdelen är ett absolut beroende av hög kvalitet Sanger sekvensering spår. Hög genomströmning amplikon sekvensering övervinner de flesta av dessa frågor. Amplikon bibliotek kan framställas med mycket låg DNA ingångar och hög täckning garanterar tillförlitliga resultat. För att minska kostnaden för amplikon sekvensering, spike vi vanligtvis i amplikon bibliotek i större sekvensering löprundor (e.g. RNA-sekvensering) med endast 1-1,5% av den totala läser. Slutligen, för att bekräfta lyckad knockout, vi starkt rekommenderar att bedöma proteinnivåer av western blotting eller flödescytometri, när det är möjligt.

Som tidigare beskrivits, den metod som presenteras här är snabb och okomplicerad och representerar ett nytt verktyg att studera genen knock out-mus och mänskliga HSPCs. Medan våra protokoll innehåller instruktioner för genen knockout med en tip-baserad elektroporation system, har andra system visat sig vara mycket effektiv12,13.

Två stora begränsningar måste erkännas när det gäller metoden RNP. Först, som beskrivs av vår grupp, HSPCs electroporated med in vitro-livskraft transkriberat sgRNAs avsevärt kan äventyras av elektroporation, särskilt när förhållandena inte är optimala6. Om det behövs, kan kommersiellt syntetiskt sgRNAs (dvs. eliminera in vitro- transkription) lösa detta problem. Dessa blir billigare med tiden och kan köpas från flera leverantörer. I det här fallet in vitro- transkription kunde användas för att generera en pool av sgRNA till skärmen för effekt, och sedan den mest effektiva sgRNA(s) kan väljas för syntes. Den andra stora begränsningen av RNP strategi är oförmågan att spåra framgångsrikt transfekterade celler, som i viral-baserade metoder. Dock kan hög KO effektivitet och snabb redigering uppnås med Cas9-sgRNA RNPs uppväga dessa nackdelar i många experimentella scenarier. Vi rekommenderar att du använder hög genomströmning amplikon sekvensering att exakt bestämma avbrott effektivitet i varje experiment. Om den knock-out av genen av intresse förväntas ge en proliferativ fenotyp (dvs. antingen minskat eller ökat spridning jämfört med vildtyp celler), att bestämma frekvensen ditsatta vid flera tidpunkter gör att man kan bedöma huruvida KO celler genomgå anrikning (dvs ditsatta frekvens ökar över tid) eller är outcompeted (dvs. ditsatta frekvens minskar med tiden).

Utför in vivo eller in vitro- experiment för att förstå de biologiska effekterna av förlust av geners funktion kräver lämpliga kontroller. Som tidigare nämnts, in vitro- transkriberat sgRNAs kan vara giftigt för celler, särskilt primära progenitor cells6. DNA dubbel-strand raster orsakas av Cas9 protein kan dessutom orsaka gen oberoende anti-proliferativ svar14. Därför vi använder ofta ett antal kontroll sgRNAs CRISPR experiment och rekommendera en cell surface markör uttryckt på din celltyp samt en andra målgenen som inte uttrycks.

Kortfristiga kultur av mänskliga HSPCs i närvaro av cytokiner ökar den gen avbrott effektivitet6 och är nödvändigt för att uppnå hög verkningsgrad KO. Vi har hittat 36-48 timmar för att vara den idealiska kultur före elektroporation6. Efter elektroporation, cellerna kan vara ytterligare odlade att hålla i åtanke att ju längre kulturen desto större är risken att förlora Multilinjärt engraftment kapacitet. Därför, vi utför vanligen transplantationer 6 timmar efter elektroporation och aldrig senare än 24 timmar efter elektroporation.

CRISPR/Cas9 förbättrats dramatiskt forskare förmåga att framgångsrikt redigera genomet hos däggdjursceller. Att göra gen störningar mer genomförbart i primära hematopoetiska progenitorceller förutspås att snabbt öka den vetenskapliga kunskapen inom området HSPCs och hematologiska sjukdomar. Ännu viktigare, gör det protokoll som beskrivs här det också möjligt att samtidigt generera flera knockouts med hög verkningsgrad, vilket möjliggör modellering av komplexa genetiska landskap, ses ofta i leukemic sjukdomar.

Även om de protokoll som beskrivs häri är fokuserade på genen störningar, kan de lätt anpassas för genen inpressning experiment. Detta kan åstadkommas genom samtidig leverans av enkelsträngat oligonukleotiden mallar för homologi-regisserad reparation6,13 (HDR) eller genom transduktion av celler post-elektroporation med AAV6 vektorer som innehåller den homologi mall12. Förmågan att reparera eller införa specifika mutationer i HSPCs kommer att underlätta nya terapeutiska strategier för genterapi och utökade studier av cancer driver mutationer i AML och andra hematologiska sjukdomar. HDR i mänskliga HSPCs har varit framgångsrika6,12,13, mus HSPCs har varit svårt att redigera använder denna strategi6. Optimering av HDR protokoll i mänskliga och särskilt i mus HSPCs kommer att möjliggöra mer specifik redigering och utvecklingen av verktyg för att spåra redigerade celler använder endogena taggning.

Slutligen är det också tänkt att störningar av muterade gain-of-function alleler kan utgöra en potentiell terapeutisk metod för medfödda och förvärvade hematopoetiska störningar. I det här fallet rekommenderas en DNA-gratis strategi för att undvika möjliga integrationer som kunde främja omvandling. Metoden ”hit and run” minskar dessutom risken för oönskad off-effekter. Mer ansträngning behövs för att utveckla specifika leveranssystem som skulle öppna nya vägar för behandling av maligna och icke-maligna hematologiska sjukdomar.

Disclosures

Någon intressekonflikt att lämna ut

Acknowledgments

Detta arbete stöds av Cancer förebyggande och forskning Institutet Texas (RP160283, RP140001 och R1201), Gabrielles Angel Foundation för cancerforskning, Stiftelsen Edward P. Evans och NIH (DK092883, CA183252, CA125123, P50CA126752, CA193235 och DK107413). M.C.G. stöds av Baylor forskning förespråkar för Student forskare. Flödescytometri stöddes delvis av NIH (National Center for forskningsresurser grant S10RR024574, nationella institutet för allergi och smittsamma sjukdomar AI036211 och National Cancer Institute P30CA125123) för den Baylor College of Medicine Flödescytometri och Cell sortering Core.

Materials

Name Company Catalog Number Comments
Tissue culture plates according to cell numbers
1.5 ml Eppendorf microtubes Sigma Z606340-1000EA
50ml Falcon tubes Corning 352070
Nuclease Free Water - DEPC treated ThermoFisher Scientific AM9915G
KAPA HiFi HotStart ReadyMix (2X) KAPA Biosystems KK2600
MinElute PCR purification Kit Qiagen 28004
RNAse Zap RNAse Decontamination Solution ThermoFisher Scientific AM9780
RNA Clean and Concentrator-25 Zymo R1017
HiScribe T7 High Yield RNA Synthesis Kit New England Biolabs E2040S
Alt-R S.p. Cas9 Nuclease 3NLS, 100 µg IDT 1074181
40 mm Cell Strainers VWR 352340
Dulbecco's Phosphate Buffered Saline (PBS) GenDEPOT CA008-050
Fetal Bovine Serum (FBS), Regular Corning 35010CV
AutoMACS Pro Separator or MACS manual Cell Separation columns Miltenyi
Neon Transfection System Device ThermoFisher Scientific
Neon Transfection System 10mL kit ThermoFisher Scientific MPK1025 For larger numbers of cells (see protocol) Neon Transfection System 100 mL kit (# MPK10025) can be used
Name Company Catalog Number Comments
UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific 15575020 For human experiments only
Lymphoprep Stem Cell Technologies 7851 For human experiments only
CD34 MicroBead Kit UltraPure human Miltenyi Biotec 130-100-453 For human experiments only
Stem Span SFEM II Stem Cell Technologies 9605 For human experiments only
Recombinant Human SCF Miltenyi Biotec 130-096-695 For human experiments only
Recombinant Human TPO Miltenyi Biotec 130-094-013 For human experiments only
Recombinant Human FLT3L Miltenyi Biotec 130-096-479 For human experiments only
Name Company Catalog Number Comments
Mouse dissection tools For mouse experiments only
Mortar and Pestle For mouse experiments only
Hank's Balanced Salt Solution (HBSS) Gibco 14170112 For mouse experiments only
Biotin-conjugated anti c-kit antibody eBioscience 13-1171-82 For mouse experiments only
Anti-Biotin MicroBeads Miltenyi Biotec 130-090-485 For mouse experiments only
X VIVO-15, with L-Glutamine, Genatmycin and Phenol Red Lonza 04-418Q For mouse experiments only
Mouse IL-6 Peprotech 216-16 For mouse experiments only
Mouse TPO Peprotech 315-14 For mouse experiments only
Mouse IL-3 Peprotech 213-13 For mouse experiments only
Mouse SCF Peprotech 250-03 For mouse experiments only

DOWNLOAD MATERIALS LIST

References

  1. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, 816-821 (2012).
  2. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  3. Sternberg, S. H., Doudna, J. A. Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell. 58, 568-574 (2015).
  4. Heckl, D., et al. Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 32, 941-946 (2014).
  5. Mandal, P. K., et al. Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell stem cell. 15, 643-652 (2014).
  6. Gundry, M. C., et al. Highly Efficient Genome Editing of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. Cell Rep. 17, 1453-1461 (2016).
  7. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24, 1012-1019 (2014).
  8. Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature methods. 12, 982-988 (2015).
  9. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Current protocols in immunology. 111, A3 B 1-3 (2015).
  10. Lykke-Andersen, S., Jensen, T. H. Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol. 16, 665-677 (2015).
  11. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 42, e168 (2014).
  12. Dever, D. P., et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells. Nature. 539, 384-389 (2016).
  13. DeWitt, M. A., et al. Selection-free genome editing of the sickle mutation in human adult hematopoietic stem/progenitor cells. Sci Transl Med. 8, 360ra134 (2016).
  14. Aguirre, A. J., et al. Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting. Cancer Discov. 6, 914-929 (2016).
Högeffektiva gen störningar av murina och mänskliga hematopoetiska stamceller av CRISPR/Cas9
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).More

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter