Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Capture promoteur Salut-c : Haute résolution, Genome-wide profilage des Interactions de promoteur

doi: 10.3791/57320 Published: June 28, 2018
* These authors contributed equally

Summary

Éléments de régulation de l’ADN, comme améliorateurs, contrôlent l’expression des gènes en contactant physiquement les promoteurs de gènes cibles, souvent par le biais des interactions chromosomiques à longue portée, s’étendant sur grandes distances de génomiques. Promoteur de Capture Hi-C (DAPE-C) identifie des interactions significatives entre les promoteurs et les régions distales, permettant l’attribution des séquences régulatrices potentiels de leurs gènes cibles.

Abstract

L’organisation en trois dimensions du génome est liée à sa fonction. Par exemple, des éléments de régulation comme exhausteurs de transcriptional contrôlent l’expression spatio-temporelle de leurs gènes cibles par le biais de contacts physiques, souvent des liens relationnels considérable (dans certains cas des centaines de kilobases) génomique et contournant gènes voisins. Le génome humain recèle un exhausteurs de 1 million environ, la majorité dont est inconnu gènes cibles. Affectation des régions régulatrices distales à leurs gènes cibles est donc crucial de comprendre le contrôle d’expression de gène. Nous avons développé promoteur Capture Hi-C (DAPE-C) pour permettre la détection du génome des régions distales de promoteur-interaction (PIRs), pour tous les promoteurs dans une expérience simple. PCHi-c, hautement complexe CIH bibliothèques sont spécifiquement enrichis de séquences promotrices par le biais de sélection dans la solution hybride avec des milliers d’appâts biotinylé RNA complémentaires jusqu’aux extrémités de tous les fragments de restriction contenant du promoteur. Le but est de séquences promotrices puis menu déroulant et leurs partenaires d’interaction fréquente comme exhausteurs et d’autres éléments réglementaires potentielles. Après le séquençage haut débit jumelé-fin, un test statistique est appliqué à chaque fragment de restriction ligaturé au promoteur d’identifier les détecteurs infrarouge passifs significatifs au niveau du fragment de restriction. Nous avons utilisé le PCHi-C à produire un atlas des interactions à longue portée de promoteur en des dizaines d’homme et types de cellules de souris. Ces cartes d’interactome promoteur ont contribué à une meilleure compréhension du contrôle d’expression de gène mammifère en affectant les régions régulatrices putatives à leurs gènes cibles et révélant les réseaux d’interaction spatiale préférentiel de promoteur-promoteur. Cette information a aussi haute importance à la compréhension des maladies génétiques humaines et l’identification des gènes de maladies potentielles, en liant non codantes associés à la maladie variantes dans ou près des séquences de contrôle de leurs gènes cibles de la séquence.

Introduction

Accumulation de preuves suggère que l’organisation en trois dimensions du génome joue un rôle fonctionnel important dans une gamme de processus nucléaires, y compris les gènes d’activation1,2,3,4 la répression ,5,6,7,8, recombinaison9,10, ADN réparation11, réplication de l’ADN12,13, et sénescence cellulaire14. Exhausteurs de lointains sont trouvent à proximité spatiale aux promoteurs qu’ils réglementent15,16,17, qui est essentiel pour le contrôle d’expression de gène spatio-temporelle approprié. Destructions de renforceur montrent qu’exhausteurs distales sont essentiels pour cible génétique transcription18,19,20,21,22et « forcé la chromatine en boucle » démontre que le tethering machiné entre un renforceur et son promoteur de cible dans le locus de l’hexabromobiphényle est suffisant pour entraîner l’activation transcriptionnelle23. En outre, réarrangements génomiques qui apportent des gènes sous le contrôle d’exhausteurs ectopiques peuvent entraîner activation de gènes inappropriés et maladie24,25,26. Ensemble, ces exemples montrent que les interactions de promoteur-enhancer sont essentielles pour le contrôle de gènes et exigent le règlement serré afin d’assurer l’expression des gènes appropriés. L’homme et génomes de souris sont chacun estimées à environ 1 million d’exhausteurs de port. Pour la grande majorité de ces rehausseurs, gènes cibles sont inconnues, et les « règles d’engagement » entre promoteurs et exhausteurs sont mal compris. Affectation d’exhausteurs de transcriptionnelles à leurs gènes cibles ainsi demeure un défi majeur en déchiffrant contrôle d’expression génique chez les mammifères.

Notre compréhension de l’architecture en trois dimensions de génome a été révolutionnée par l’introduction de 3C27 (capture de conformation de chromosome) et ses variantes28,29,30,31 . Le plus puissant de ces techniques, le CIH (capture de conformation du chromosome à haut débit) est destiné à identifier l’ensemble entier des interactions chromosomiques au sein d’une population cellulaire. Salut-C bibliothèques, typiquement générés à partir des millions de cellules, sont très complexes avec une estimée 1011 produits de ligature indépendante entre les fragments de ~ 4 Ko dans le génome humain32. Comme une conséquence, une identification fiable et reproductible des interactions entre restriction individuelle des fragments (tels que ceux contenant un promoteur ou un rehausseur) de données Hi-C ne soient pas possibles à moins que le CIH bibliothèques sont soumis au séquençage ultra profond, qui n’est pas une solution économiquement viable pour les laboratoires préparant Hi-C bibliothèques régulièrement. Afin de contourner cette lacune, nous avons développé promoteur capturer CIH pour enrichir spécifiquement promoteur contenant des produits de ligature de bibliothèques Hi-C. Nous nous sommes concentrés sur les promoteurs pour deux raisons. Tout d’abord, contacts de promoteur-renforceur montrent très importante pour les niveaux d’expression de gène approprié dans de nombreuses études (voir références ci-dessus), et en second lieu, que les promoteurs sont en grande partie invariantes entre les types de cellules, le même système d’appât de capture peut servir à interroger les circuits réglementaires sur plusieurs types de cellules et conditions. Notre approche s’appuie sur l’hybridation solution de bibliothèques Hi-C avec des dizaines de milliers de 120mers biotinylé RNA complémentaires aux produits contenant du promoteur de la ligature de CIH et capture ultérieure sur streptavidine des billes magnétiques. Il en résulte dans les bibliothèques de DAPE-C avec beaucoup moins de complexité par rapport à la bibliothèque de CIH originale, en se concentrant uniquement sur l’identification de fragments qui sont ligaturées aux promoteurs à beaucoup de hautes fréquences.

Nous avons utilisé le PCHi-C dans un certain nombre de l’homme et les types de cellules de souris de contribuer à une meilleure compréhension du contrôle d’expression de gène de découvrir à longue distance distale interaction régions promotrices avec fonction réglementaire, ainsi que non aléatoire contacts de promoteur-promoteur dans l’espace en trois dimensions du noyau. Les études ont cartographié des centaines de milliers de contacts de promoteur-renforceur à travers de nombreuses cellules types33,34,35,36,37,38, 39, identifié Polycomb répressif complexe-mediated spatiale organisation du génome dans les cellules souches embryonnaires de souris7, a démontré un recâblage à grande échelle du promoteur interactomes au cours de la différenciation cellulaire37, 38 , 39et lié non codantes associés à la maladie de séquences variantes de gènes promoteurs35.

PCHi-C est une méthode idéale pour cartographier l’ensemble du génome de séquences d’ADN interagit avec les promoteurs. Approches connexes, tels que capturer Hi-C des régions génomiques discontinues (voir Discussion) sont la méthode de choix pour obtenir les profils d’interaction à haute résolution pour certaines régions génomiques. DAPE et capturer Hi-C sont extrêmement semblables d’un point de vue expérimental (la seule différence est le choix du système de capture), afin que les conseils et les directives que nous fournissons sont applicables à ces deux approches. Nous présentons ici une description détaillée du PCHi.-c. Nous exposer brièvement les raisons et la conception d’une expérience de DAPE-C, fournir un protocole étape par étape de la génération du bibliothèque DAPE-C et illustrer comment la qualité des bibliothèques DAPE-C peut être étudiée à différentes étapes du protocole pour obtenir des données de haute qualité.

Protocol

1. Fixation de formaldéhyde

  1. Préparation de cellules : commencer avec un minimum de 2 x 107 cellules par expérience.
    1. Pour les cellules en culture, remettre en suspension les cellules dans un milieu de culture. Pour ex vivo des cellules, resuspendre dans 1 x de Dulbecco modifié Eagle (DMEM), additionné de 10 % (vol/vol) sérum fœtal (SVF).
    2. Pour les cellules adhérentes, milieu de culture de supprimer et ajouter 30,625 mL de milieu frais avec 10 % (vol/vol) : FBS à température ambiante (20 à 25 ° C ; RT).
    3. Pour les cellules en suspension, recueillir et centrifuger les cellules à 400 x g et 20 ° C pendant 3 min. Enlever le surnageant et Resuspendre le culot dans 30,625 mL de milieu avec 10 % (vol/vol) FBS à température ambiante.
    4. Pour les tissus solides, utiliser la trypsine (concentration finale 0,05 % à 2,5 %, selon le type de cellule) ou dounce homogénéisation pour obtenir une suspension de cellules du même. Après cette étape supplémentaire, traiter les cellules comme les cellules en suspension.
  2. Ajouter 4,375 mL de paraformaldéhyde à méthanol-free 16 % (ampoule ouverte juste avant l’utilisation) à une concentration finale de 2 % (vol/vol). Difficulté pendant 10 min à RT avec un mélange doux sur un rocker.
    ATTENTION : Paraformaldéhyde est un produit chimique dangereux. Suivre les règlements de santé et de sécurité appropriées.
  3. Étancher la réaction en ajoutant 5 mL de fraîchement préparée 1 M glacee glycine. Mélanger pendant 5 min avec un balancement doux à ta et puis incuber sur glace pendant 15 minutes avec inversion occasionnels.
  4. Laver et prélever des cellules fixes.
    1. Pour les cellules adhérentes, éliminer le surnageant, ajouter 10 mL de glacée 1 x tampon au phosphate pH 7.4 sur le mur de la plaque et retirez-le. Ajouter 1 mL de glacé 1 x PBS, pH 7,4, prélever des cellules à l’aide d’un grattoir de cellules et les transférer dans un tube de 50 mL. Répétez l’opération deux fois pour prélever des cellules autant que possible. Additionner les PBS glacée au volume final de 50 mL.
    2. Pour les cellules en suspension, centrifugeuse cellules à 760 x g 4 ° C pendant 5 min, retirer le surnageant et Resuspendre le culot dans 50 mL de PBS glacé pH 7,4.
  5. Centrifuger les cellules à 400 x g et 4 ° C pendant 10 min et retirer délicatement le surnageant. Le culot cellulaire peut être snap congelés dans l’azote liquide et ensuite stockées à-80 ° C pendant plusieurs mois.

2. lyse cellulaire

  1. Une nouvelle suspension du culot dans 50 mL de tampon de lyse glacée fraîchement préparés (pH 10 mM Tris-HCl 8, 0,2 % (vol/vol) Igepal CA-630, 10 mM NaCl et inhibiteur de la protéase un comprimé cocktail) et mélanger. Incuber sur glace pendant 30 min, mélanger occasionnellement en inversant. Centrifuger les noyaux à 760 x g et 4 ° C pendant 5 min et éliminer le surnageant.

3. hindIII Digestion

  1. Laver les noyaux des cellules avec du tampon de restriction 1,25 x 2. Resuspendre le culot dans 1 mL de tampon de restriction glacee 1,25 x 2 et transvaser dans un tube de 1,5 mL. Faites tourner les noyaux à 760 x g et 4 ° C pendant 5 min et éliminer le surnageant.
  2. Resuspendre le culot dans 1790 µL de tampon de restriction 1,25 x 2. Faire 5 aliquotes, chacun contenant 5 millions de cellules en 358 µL de 1,25 x tampon restriction 2.
  3. Ajouter 11 µL de 10 % (wt/vol) SDS par aliquote et agiter à 950 tr / min (tr/min) pendant 30 min à 37 ° C dans un thermomixer. Si des amas de cellules apparaissent, se dissocient en pipettant également, en évitant les bulles.
  4. Ajouter 75 µL de 10 % Triton X-100 (vol/vol) par aliquote et agiter à 950 tr/mn et 37 ° C pendant 15 min dans un thermomixer. Si des amas de cellules apparaissent, se dissocient en pipettant également, en évitant les bulles.
  5. Ajouter 12 µL de 100 U/µL HindIII 100 (1 200 unités au total) par aliquote et incuber à 37 ° C pendant la nuit (O/N) et en agitant à 950 tr/min dans un thermomixer.
    1. Pour le contrôle de la digestion, 25 µL de l’échantillon (5 µL de chaque aliquote) dans un nouveau tube de transfert avant d’ajouter l’enzyme (contrôle non digéré) et répéter l’opération après l’ajout de l’enzyme (contrôle digéré). Incuber les tubes de la même manière que la bibliothèque de la CIH.
  6. Le lendemain matin, ajouter 5 µL de 100 U/µL HindIII (500 unités au total) par aliquote et incuber à 37 ° C pendant 2 h et en agitant à 950 tr/min dans un thermomixer.
  7. Contrôle de la digestion : pour les contrôles digérées et non digérés (voir 3.5.1), effectuer crosslink inversion (étape 6), extraction au phénol : chloroforme et précipitation de l’ADN (étape 7).
    1. Concevoir une paire d’amorces qui s’étendent sur un site de dIII Hin. Dans la même région, concevoir une autre paire d’amorces qui ne s’étendent sur un site de dIII Hin. Concevoir des amorces pour la PCR quantitative (Q-PCR) à l’aide de Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/) et les paramètres suivants :
      Taille d’apprêt : 20 optimale (min. : Max. 18 : 27) ; Apprêt Tm : 60 optimale (min. : 57, maxi : 63) ; Teneur en % amorce CG : min. : 20, Max. : 80 ; Taille de l’amplicon : RT-PCR ~ 100 bp (pour PCR classique ~ 300 bp) ; Mispriming bibliothèque : homme (amorces humaines) ou rongeur et simple (amorces de souris).
    2. Effectuer Q-PCR pour obtenir 4 Cts de moyenne (cycle seuil) : Ct [D ; H], obtenu à partir de l’échantillon digéré [D] avec la paire d’amorces qui s’étendent sur un site de dIII Hin[H] ; CT [D ;-], obtenu à partir de l’échantillon digéré [D] avec la paire d’amorces qui ne s’étendent sur un site de dIII Hin[-] ; CT [U ; H], obtenu à partir de l’échantillon non digéré [U] avec la paire d’amorces qui s’étendent sur un site de dIII Hin; CT [U ;-], obtenu à partir de l’échantillon non digéré [U] avec la paire d’amorces qui ne s’étendent sur un site de dIII Hin[-]. Calculer le pourcentage de la digestion comme : digestion % = 100/100-2(Ct[D,H]-Ct[D,-]) - (Ct[U,H]-Ct[U,-]).

4. Biotinylation des surplombs de Fragment de Restriction

  1. Préparer le mélange maître biotinylation : 30,6 µL de restriction mémoire tampon 2, 10,2 µL d’H2O 10 x (qualité biologie moléculaire), 7,65 µL de 10 mM dCTP, 7,65 µL de 10 mM dGTP, 7,65 µL de 10 mM dTTP, 191.25 µL de 0,4 mM biotine-14-dATP et 51 µL de 5 000 U/mL ADN polymérase j’ai () grand Fragment de Klenow).
  2. Ajouter 60 µL du mélange maître biotinylation par aliquote, mix et incuber à 37 ° C pendant 1 h, secouant à 700 tr/min (thermomixer) pendant 5 s, toutes les 30 s. Après 1 h, placer les aliquotes sur la glace.

5. en-noyau ligature

  1. Préparer le mélange maître de ligature : 510 µL de 10 x tampon de T4 DNA ligase, 51 µL de 10 mg/mL d’albumine sérique Bovine (BSA x 100), 1754.4 µL d’eau (qualité biologie moléculaire) et 127,5 µL de 1 U/µL T4 DNA ligase (voir Table des matières).
  2. Ajouter 479 µL du mélange maître ligature par mélange aliquote et incuber à 16 ° C pendant 4 h, secouant à 700 tr/min pendant 5 s toutes les 2 min dans un thermomixer.
  3. Incuber 30 min à température ambiante.

6. Crosslink inversion

  1. Combiner tous les aliquotes dans un tube à centrifuger 50 mL (convient pour la centrifugation à grande vitesse).
  2. Ajouter 62,5 µL de 10 mg/mL RNase A, mix et incuber 30 min à 37 ° C.
  3. Ajouter 300 µL de 10 mg/mL de protéinase K, mélanger et laisser incuber 30 min à 37 ° C.
  4. Incuber les réaction O/N (ou au moins 4 h) à 65 ° C. Le lendemain matin, ajouter 300 µL de 10 mg/mL protéinase K, mélanger et laisser incuber 1 h à 65 ° C.

7. Purification d’ADN

  1. Ajouter 4337.5 µL de tampon TLE (10 mM Tris-HCl pH 8.0 ; 0,1 mM EDTA pH 8.0) et mélanger.
  2. Ajouter 1 volume (10 mL) phénol le pH 8,0, Vortexer pendant 10 s et centrifuger à RT et 20 000 x g pendant 3 min. transférer 9 mL de la phase supérieure (aqueuse) dans un nouveau tube de 50 mL.
    ATTENTION : Le phénol est un produit chimique dangereux. Suivre les règlements de santé et de sécurité appropriées.
  3. Ajouter 2 mL de tampon TLE à la phase aqueuse restante, vortex pour 2,5 mL de la phase aqueuse dans le nouveau tube de transfert de 10 s et centrifuger à RT et 20 000 x g pendant 3 min. d’après l’étape 7.2, rendant le volume final 11,5 mL. Jeter le tube contenant la phase inférieure (organique).
  4. Ajouter 1 volume (11,5 mL) de phénol : chloroforme : isoamylique alcool (25:24:1), Vortexer pendant 10 s et centrifuger à RT et 20 000 x g pendant 3 min. transfert 11 mL de la phase supérieure (aqueuse) dans un nouveau tube de 50 mL. Répétez l’étape 7.3. Le volume de l’échantillon total sera désormais 13,5 mL.
  5. Ajouter 1,35 mL de 3M sodium acétate pH 5,2 et 33,75 mL d’éthanol à 100 % glace froide, mix et incuber à-80 ° C pendant 45 min ou alternativement pendant la nuit à-20 ° C.
  6. Centrifuger à 4 ° C et 20 000 x g pendant 10 min, retirer le surnageant, resuspendre le culot dans 1 mL d’éthanol (vol/vol) à 70 % fraîchement préparés et transférer dans un nouveau tube.
  7. Centrifuger à 4 ° C et à pleine vitesse pendant 3 min dans une centrifugeuse de paillasse, puis enlever le surnageant.
  8. Resuspendre le culot dans 1 mL d’éthanol de glace froid 70 % (vol/vol) et répétez l’étape 7,7. Sécher le culot à 37 ° C pendant 10 min et remettre en suspension dans 650 µL de tampon de la TLE. Déterminer le rendement d’ADN en utilisant un test d’amplification fluorescence pour quantifier l’ADN bicaténaire.
    Remarque : Le protocole peut être suspendu ici par le composant logiciel enfichable de congélation et stockage de l’échantillon à-80 ° C pendant plusieurs mois, ou à-20 ° C pendant une courte période de temps.

8. les contrôles de qualité

  1. Surveiller l’intégrité de la bibliothèque et la ligature par électrophorèse de l’ADN. Courir 200 ng de bibliothèque sur un gel de x TBE 0,8 % d’agarose/1. L’ADN doit s’exécuter comme un groupe de plus de 10 Ko.
  2. Détecter le type cellulaire connu invariant courte et longue portée des interactions par PCR classique. Utilisez 100 ng de modèle ADN par réaction PCR. Concevoir les amorces PCR proches et vers les sites de restriction suivant les instructions ci-dessus (voir 3.7.1). Séquences d’amorces pour le contrôle de la qualité des souris et des bibliothèques de CIH humaines sont énumérés au tableau 1.
  3. Contrôle de remplir et de ligature : découper les bandes de gel contenant les amplicons de contrôler 8.2, gel-extrait l’ADN et l’ADN servira de modèle pour 4 réactions individuelles de PCR avec des amorces identiques.
    1. Purifier les amplicons à l’aide d’un kit de purification de PCR et quantifier la concentration d’ADN.
    2. Préparer quatre réactions de digestion (HindIII [un], NheI [b], HindIII + NheI [c] et aucune enzyme [d]) pour chaque amplicon dans un volume final de 15 µL : 500 ng d’amplicon, 1,5 µL de 10 x tampon restriction 2.1, 0,15 µL de 10 mg/mL d’albumine sérique Bovine (BSA x 100) et 0.1 µL (10 unités) de l’enzyme (HindIII [un], NheI [b], HindIII + NheI [c] ou l’eau [d]).
    3. Digérer pendant 1 h à 37 ° C, puis exécutez les réactions de digestion sur un gel de x TBE d’agarose/1 1,5 % (wt/vol).

9. Fragmentation de l’ADN

  1. Transfert 50,5 µg d’échantillon dans un tube à nouveau et ajouter tampon TLE pour un volume final de 655 µL. échantillon de fractionné dans 5 fioles de sonication (voir Table des matières) en ajoutant 130 µL de bibliothèque (10 µg) de chaque flacon. Cisaille à une taille de ~ 400 bp dans un ultra-sonicateur (voir Table des matières) en utilisant les paramètres suivants : facteur d’utilisation : 10 % ; puissance incidente de crête (w) : 140 ; cycles / rafale : 200 ; temps : 55 s.
  2. Prélever un échantillon aux ultrasons dans un tube frais 2 mL.

10. sélection de la taille recto-verso SPRI-perle

  1. Solution de perles Mix SPRI (Solid Phase réversible immobilisation) bien en inversant, 1,85 mL de solution de perle de transfert dans un nouveau tube et porter à RT pendant 15 min.
  2. Ajouter 350 µL d’eau (qualité biologie moléculaire) dans l’échantillon (volume final 1 mL).
  3. Ajouter 600 µL de solution de perle SPRI à l’échantillon (volume total 1,6 mL ; rapport de solution SPRI à l’ADN : 0,6 à 1), incuber pendant 5 min à RT et essorer sample dans une centrifugeuse de paillasse pour 2 – 3 s recueillir l’échantillon.
  4. Ouvrez le couvercle, placez l’échantillon sur le support de séparation magnétique pendant 5 min, transfert clair surnageant dans un nouveau tube et jeter des perles.
  5. Concentrer les perles SPRI pour la seconde étape de sélection de taille : 930 transférer µL de SPRI Perles dans un nouveau tube, placer sur le support de séparation magnétique pendant 5 min et jeter le surnageant clair. Remettre en suspension les perles dans 310 µL de solution de perle de SPIR.
  6. Ajouter 300 µL de concentré perles SPRI (étape 10,5) dans l’échantillon (volume total 1,9 mL ; ratio SPRI solution d’ADN est maintenant de 0,9 à 1), incuber 5 min à RT et essorage goûter dans une centrifugeuse de paillasse pour 2 – 3 s. Ouvrez le couvercle , placer le tube sur le stand de séparation magnétique pendant 5 min et jeter le surnageant.
  7. Ajouter 1 mL d’éthanol à 70 % (vol/vol) fraîchement préparés dans le tube d’échantillon sur le stand de séparation magnétique, incuber pendant 30 s, puis le surnageant de défausse. Répéter deux fois.
  8. Perles de secs à 37 ° C dans un thermomixer (couvercle de tube ouvert) pour pas plus de 5 min. Ajouter 300 µL de tampon TLE à l’échantillon, mélanger et incuber pendant 10 min à température ambiante.
  9. Essorer sample dans une centrifugeuse de paillasse pour 2 – 3 s, ouvrez le couvercle et le tube sur la séparation magnétique reposer pendant 5 min. transfert clair surnageant dans un nouveau tube et jeter des perles.

11. biotine/Streptavidin-siphonnage de ligature produits

  1. Préparer des tampons : 1 x tampon de TB (5 millimètres Tris-HCl pH 8.0 ; 0,5 mM EDTA ; 1 M NaCl, 0,05 % Tween 20) ; 2 x tampon NTB (10 mM Tris-HCl pH 8,0 ; 1 mM EDTA 2 M NaCl) ; 1 x NTB solution tampon (pH 5 mM Tris-HCl 8.0 ; 0,5 mM EDTA 1 M NaCl).
  2. Ajouter 200 µL de billes magnétiques de streptavidine couplé (voir Table des matières) dans un nouveau tube, placez-le sur le support de séparation magnétique pendant 1 min et éliminer le surnageant.
  3. Laver les perles deux fois avec 500 µL de tampon de TB 1 x.
    1. Pour chaque étape de lavage pendant la biotine déroulants, réparation fin et l’enlèvement de biotine non ligaturé les extrémités de l’ADN, résidus de dATP et étapes de ligature adaptateur, remettre en suspension les perles dans le tampon correspondant, tournent à la RT et 15 t/min pendant 3 min, faire tourner le tube dans une centrifugeuse de paillasse pour 2-3 s, placer le tube sur le stand de séparation magnétique pendant 3 min et éliminer le surnageant.
  4. Une nouvelle suspension perles dans 300 µL de tampon de x NTB 2. Mélange de perles et échantillon (volume total de 600 µL) et incuber à RT pendant 15 min sur une roue rotative à 3 t/mn.
  5. Récupérer les perles sur le support de séparation magnétique pendant 3 min et retirez le surnageant clair. Laver les perles deux fois en 500 µL de tampon de x NTB 1 premier puis dans 200 µL de tampon de ligature 1 x. Remettre en suspension les perles dans 50 µL de tampon de ligature x 10.

12. terminer la réparation et l’enlèvement de la biotine aux extrémités de l’ADN Non ligaturé

  1. Mélanger l’échantillon (50 µL au total) avec 50 µL de 2,5 mM dNTP mix (12,5 µL de 10 mM de chaque dNTP), 18,1 µL de 3 000 U/mL T4 ADN-polymérase, 18,1 µL de 10 000 U/mL T4 PNK, 3,7 µL de 5 000 U/mL ADN polymérase I grand (Klenow) fragment et 360.1 µL d’H2O.
  2. Mélanger et laisser incuber à 20 ° C pendant 1 h, secouant 5 s à 700 tr/min toutes les 2 min dans un thermomixer.
  3. Récupérer les perles sur le stand de séparation magnétique, retirez le surnageant clair et perles de lavage deux fois en 500 µL de 1 x tampon de TB.
  4. Laver les perles dans 500 µL de tampon de x NTB 1, suivie d’un lavage dans 500 µL de 1 x TLE.
  5. Récupérer les perles sur le stand de séparation magnétique, retirer le liquide clair surnageant et remettre en suspension perles en 415 µL de tampon de x TLE 1.

13. dATP équeutage

  1. Allient échantillon (415 µL) 50 µL de restriction mémoire tampon 2, 5 µL de dATP 10 mM et 30 µL 5 U/µL Klenow exo-minus 10 x.
  2. Mélanger et laisser incuber à 37 ° C pendant 30 min, secouant 5 s à 700 tr/min toutes les 2 min dans un thermomixer.
  3. Récupérer les perles sur le stand de séparation magnétique, retirez le surnageant clair et perles de lavage deux fois en 500 µL de 1 x tampon de TB.
  4. Laver les perles dans 500 µL de tampon de x NTB 1.

14. adaptateur ligature

  1. Laver les perles dans 200 µL de 1 x tampon de réaction de ligature (voir Table des matières).
  2. Une nouvelle suspension perles dans 200 µL de tampon de réaction 1 x ligature. Ajouter 4 µL de DNA ligase (voir Table des matières) et 16 µL de 15 µM recuit des adaptateurs de PE (pré recuire les adaptateurs PE en mélangeant des volumes égaux de PE 1 et PE, carte 2 (tous deux à 30 µM) et en incubant pendant quelques minutes à ta). Incuber à RT pendant 15 min.
  3. Récupérer les perles sur le stand de séparation magnétique, retirez le surnageant clair et perles de lavage deux fois en 500 µL de 1 x tampon de TB.
  4. Laver les perles dans 500 µL de tampon de x NTB 1. Puis, laver des perles dans 100 µL de 1 x tampon de restriction 2, remettre en suspension dans 50 µL de 1 x tampon de restriction 2 perles et transférer dans un nouveau tube.

15. Salut-C Bibliothèque Amplification

  1. Préparer le mélange maître PCR : 100 µL de tampon de x Phusion 5 ; 6 µL d’amorces de PCR PE 25 µM 1.0 ; 6 µL d’amorces de PCR PE 25 µM 2.0 ; 14 µL du mélange dNTP (10 mM chacun) ; 6 µL de Phusion polymérase ; 318 µL d’H2O.
  2. Mix master Mix PCR avec les perles (500 µL au total), le diviser en 10 parties aliquotes de 50 µL et amplification par PCR en utilisant les conditions suivantes :
    30 s à 98 ° C
    7 cycles de : 10 s à 98 ° C ; 30 s à 65 ° C ; 30 s à 72 ° C
    7 min à 72 ° C
  3. Recueillir les réactions de PCR dans un nouveau tube, un récupérateur de perles sur le stand de séparation magnétique et transfert surnageante (500 µL) dans un nouveau tube.
  4. Purifier l’ADN de bibliothèque à l’aide de perles de SPIR.
    1. Perles Mix SPRI, transférer 460 µL de perles dans un nouveau tube et porter à RT pour 15 min. ajouter 450 µL de billes SPRI pour les réactions de PCR (volume final 950 µL), incuber pendant 5 min à RT et essorer sample dans une centrifugeuse de paillasse pour 2 – 3 s recueillir l’échantillon.
    2. Ouvrez le couvercle, placez l’échantillon sur le support de séparation magnétique pendant 5 min et éliminer le surnageant.
    3. Garder les perles sur le stand de séparation magnétique, ajouter 1 mL d’éthanol à 70 % (vol/vol) à échantillon tube au-dessus d’une zone claire de perles, laisser pendant 30 s, puis le surnageant de défausse.
    4. Répétez l’étape 15.4.3 deux fois plus.
    5. Sécher les perles à 37 ° C dans un thermomixer (couvercle de tube ouvert) pendant pas plus de 5 min.
    6. Ajouter 51 µL de tampon de la TLE dans l’échantillon, mix et incuber pendant 10 min à 37 ° C, secouant à 950 tr/min dans un thermomixer.
    7. Essorer sample dans une centrifugeuse de paillasse pour 2 – 3 s, ouvrez le couvercle et le tube sur la séparation magnétique reposer pendant 5 min. transfert clair surnageant dans un nouveau tube et jeter des perles.
    8. Quantifier la concentration de la bibliothèque de la CIH. Après 7 tours d’amplification PCR, nous obtenons régulièrement 500 – 1 500 ng de bibliothèque Hi-C.

16. Capture solution hybride

NOTE : Bloqueur et tampon (SHS1-4) solutions ci-dessous proviennent de la SureSelect nécessaire (voir la Table des matières).

  1. Transfert 500 ng à 1 µg de CIH bibliothèque dans un nouveau tube et évaporer l’échantillon sur un concentrateur de vide (voir la Table des matières, 45 ° C, pression de vide : niveau 30,0, rampe 5) jusqu’au sec.
  2. Remettre en suspension évaporés CIH bibliothèque en ajoutant 3,6 µL d’H2O (qualité biologie moléculaire), 2,5 µL de bloqueur 1, 2,5 µL de bloqueur 2 et 0,6 µL de dresseur personnalisé.
  3. Transférer l’échantillon dans un puits d’une nouvelle bande de tube PCR, fermer avec une bande de cap PCR et placez sur la glace. Label « D » (pour l’ADN de Salut-C).
  4. Préparer le tampon d’hybridation : 12,5 µL de tampon de SHS1 ; 0,5 µL de tampon de SHS2 ; 5 µL de tampon de SHS3 ; 6.5 µL de tampon de SHS4.
  5. Incuber à 65 ° C pendant 5 min dans un thermomixer. Transvaser dans un puits d’une nouvelle bande de tube PCR, fermer avec une bande de cap PCR et maintenir au Label RT. comme « H » (pour le tampon d’hybridation).
  6. Dans un puits d’une nouvelle bande de tube PCR, mélanger 5 µL de 100 ng/µL biotinylé sondes d’ARN (magasin à-80 ° C et décongélation sur la glace juste avant l’utilisation) ; 0,5 µL de B SRNase (inhibiteur de RNase) et 1,5 µL d’H2O (qualité biologie moléculaire).
  7. Fermer la bande de tube PCR avec une bande de cap PCR et placez sur la glace. Étiquette en tant que « R » (RNA).
  8. Mettre en place la machine PCR en utilisant les paramètres suivants :
    5 min à 95 ° C ; 25 h à 65 ° C ; couvercle chauffé ; Volume 29 µL PCR réaction.
    Remarque : Passez aussi rapidement que possible au cours de toutes les procédures pendant que la machine PCR fonctionne afin d’éviter l’évaporation de l’échantillon.
  9. Placez la bande de tube PCR « D » dans la machine PCR, fermer le couvercle de machine PCR et commencer la réaction PCR. Lorsque le programme PCR atteint 65 ° C, ouvrez le couvercle de machine PCR et placez une bande de tube de PCR « H » dans la machine PCR. Fermer le couvercle de machine PCR et incuber pendant 3 min. ouvrir le couvercle de machine PCR, place le tube PCR « R » bande sur la machine PCR et fermer la machine PCR.
  10. Après 2 min, ouvrez le couvercle de machine PCR et toutes les bandes de tubes PCR. Transférer 13 µL de bien « H » en bien « R », puis tout le volume de bien « D » en bien « R ». Pipette et descendre 3 fois pour mélanger la réaction, fermez la bande de tube PCR, supprimer le « H » et « D » PCR tube de bandelettes et fermer le couvercle machine PCR. Incubez la réaction à 65 ° C pendant 24 h.

17. isolement promoteur Fragment contenant des produits de ligature

Remarque : Les étapes suivantes sont recommandées à faire avec le kit d’adaptateur de SureSelect et de la bibliothèque (voir le Tableau des matériaux).

  1. Réchauffez 1,5 mL de tampon de lavage 2 par échantillon à 65 ° C à l’avance.
  2. Ajouter 60 µL de streptavidine couplé des billes magnétiques (voir Table des matières) dans un nouveau tube, placer sur le support de séparation magnétique pendant 1 min et éliminer le surnageant.
  3. Laver les perles trois fois avec 200 µL de 1 x tampon de liaison.
    Remarque : Pour chaque étape de lavage pendant l’isolement après capture de produits contenant du promoteur de la ligature, nouvelle suspension perles dans le tampon correspondant, tourner pendant 3 min à ta et 15 tr/min sur une roue en rotation, tourner doucement le tube dans une centrifugeuse de paillasse pour 2-3 s de recueillir exemple, place le tube sur la séparation magnétique reposer pendant 3 min, puis enlever le surnageant.
  4. Une nouvelle suspension perles dans 200 µL de 1 x tampon de liaison. Ouvrir la machine PCR et dans la bande de tube PCR (alors que le programme PCR est encore en cours d’exécution) et transférer la réaction d’hybridation dans le tube avec les billes magnétiques. Incuber à RT pendant 30 min sur une roue rotative à 3 t/mn.
  5. Récupérer les perles sur le stand de séparation magnétique et éliminer le surnageant clair. Remettre en suspension dans 500 µL de tampon de lavage 1, mix, perles et incuber pendant 15 min à 20 ° C en agitant à 950 tr/min dans un thermomixer.
  6. Récupérer les perles sur le support de séparation magnétique pendant 3 min et retirez le surnageant clair. Remettre en suspension dans 500 µL de tampon de lavage 2 perles, mélanger et incuber 10 min à 65 ° C en agitant à 950 tr/min dans un thermomixer. Répétez l’étape deux fois plus de 17,5.
  7. Récupérer les perles sur le stand de séparation magnétique, retirez le surnageant clair et une nouvelle suspension perles dans 200 µL de 1 x tampon de restriction 2. Récupérer les perles sur le stand de séparation magnétique, éliminer le surnageant et remettre en suspension perles dans 30 µL de 1 x tampon de restriction 2.

18. DAPE-C Bibliothèque Amplification

  1. Préparer le mélange maître PCR : 60 µL de tampon de x PCR 5 (Phusion tampon), 3,6 µL d’amorce de 25 PE PCR de µM 1.0, 3,6 µL d’amorce de 25 PE PCR de µM 2.0, 8,4 µL du mélange dNTP (10 mM), 3,6 µL de Phusion polymérase et 190,8 µL d’H2O.
  2. Mix master Mix PCR avec les perles (300 µL au total), diviser en 6 parties aliquotes de 50 µL et PCR-amplifier en utilisant les conditions suivantes :
    30 s à 98 ° C
    4 cycles de : 10 s à 98 ° C, 30 s à 65 ° C, 30 s à 72 ° C
    7 min à 72 ° C
  3. Collecter toutes les réactions de PCR dans un nouveau tube, récupérer les perles sur l’aimant et transférer le surnageant (300 µL ; contient la bibliothèque DAPE-C) dans un nouveau tube.
  4. Purifier la bibliothèque DAPE-C avec perles SPRI, suivant les étapes décrites ci-dessus moins 15,4.
  5. Quantifier la concentration de la bibliothèque de DAPE-C.

Representative Results

Promoteur de Capture Hi-C a été utilisé pour enrichir les souris7,34,36,39 et humaines33,35,37,38 CIH bibliothèques pour interactions du promoteur. Un protocole similaire (nommé HiCap) a été décrit par le groupe de Sandberg40. Figure 1 a montre le flux de travail schématique pour promoteur Capture Hi-C. Dans le protocole décrit ici, CIH bibliothèques sont générés à l’aide de ligature à noyau41, qui se traduit par un nombre considérablement réduit de ligature des faux produits42. Pour DAPE-C, souris très complexe ou humaine CIH bibliothèques sont soumis à l’hybridation in-solution et capturent à l’aide de 39 021 biotinylé ARN complémentaire à 22 225 souris contenant du promoteur HindIII des fragments de restriction, ou 37 608 biotinylé RNAs cible 22 076 humain contenant du promoteur HindIII des fragments de restriction, respectivement. Promoteur contenant des fragments de restriction peut être ciblée aux deux extrémités par individuel biotinylé RNAs (Figure 1 b). Nous avons trouvé que la capture des deux finit amélioration de la couverture des promoteurs individuels (Figure 1, séquence brute lectures) presque double, comme prévu. Ainsi, chaque fois que possible (c.-à-d., dans des régions non répétitive), nous conseillons d’utiliser biotinylé ARN complémentaire aux deux extrémités d’un fragment de restriction à capturer.

Afin d’évaluer la qualité bibliothèque DAPE-C à un stade précoce au cours de la préparation de la bibliothèque, nous réalisons deux contrôles après ligature d’ADN et de purification, comme décrit précédemment31. La première consiste à utiliser des paires d’amorces spécifiques pour amplifier les produits ligature comme 3C27. Nous utilisons des paires d’amorces (tableau 1) afin d’amplifier les produits invariant ligature à longue portée de type cellulaire, tel qu’entre le gène Myc et ses amplificateurs connus situé environ 2 Mo (Figure 2 a) ou entre les gènes de la Hist1 locus ( séparés par 1. 5 Mb), ainsi qu’entre les deux régions situées à proximité de linéaire (« contrôle à courte portée »).

Le deuxième contrôle qualité est effectué pour déterminer l’efficacité d’incorporation de la biotine au cours de la médiation Klenow remplir des surplombs de site de restriction avec biotine-dATP. Remplir de Klenow réussie et de résultats ultérieurs ligature d’émoussé-fin dans la disparition du site original de restriction entre les molécules d’ADN d’un produit de la ligature et dans le cas de HindIII dans la formation d’un nouveau site de reconnaissance de NheI (Figure 2 b ). Le rapport entre le HindIII produit digéré la ligature NheI est une lecture directe de l’efficacité de l’incorporation de biotine. Une bibliothèque de CIH de mauvaise qualité va montrer un haut niveau de la digestion HindIII, tandis que les bibliothèques de haute qualité ayant quasi-complète NheI digestion des produits de ligature (Figure 2 b).

Après préparation de bibliothèque CIH (c.-à-d. après streptavidine-biotine tirer vers le bas de taille-sélectionné des produits de ligature CIH, ligation de l’adaptateur et PCR pré-saisie), la distribution de l’intégrité et la taille de la bibliothèque de la CIH est évaluée par le Bioanalyzer (Figure 2 C). le même contrôle est effectué à la fin de la préparation de bibliothèque DAPE-C (c.-à-d., après la capture de l’hybridation des produits contenant du promoteur de la ligature et post-capture PCR). Comparaison des profils Hi-C et C-PCHi Bioanalyzer montre que comme prévu, CIH bibliothèques sont beaucoup plus concentrés que les bibliothèques correspondantes de DAPE-C, mais la distribution de la taille des bibliothèques est très similaire, ce qui indique que la capture pas dans PCHi-C n’introduit un biais de taille (Figure 2, D).

Après le séquençage jumelé-fin, les lectures de DAPE-C sont mappés, qualité contrôlée et filtrée à l’aide du pipeline de HiCUP43. Haute qualité DAPE-C bibliothèques contiennent entre 70 et 90 % « paires valide » (c.-à-d. les séquence jumelé-fin lit entre deux fragments de restriction qui ne sont pas des voisins sur le plan génomique linéaire ; Figure 3 a, B). À l’aide de la ligature dans le noyau protocole41,42, le pourcentage de trans lire paires (c.-à-d. les séquence jumelé-fin lit entre deux fragments de restriction qui sont situés sur des chromosomes différents) sont généralement faibles, entre 5 et 25 %, ce qui reflète l’existence de territoires chromosomiques et indiquant la qualité bonne bibliothèque. Une comparaison directe du pourcentage de « paires valides » entre les bibliothèques de la CIH et leurs correspondants de bibliothèques DAPE-C35, montre que, dans tous les cas, le pourcentage de couples valides est plus élevé dans les bibliothèques de DAPE-C (Figure 3 b). Cela s’accompagne d’une réduction du pourcentage de non valide « même fragment interne » lectures en DAPE-C (Figure 3). C’est prévu, car l’étape de capture non seulement enrichit des produits contenant du promoteur de la ligature, mais également à des fins de fragment de restriction, en raison de la position de l’oligos de capture sur la restriction des fragments (voir Figure 1 b).

Après HiCUP de filtrage, nous déterminons l’efficacité de captage. PCHi-C bibliothèques contiennent trois types de séquence valide lectures après filtrage de HiCUP :
1.) promoteur : génome lit (c.-à-d., les lectures entre un fragment de promoteur capturés et un fragment de restriction HindIII non-promoteur n’importe où dans le génome)
2.) promoteur : promoteur lit (lit entre deux fragments de promoteur capturé)
3.) génome : génome lit (produits de ligature de fond Hi-C où ni les partenaires de produit ligature mappe à un promoteur capturé). Ceux-ci sont éliminés avant les analyses en aval.

Bibliothèques de DAPE-C de haute qualité, les coûts de capture (somme des catégories 1 et 2 ci-dessus) entre 65 et 90 % (Figure 3D) sont. Une comparaison directe de bibliothèques Hi-C montre que DAPE-C se traduit par un ~ 15 fois enrichissement promoteur ligature des produits contenant des (Figure 3D), dans certains cas 17 fois. C’est proche du maximum hypothétique (19.6-fold) enrichissement pour DAPE-C, qui dépend de la proportion du génome des fragments de restriction couverts par le système de capture. Plus grand enrichissement est possible grâce à la conception des systèmes de capture ciblant moins restriction fragments44,45,46.

Analyse du promoteur interactomes montre cellule type et lignée-spécificité33,34,35, avec des changements importants au cours de la différenciation cellulaire37,38,39 . Figures 4 et 5 donnent des exemples de lignée spécificité et différenciation dynamique aux promoteurs spécifiques. Par exemple, ALAD est exprimée constitutivement dans toutes les cellules, mais son expression est augmentée dans les érythroblastes47. Le promoteur de l’ALAD entre en contact avec plusieurs fragments distales dans toutes les cellules hématopoïétiques et s’engage dans des interactions supplémentaires spécifiquement dans les érythroblastes (Figure 4). IL-8 ne montre aucune interaction significative dans les cellules de B, très peu d’interactions dans les lymphocytes T, mais des dizaines d’interactions dans les cellules de la lignée myéloïde, incluant des interactions spécifiques de type cellulaire dans les monocytes, les neutrophiles et les mégacaryocytes ( La figure 5). Ces exemples montrent comment DAPE-C peut être utilisé pour démêler le type cellulaire spécifique interactomes et identifier les régions promoteur interagissant avec potentiel réglementaire.

Figure 1
Figure 1 : Conception d’appâts promoteur Capture Hi-C justification et capture. (A) les flux de travail schématique du PCHi.-c. Dans le noyau ligature Hi-C41,42 (I) est suivie-solution hybridation avec les amorces biotinylées RNA (II) ciblant les fragments de restriction de tout humain (représenté ici) ou de promoteurs de gènes (III) de la souris. (B) Bait conception de DAPE.-c. Appâts de capture biotinylé RNA (courbes rouges) sont conçus contre les extrémités du promoteur contenant des fragments de restriction (gris ; note que les séquences promotrices eux-mêmes (rouge) s’adressent uniquement par les appâts de capture de RNA si elles sont situées à restriction extrémités de fragment). Ligature des produits consistant en promoteur contenant des fragments de restriction (gris) et leurs interaction des fragments de restriction (jaune et vert) sont isolés grâce à l’hybridation de la séquence-complémentarité entre appât RNA et cible de l’ADN et les suivantes streptavidine-biotine pulldown, comme le montre l’efficacité de captage a (C) Comparaison de DAPE-C pour promoteur contenant des fragments de restriction ciblée par un RNA appât capture sonde vs deux sondes de capture d’appâts d’ARN (voir schéma b). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : Contrôles de qualité avant séquençage DAPE-C. (A) à gauche, schéma de juxtaposition spatiale entre le promoteur et PIR, aboutissant à un produit de ligature de CIH consistant en un fragment de restriction contenant du promoteur (gris ; séquence promotrice en rouge) et un fragment de restriction PIR (jaune). Droit, ADN gel d’électrophorèse montrant des exemples de produits de ligature de CIH amplifiés à l’aide de paires d’amorces spécifiques (comme décrit dans le schéma à gauche). (B) à gauche, des exemples représentatifs de restriction HindIII, NheI et HindIII/NheI digère de CIH ligature (produits PCR montré à A). À droite, schéma de l’ADN de séquence après ligature de CIH après échec (en haut) ou réussie (en bas) dNTP Klenow compléter des jonctions de restriction et de ligature subséquente. Profil de bioanalyzer (C) représentant le CIH bibliothèque (dilution au 1/5). Profil de bioanalyzer (D) représentant DAPE-C Bibliothèque (sans dilution). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : Contrôles de qualité pour le séquençage après DAPE-C. (A) comparaison du pourcentage séquence valide lire paires après HiCUP43 traitement DAPE-C vs correspondant bibliothèques CIH (données de Javierre et coll., 201635). (B) représentant HiCUP DAPE-C résultat montrant valide lire couples et autres catégories de séquence qui sont mis au rebut avant les analyses en aval (données de Javierre et coll., 201635). (C) comparaison du pourcentage « même fragment interne » lit après HiCUP traitement DAPE-C vs correspondant bibliothèques CIH (données de Javierre et coll., 201635). (D) Comparaison de séquence pourcentage lit impliquant des fragments promoteur appâtés (efficacité de captage) DAPE-C vs correspondant bibliothèques CIH (données de Javierre et coll., 201635). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4: ALAD Profil DAPE-C dans les cellules hématopoïétiques humaines. Interactions de promoteur des types de cellules myéloïdes sont affichées sous forme d’arcs bleus et interactions de promoteur des types de cellules lymphoïdes sont affichées sous forme d’arcs pourpres. Des interactions érythroblaste spécifiques sont indiquées par des flèches rouges (données de Javierre et coll., 201635). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 5
Figure 5 : IL8 Profil de DAPE-C dans les cellules hématopoïétiques humaines. Interactions de promoteur des types de cellules myéloïdes sont affichées sous forme d’arcs bleus et interactions de promoteur des types de cellules lymphoïdes sont affichées sous forme d’arcs pourpres. Les interactions monocyte-spécifiques sont indiquées par des flèches vertes, interactions neutrophile spécifiques sont indiquées par des flèches rouges et une interaction mégacaryocyte spécifique est indiquée par une flèche marron (données de Javierre et coll., 201635). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Humaine
Nom Séquence Chromosome Strand Début GRCh38/hg38 Fin GRCh38/hg38 Combinaisons d’amorces pour tester les interactions 3C et l’incorporation de la biotine
HS AHF64 Dekker GCATGCATTAGCCTCTGCTGTTCTCTGAAATC 11 + 116803960 116803991 utiliser en combinaison avec hs AHF66 Dekker
HS AHF66 Dekker CTGTCCAAGTACATTCCTGTTCACAAACCC 11 + 116810219 116810248 utiliser en combinaison avec hs AHF64 Dekker
locus MYC HS GGAGAACCGGTAATGGCAAA 8 - 127733814 127733833 utiliser en combinaison avec hs MYC + 1820 ou hs MYC-538
HS MYC + 1820 AAAATGCCCATTTCCTTCTCC 8 + 129554527 129554547 utiliser en combinaison avec le locus MYC hs
HS MYC-538 TGCCTGATGGATAGTGCTTTC 8 - 127195696 127195716 utiliser en combinaison avec le locus MYC hs
HS HIST1 F AAGCAGGAAAAGGCATAGCA 6 + 26207174 26207193 utiliser en combinaison avec hs HIST1 R
HS HIST1 R TCTTGGGTTGTGGGACTTTC 6 + 27771575 27771594 utiliser en combinaison avec hs HIST1 F
Souris
Séquence Chromosome Strand Début GRCm38/mm10 Fin GRCm38/mm10 Combinaisons d’amorces pour tester les interactions 3C et l’incorporation de la biotine
TCATGAGTTCCCCACATCTTTG 8 + 84841090 84841111 utiliser en association avec mm Calr2
CTGTGGGCACCAGATGTGTAAAT 8 + 84848519 84848541 utiliser en association avec mm Calr1
TATCAAGGGTGCCCGTCACCTTCAGC 6 + 125163098 125163123 utiliser en combinaison avec Gapdh4 Dekker
GGGCTTTTATAGCACGGTTATAAAGT 6 + 125163774 125163799 utiliser en combinaison avec Gapdh3 Dekker
GGAGGAGGGAAAAGGAGTGATT 6 + 52212829 52212850 utiliser en association avec mm Hoxa13
CAGGCATTATTTGCTGAGAACG 6 - 52253490 52253511 utiliser en association avec mm Hoxa7
GGGTAATGGTGTCACTAACTGG 13 + 23571284 23571305 utiliser en combinaison avec Hist1h3e ou mm Hist1h4i
GGGTTTGATGAGTTGGTGAAG 13 + 23566541 23566561 utiliser en association avec mm Hist1h2ae
TTGGGCCAAAGCCTATATGA 13 + 22043085 22043104 utiliser en association avec mm Hist1h2ae

Tableau 1 : Séquences d’amorces pour le contrôle de la qualité d’être humain et les bibliothèques de souris Hi-C.

Discussion

Conception modulaire du promoteur Capture Hi-C

Promoteur de Capture Hi-C est conçu pour enrichir spécifiquement CIH bibliothèques pour les interactions impliquant des promoteurs. Ces interactions constituent uniquement un sous-ensemble des produits de ligature présents dans une bibliothèque de CIH.

Capture Hi-C peut facilement être modifié pour enrichir les bibliothèques Hi-C pour chaque région génomique ou les régions d’intérêt en changeant le système de capture. Régions de capture peuvent être continu segments génomiques44,45,46,48, rehausseurs qui ont été identifiés à DAPE-C ("inverser la Capture Hi-C"35) ou DNase I sites hypersensibles49 . La taille du système de capture peut être ajustée selon la portée expérimentale. Par exemple, Dryden et al. cibler les 519 fragments d’appât dans trois déserts de gènes associés à breast cancer44. Le système de piégeage par Martin et al. cible les deux segments génomiques continues (« Région de Capture » : 211 régions génomiques au total ; 2 131 fragments de restriction) et sélectionné les promoteurs (3 857 promoteurs de gènes)45.

Bibliothèques de SureSelect sont disponibles dans des gammes de tailles différentes : 1 Ko à 499 Ko (5 190 – 4 806), 500Ko à 2,9 Mo (5 190 – 4 816) et 3 Mo à 5,9 Mo (5 190 – 4 831). Comme chaque capture individuels biotine-ARN est 120 nucléotides de long, ces capturent systèmes accueillir un maximum de 4 158, 24 166 et 49 166 individuels de capture des sondes, respectivement. Cela correspond à 2 079 12 083 et des fragments de restriction ciblée 24 583, respectivement (Notez que les numéros des fragments de restriction sont minorants basées sur l’hypothèse que les deux sondes de capture individuels peuvent être conçus pour chaque restriction fragment — en réalité en raison de séquences répétitives, ce ne sera pas le cas pour chaque restriction fragment (voir aussi Figure 1 b, C), ce qui entraîne un plus grand nombre de fragments de restriction targetable pour un nombre constant de sondes de capture disponibles ).

Le protocole décrit ici est basé sur l’utilisation d’une enzyme de restriction avec un site de reconnaissance bp 6 afin de découvrir les interactions à longue portée. À l’aide d’une enzyme de restriction avec un site de reconnaissance bp 4 pour une plus grande résolution des interactions plus proximales est également possible de40,49.

Limitations de DAPE-C

Une des limitations inhérentes de tous les essais de capture de conformation du chromosome sont que leur résolution est déterminée par l’enzyme de restriction utilisée pour la production de la bibliothèque. Les interactions qui se produisent entre des éléments d’ADN situées sur le même fragment de restriction sont invisibles aux déterminations « type C ». En outre, DAPE-C, dans certains cas plus d’un site d’initiation de transcription peut se trouver sur le même fragment de restriction contenant du promoteur, en SRRJ dans certains cas abritent deux marques d’histone active et répressif, rendant difficile à cerner qui réglementaire éléments de médient les interactions et de prévoir la sortie réglementaire des interactions de promoteur. À l’aide d’enzymes de restriction avec 4 sites de reconnaissance bp atténue cette question mais se fait aux dépens de la complexité de bibliothèque CIH considérablement accrue (bibliothèques de CIH générés avec 4 bp reconnaissance site enzymes de restriction sont au moins 100 fois plus complexes que le CIH bibliothèques, générés avec 6 bp reconnaissance site enzymes de restriction) et les coûts connexes pour l’ordonnancement de la génération suivante.

Une autre limitation est que le protocole actuel de DAPE-C nécessite des millions de cellules comme matière, excluant l’analyse des interactions de promoteur dans les types de cellules rares de départ. Une version modifiée du PCHi-C pour permettre l’interrogatoire des contacts de promoteur dans les populations de cellules avec 10 000 à 100 000 cellules (par exemple pendant le développement embryonnaire ou de cellules souches hématopoïétiques) serait donc un atout précieux pour la Capture Salut-C boîte à outils.

Enfin, comme toutes les méthodes qui s’appuient sur la fixation de formaldéhyde, DAPE-C enregistre seulement des interactions qui sont « gelées » au point de temps de fixation. Ainsi, afin d’étudier la cinétique et la dynamique des interactions du promoteur, des méthodes comme la microscopie des cellules vivantes Super-résolution sont tenus aux côtés de DAPE.-c.

Méthodes de disséquer organisation chromosomique spatiale à haute résolution

La grande complexité des bibliothèques d’interactions chromosomiques interdit l’identification fiable des produits de l’interaction entre deux fragments de restriction spécifique avec une signification statistique. Pour contourner ce problème, capture de la séquence a été utilisé pour enrichir le CIH33,34,40,44 ou 3C50,51 bibliothèques pour des interactions spécifiques. L’avantage majeur de l’utilisation de bibliothèques bibliothèques plus 3C Hi-C pour l’étape d’enrichissement est que Hi-C, à la différence des 3C, comprend une étape d’enrichissement pour les produits authentiques de la ligature. En conséquence, le pourcentage de lectures valides dans les bibliothèques de DAPE-C est environ 10 fois plus élevé que dans la Capture-C bibliothèques50, qui contenait environ 5 à 8 % valide lit après filtrage HiCUP. Samid et coll. ont comparé directement Capture-C à HiCap, qui comme DAPE-C utilise les bibliothèques de la CIH pour l’enrichissement de capture, contrairement à la Capture-C, qui utilise les bibliothèques de 3C. Conformément à nos conclusions, ils ont constaté que les bibliothèques Capture-C sont composées principalement de fragments non ligaturé40. En outre, les bibliothèques HiCap avaient une plus grande complexité que les bibliothèques de Capture-C40.

Une variante de Capture-C, appelée génération Capture-C52 NG Capture-C utilise un oligo par extrémité de fragment de restriction, comme précédemment établies dans le PCHi-C33,34, au lieu de chevauchement des sondes utilisées dans l’original Protocole de capture-C50. Ceci augmente le pourcentage de lectures valides par rapport à la Capture-C modestement, mais NG Capture-C emploie deux séries séquentielles d’enrichissement de la capture, et un nombre relativement élevé de PCR cycles (20 à 24 cycles au total, par rapport aux 11 cycles généralement DAPE-c), qui inévitablement se traduit par un nombre plus élevé de doublons de séquence et moins complexe de la bibliothèque. Dans les expériences du procès lors de l’optimisation du PCHi-C, nous avons constaté que le pourcentage d’unique (c'est-à-dire, ne pas dupliqués) lu paires ne était que d’environ 15 % lorsque nous avons utilisé 19 cycles PCR (13 cycles pré capturent + 6 cycles après capturent ; données non présentées), mais optimisation à un plus faible nombre de cycles PCR, entraîne généralement de 75 à 90 % des paires de lecture uniques. Ainsi, réduire le nombre de cycles PCR sensiblement augmente la quantité de données sur les séquences informatives.

Une méthode récente allie ChIP avec Salut-C mettre l’accent sur les interactions chromosomiques médiées par une protéine spécifique d’intérêt (HiChIP,53). Par rapport à clerbois-PET54, qui repose sur un raisonnement similaire, HiChIP données contient un nombre plus élevé de lectures de séquence informative, permettant une interaction plus de confiance envers l’appel53. Il sera très intéressant de comparer directement le HiChIP correspondant et capturer le CIH des ensembles de données une fois qu’ils seront disponibles (par exemple HiChIP à l’aide d’un anticorps dirigé contre le cohesin unité Smc1a53 avec Capture Hi-C pour tous les Smc1a lié restriction fragments) côte à côte. Une différence inhérente entre ces deux approches est que capturer le CIH ne dépend pas de l’immunoprécipitation de la chromatine et est donc capable d’interroger les interactions chromosomiques indépendamment d’occupation de la protéine. Cela permet la comparaison de l’organisation génomique 3D en présence ou en absence de liaison de facteur spécifique, tel qu’il a été utilisé pour identifier le PRC1 comme un régulateur clé de souris ESC génome spatiale architecture7.

PCHi-C et GWAS

Études d’association pangénomique (GWAS) ont révélé que plus de 95 % des maladies associées à des variantes de séquence sont situés dans des régions non codantes du génome, souvent à de grandes distances de gènes codant pour des protéines55. Variantes GWAS sont souvent trouvés à proximité immédiate de la DNase I sites hypersensibles, qui est une marque de séquences avec l’activité de régulation possible. DAPE et capturer Hi-C ont été utilisés intensivement pour lier les promoteurs à locus risque GWAS impliqués dans breast cancer44, cancer colorectal48et maladie auto-immune35,45,46. Une DAPE-C étude sur 17 des cellules hématopoïétiques humains différents types trouvent SNP associés à des maladies auto-immunes ont été enrichies dans le SRRJ dans les cellules lymphoïdes, tandis que les variantes de séquence associés à plaquettes et les globules rouges des traits spécifiques trouvées principalement dans les macrophages et les érythroblastes, respectivement35,56. Ainsi, type de tissu spécifiques promoteur interactomes découvert par DAPE-C peut aider à comprendre la fonction de non-codage associés à la maladie variantes de séquence et identifier de nouveaux gènes de maladie potentielle pour une intervention thérapeutique.

Caractéristiques des régions promoteur-interaction

Plusieurs lignes d’évidence lien promoteur interactomes au contrôle d’expression de gène. Tout d’abord, plusieurs études de DAPE-C ont montré que les régions génomiques interagissant avec les promoteurs de gènes à (très) sont enrichies en marques associées à l’activité enhancer, tels que H3K27 acétylation et p300 liaison33,34 , 37. nous avons constaté une corrélation positive entre le niveau d’expression de gène et le nombre d’exhausteurs interagissants, ce qui suggère que les effets additifs des résultat exhausteurs dans l’expression génique accrue niveaux34,35. En second lieu, naturellement expression locus de caractères quantitatifs (eQTLs) sont enrichis dans le SRRJ qui est connectés aux mêmes gènes dont l’expression est affectée par le eQTLs35. Troisièmement, en intégrant Voyage57 et données DAPE-C, Cairns et coll. ont découvert que les gènes voyage cartographie au SRRJ dans ces souris montrent journaliste plus forte l’expression génique de gènes rapporteurs au sites d’intégration dans les régions non-promoteur-interacting 58, indiquant que le PIRs possèdent l’activité de régulation transcriptionnelle. Ensemble, ces résultats suggèrent que le promoteur interactomes découverts par DAPE-c dans différentes de souris et de types de cellules humaines incluent principaux modules réglementaires pour le contrôle d’expression de gène.

Il est à noter que les rehausseurs représentent seulement une petite fraction (~ 20 %) de tous les détecteurs infrarouge passifs, découverts par DAPE-C33,34. Autres détecteurs infrarouge passifs pourraient avoir des rôles structurels ou topologiques plutôt que des fonctions de régulation transcriptionnelles directes. Toutefois, il semble également que DAPE-C peut-être découvrir des éléments d’ADN avec fonction de régulation qui ne pas abriter des marques rehausseur classique. Dans une ligne de cellules lymphoïdes humaines, le promoteur de la BRD7 a été trouvé pour interagir avec une région dépourvue de marques enhancer qui s’est avérée posséder une activité enhancer journaliste gène dosages33. Éléments de régulation ayant des caractéristiques similaires peuvent être plus abondants qu’actuellement apprécié. Par exemple, un écran CRISPR pour ADN éléments identifiés non marquées réglementaires éléments régulateurs (UREs) qui contrôlent l’expression des gènes, mais sont dépourvues de renforceur de marque59.

Dans d’autres cas, détecteurs infrarouge passifs ont démontré pour héberger les marques de la chromatine associées à une répression transcriptionnelle. Détecteurs infrarouge passifs et interactions promoteurs liés par PRC1 dans ces souris étaient engagés dans un vaste réseau spatial de gènes réprimés portant que le répressif marque H3K27me37. Dans les cellules lymphoblastoïdes humaines, un élément lointain interagissant avec le promoteur BCL6 réprimée transgène journaliste gene expression33, ce qui suggère qu’il pourrait fonctionner pour réprimer la transcription BCL6 dans son contexte natif.

Pesi enrichis pour l’occupation de la protéine d’isolateur de chromatine FCCT humaine ESCs et NECs37 peut représenter une nouvelle classe de détecteurs infrarouge passifs. Collectivement, ces résultats suggèrent que le SRRJ abritent une collection d’activités réglementaires de gène qui doit encore être caractérisée sur le plan fonctionnel.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Nous remercions Valeriya Malysheva pour une lecture critique du manuscrit et expert d’aide à la Figure 1. Ce travail a été soutenu par le Medical Research Council, UK (MR/L007150/1) et la biotechnologie UK et Biological Sciences Research Council, UK (BB/J004480/1).

Materials

Name Company Catalog Number Comments
16% (vol/vol) paraformaldehyde solution Agar Scientific R1026
Dulbecco's Modified Eagle Medium (DMEM) 1x Life Technologies 41965-039
Fetal bovine serum (FBS) sterile filtered Sigma  F9665
Low-retention filter tips  Starlab S1180-3810, S1180-1810, S1180-8810 and S1182-1830
10x PBS pH 7.4 Life Technologies 70011-036
Molecular biology grade water Sigma-Aldrich W4502
1 M Tris-HCl pH 8.0 Life Technologies 15568-025
IGEPAL CA-630  Sigma-Aldrich I8896
5 M NaCl  Life Technologies 24740-011
Protease inhibitor cocktail (EDTA-free)  Roche Diagnostics 11873580001
Restriction buffer 2 (10x NEBuffer 2) New England Biolabs B7002
DNA LoBind tube, 1.5 mL  Eppendorf 0030 108.051
DNA LoBind tube, 2 mL Eppendorf 30108078
20% (wt/vol) SDS   Bio-Rad Laboratories 161-0418
20% (vol/vol) Triton X-100  Sigma-Aldrich T8787
HindIII, 100 U/uL New England Biolabs R0104
10 mM dCTP  Life Technologies 18253-013
10 mM dGTP Life Technologies 18254-011
10 mM dTTP  Life Technologies 18255-018
0.4 mM Biotin-14-dATP Life Technologies 19524-016
DNA polymerase I large (Klenow) fragment 5000 units/mL New England Biolabs M0210
10x T4 DNA ligase reaction buffer  New England Biolabs B0202
100x 10mg/ml Bovine Serum Albumin  New England Biolabs B9001
T4 DNA ligase, 1 U/μL  Invitrogen 15224-025
RNase A  Roche 10109142001
Proteinase K, recombinant, PCR grade  Roche 3115836001
20 000×g 50 ml centrifuge tube VWR 525-0156
0.5 M EDTA pH 8.0  Life Technologies 15575-020
Phenol pH 8.0  Sigma P4557
Phenol: Chloroform: Isoamyl Alcohol 25:24:1  Sigma P3803
Sodium acetate pH 5.2  Sigma S7899
Quant-iT PicoGreen  Invitrogen P7589
QIAquick Gel Extraction Kit Qiagen 28704
QIAquick PCR Purification Kit Qiagen 28104
Restriction buffer 2.1 (10x NEBuffer 2.1) New England Biolabs B7202
NheI, 100U/uL New England Biolabs R0131
Micro TUBE AFA Fiber Pre-slit snap cap 6x16mm vials  Covaris 520045 For sonication
SPRI beads (Agencourt AMPure XP)  Beckman Coulter A63881
Dynabeads MyOne Streptavidin C1 beads  Invitrogen 65001
Tween 20  Sigma P9416
10 mM dATP  Life Technologies 18252-015
T4 DNA polymerase 3000 units/mL New England Biolabs M0203
T4 PNK 10000 units/mL New England Biolabs M0201
Klenow exo minus 5000 units/mL  New England Biolabs M0212
Quick ligation reaction buffer  New England Biolabs B6058
NEB DNA Quick ligase  New England Biolabs M2200
PE adapter 1.0 (5'-P-GATCGGAAGAGCGGTTCAGC
AGGAATGCCGAG-3')
Illumina
PE adapter 2.0 (5'-ACACTCTTTCCCTACACGACGCT
CTTCCGATCT-3')
Illumina
NEB Phusion PCR kit  New England Biolabs M0530
PE PCR primer 1.0 (5'-AATGATACGGCGACCACCGA
GATCTACACTCTTTCCCTAC
ACGACGCTCTTCCGATCT-3')
Illumina
PE PCR primer 2.0 (5'-CAAGCAGAAGACGGCATACGA
GATCGGTCTCGGCATTCCT
GCTGAACCGCTCTTCCGATCT-3') 
Illumina
PCR strips  Agilent Technologies 410022 and 401425
SureSelect SSEL TE Reagent ILM PE full adaptor kit  Agilent Technologies 931108
SureSelect custom 3-5.9 Mb library  Agilent Technologies 5190-4831 custom design mouse or human PCHi-C system
Dynabeads MyOne Streptavidin T1 beads  Invitrogen 65601
E220  high-performance focused ultra-sonicator Corvaris E220

DOWNLOAD MATERIALS LIST

References

  1. Osborne, C. S., et al. Active genes dynamically colocalize to shared sites of ongoing transcription. Nature Genetics. 36, 1065-1071 (2004).
  2. Schoenfelder, S., et al. Preferential associations between co-regulated genes reveal a transcriptional interactome in erythroid cells. Nature Genetics. 42, 53-61 (2010).
  3. de Wit, E., et al. The pluripotent genome in three dimensions is shaped around pluripotency factors. Nature. 501, 227-231 (2013).
  4. Bantignies, F., et al. Polycomb-dependent regulatory contacts between distant Hox loci in Drosophila. Cell. 144, 214-226 (2011).
  5. Engreitz, J. M., et al. The Xist lncRNA exploits three-dimensional genome architecture to spread across the X chromosome. Science. 341, 1237973 (2013).
  6. Denholtz, M., et al. Long-range chromatin contacts in embryonic stem cells reveal a role for pluripotency factors and polycomb proteins in genome organization. Cell Stem Cell. 13, 602-616 (2013).
  7. Schoenfelder, S., et al. Polycomb repressive complex PRC1 spatially constrains the mouse embryonic stem cell genome. Nature Genetics. 47, 1179-1186 (2015).
  8. Kundu, S., et al. Polycomb Repressive Complex 1 generates discrete compacted domains that change during differentiation. Molecular Cell. 65, 432-446 (2017).
  9. Skok, J. A., Gisler, R., Novatchkova, M., Farmer, D., de Laat, W., Busslinger, M. Reversible contraction by looping of the Tcra and Tcrb loci in rearranging thymocytes. Nature Immunology. 8, 378-387 (2007).
  10. Zhang, Y., et al. Spatial organization of the mouse genome and its role in recurrent chromosomal translocations. Cell. 148, 908-921 (2012).
  11. Aymard, F., et al. Genome-wide mapping of long-range contacts unveils clustering of DNA double-strand breaks at damaged active genes. Nature Structural & Molecular Biology. 24, 353-361 (2017).
  12. Ryba, T., et al. Evolutionarily conserved replication timing profiles predict long-range chromatin interactions and distinguish closely related cell types. Genome Research. 20, 761-770 (2010).
  13. Pope, B. D., et al. Topologically associating domains are stable units of replication-timing regulation. Nature. 515, 402-405 (2014).
  14. Chandra, T., et al. Global reorganization of the nuclear landscape in senescent cells. Cell Reports. 10, 471-483 (2015).
  15. Carter, D., Chakalova, L., Osborne, C. S., Dai, Y. F., Fraser, P. Long-range chromatin regulatory interactions in vivo. Nature Genetics. 32, 623-626 (2002).
  16. Tolhuis, B., Palstra, R. J., Splinter, E., Grosveld, F., de Laat, W. Looping and interaction between hypersensitive sites in the active beta-globin locus. Molecular Cell. 10, 1453-1465 (2002).
  17. Amano, T., Sagai, T., Tanabe, H., Mizushina, Y., Nakazawa, H., Shiroishi, T. Chromosomal dynamics at the Shh locus: limb bud-specific differential regulation of competence and active transcription. Developmental Cell. 16, 47-57 (2009).
  18. Zuniga, A., et al. Mouse limb deformity mutations disrupt a global control region within the large regulatory landscape required for Gremlin expression. Genes & Development. 18, 1553-1564 (2004).
  19. Sagai, T., Hosoya, M., Mizushina, Y., Tamura, M., Shiroishi, T. Elimination of a long-range cis-regulatory module causes complete loss of limb-specific Shh expression and truncation of the mouse limb. Development. 132, 797-803 (2005).
  20. D'Haene, B., et al. Disease-causing 7.4 kb cis-regulatory deletion disrupting conserved non-coding sequences and their interaction with the FOXL2 promotor: implications for mutation screening. PLoS Genet. 5, e1000522 (2009).
  21. Sur, I. K., et al. Mice lacking a Myc enhancer that includes human SNP rs6983267 are resistant to intestinal tumors. Science. 338, 1360-1363 (2012).
  22. Herranz, D., et al. A NOTCH1-driven MYC enhancer promotes T cell development, transformation and acute lymphoblastic leukemia. Nature Medicine. 20, 1130-1137 (2014).
  23. Deng, W., et al. Controlling long-range genomic interactions at a native locus by targeted tethering of a looping factor. Cell. 149, 1233-1244 (2012).
  24. Groschel, S., et al. A single oncogenic enhancer rearrangement causes concomitant EVI1 and GATA2 deregulation in leukemia. Cell. 157, 369-381 (2014).
  25. Lupianez, D. G., et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell. 161, 1012-1025 (2015).
  26. Franke, M., et al. Formation of new chromatin domains determines pathogenicity of genomic duplications. Nature. 538, 265-269 (2016).
  27. Dekker, J., Rippe, K., Dekker, M., Kleckner, N. Capturing chromosome conformation. Science. 295, 1306-1311 (2002).
  28. Simonis, M., et al. Nuclear organization of active and inactive chromatin domains uncovered by chromosome conformation capture-on-chip (4C). Nature Genetics. 38, 1348-1354 (2006).
  29. Zhao, Z., et al. Circular chromosome conformation capture (4C) uncovers extensive networks of epigenetically regulated intra- and interchromosomal interactions. Nature Genetics. 38, 1341-1347 (2006).
  30. Dostie, J., et al. Chromosome Conformation Capture Carbon Copy (5C): A massively parallel solution for mapping interactions between genomic elements. Genome Research. 16, 1299-1309 (2006).
  31. Lieberman-Aiden, E., et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 326, 289-293 (2009).
  32. Belton, J. M., McCord, R. P., Gibcus, J. H., Naumova, N., Zhan, Y., Dekker, J. Hi-C: a comprehensive technique to capture the conformation of genomes. Methods. 58, 268-276 (2012).
  33. Mifsud, B., et al. Mapping long-range promoter contacts in human cells with high-resolution capture Hi-C. Nature Genetics. 47, 598-606 (2015).
  34. Schoenfelder, S., et al. The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements. Genome Res. 25, 582-597 (2015).
  35. Javierre, B. M., et al. Lineage-specific genome architecture links enhancers and non-coding disease variants to target gene promoters. Cell. 167, 1369-1384 (2016).
  36. Wilson, N. K., et al. Integrated genome-scale analysis of the transcriptional regulatory landscape in a blood stem/progenitor cell model. Blood. 127, e12-e23 (2016).
  37. Freire-Pritchett, P., et al. Global reorganisation of cis-regulatory units upon lineage commitment of human embryonic stem cells. Elife. 6, (2017).
  38. Rubin, A. J., et al. Lineage-specific dynamic and pre-established enhancer-promoter contacts cooperate in terminal differentiation. Nature Genetics. 49, 1522-1528 (2017).
  39. Siersbaek, R., et al. Dynamic rewiring of promoter-anchored chromatin loops during adipocyte differentiation. Molecular Cell. 66, 420-435 (2017).
  40. Sahlen, P., et al. Genome-wide mapping of promoter-anchored interactions with close to single-enhancer resolution. Genome Biology. 16, 156 (2015).
  41. Nagano, T., et al. Single-cell Hi-C reveals cell-to-cell variability in chromosome structure. Nature. 502, 59-64 (2013).
  42. Nagano, T., Varnai, C., Schoenfelder, S., Javierre, B. M., Wingett, S. W., Fraser, P. Comparison of Hi-C results using in-solution versus in-nucleus ligation. Genome Biology. 16, 175 (2015).
  43. Wingett, S., et al. HiCUP: pipeline for mapping and processing Hi-C data. F1000 Res. 4, 1310 (2015).
  44. Dryden, N. H., et al. Unbiased analysis of potential targets of breast cancer susceptibility loci by Capture Hi-C. Genome Research. 24, 1854-1868 (2014).
  45. Martin, P., et al. Capture Hi-C reveals novel candidate genes and complex long-range interactions with related autoimmune risk loci. Nature Communications. 6, 10069 (2015).
  46. McGovern, A., et al. Capture Hi-C identifies a novel causal gene, IL20RA, in the pan-autoimmune genetic susceptibility region 6q23. Genome Biol.ogy. 17, 212 (2016).
  47. Hodge, D., et al. A global role for EKLF in definitive and primitive erythropoiesis. Blood. 107, 3359-3370 (2006).
  48. Jager, R., et al. Capture Hi-C identifies the chromatin interactome of colorectal cancer risk loci. Nature Communications. 6, 6178 (2015).
  49. Joshi, O., et al. Dynamic reorganization of extremely long-range promoter-promoter Interactions between two states of pluripotency. Cell Stem Cell. 17, 748-757 (2015).
  50. Hughes, J. R., et al. Analysis of hundreds of cis-regulatory landscapes at high resolution in a single, high-throughput experiment. Nature Genetics. 46, 205-212 (2014).
  51. Kolovos, P., et al. Targeted Chromatin Capture (T2C): A novel high-resolution high-throughput method to detect genomic interactions and regulatory elements. Epigenetics Chromatin. 7, 10 (2014).
  52. Davies, J. O., et al. Multiplexed analysis of chromosome conformation at vastly improved sensitivity. Nature Methods. 13, 74-80 (2016).
  53. Mumbach, M. R., et al. HiChIP: efficient and sensitive analysis of protein-directed genome architecture. Nature Methods. 13, 919-922 (2016).
  54. Fullwood, M. J., et al. An oestrogen-receptor-alpha-bound human chromatin interactome. Nature. 462, 58-64 (2009).
  55. Maurano, M. T., et al. Systematic localization of common disease-associated variation in regulatory DNA. Science. 337, 1190-1195 (2012).
  56. Petersen, R., et al. Platelet function is modified by common sequence variation in megakaryocyte super enhancers. Nat. Commun. 8, 16058 (2017).
  57. Akhtar, W., et al. Chromatin position effects assayed by thousands of reporters integrated in parallel. Cell. 154, 914-927 (2013).
  58. Cairns, J., et al. CHiCAGO: Robust detection of DNA looping interactions in Capture Hi-C data. Genome Biology. 17, 127 (2016).
  59. Rajagopal, N., et al. High-throughput mapping of regulatory DNA. Nature Biotechnology. 34, 167-174 (2016).
Capture promoteur Salut-c : Haute résolution, Genome-wide profilage des Interactions de promoteur
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Schoenfelder, S., Javierre, B. M., Furlan-Magaril, M., Wingett, S. W., Fraser, P. Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions. J. Vis. Exp. (136), e57320, doi:10.3791/57320 (2018).More

Schoenfelder, S., Javierre, B. M., Furlan-Magaril, M., Wingett, S. W., Fraser, P. Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions. J. Vis. Exp. (136), e57320, doi:10.3791/57320 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter