Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

प्रमोटर कब्जा हाय-सी: उच्च संकल्प, जीनोम-व्यापक प्रमोटर बातचीत की रूपरेखा

doi: 10.3791/57320 Published: June 28, 2018
* These authors contributed equally

Summary

डीएनए ऐसे बढ़ाने के रूप में नियामक तत्वों, शारीरिक रूप से लक्ष्य जीन प्रवर्तकों से संपर्क द्वारा जीन अभिव्यक्ति नियंत्रण, अक्सर लंबी दूरी के माध्यम से गुणसूत्र बड़ी जीनोमिक दूरी फैले बातचीत । प्रमोटर कब्जा हाय-सी (PCHi-सी) अपने लक्ष्य जीन के लिए संभावित विनियामक दृश्यों के काम को सक्षम करने, प्रवर्तकों और बाहर के क्षेत्रों के बीच महत्वपूर्ण बातचीत की पहचान करता है ।

Abstract

जीनोम का तीन आयामी संगठन अपने कार्य से जुड़ा हुआ है. उदाहरण के लिए, transcriptional बढ़ाने के रूप में विनियामक तत्वों शारीरिक संपर्क के माध्यम से अपने लक्ष्य जीन की spatio-लौकिक अभिव्यक्ति नियंत्रण, अक्सर काफी पाटन (कुछ मामलों में kilobases के सैकड़ों) जीनोमिक दूरी और बाईपास पास जीन । मानव जीनोम एक अनुमानित १,०००,००० बढ़ाने के बंदरगाह, जिनमें से विशाल बहुमत अज्ञात जीन लक्ष्य है । उनके लक्ष्य जीन के लिए बाहर का नियामक क्षेत्रों निर्दिष्ट इस प्रकार जीन अभिव्यक्ति नियंत्रण को समझने के लिए महत्वपूर्ण है । हम एक ही प्रयोग में सभी प्रवर्तकों के लिए, बाहर प्रमोटर-बातचीत क्षेत्रों (PIRs) के जीनोम चौड़ा पता लगाने को सक्षम करने के लिए प्रवर्तक कब्जा हाय-सी (PCHi-सी) का विकास किया । PCHi-सी में, अत्यधिक जटिल उच्च सी पुस्तकालयों विशेष रूप से सभी प्रमोटर युक्त प्रतिबंध टुकड़े के सिरों के पूरक biotinylated आरएनए चारा के हजारों के साथ में समाधान संकर चयन के माध्यम से प्रमोटर दृश्यों के लिए समृद्ध कर रहे हैं । उद्देश्य के लिए तो खींच-नीचे प्रमोटर दृश्यों और उनके ऐसे बढ़ाने और अंय संभावित नियामक तत्वों के रूप में लगातार बातचीत भागीदारों है । उच्च-प्रवाह युग्मित-समाप्त sequencing के बाद, एक सांख्यिकीय परीक्षण प्रतिबंध अंश स्तर पर महत्वपूर्ण PIRs की पहचान करने के लिए प्रत्येक promotion-ligated प्रतिबंध अंश करने के लिए लागू किया जाता है । हम PCHi-सी का इस्तेमाल किया है के लिए मानव और माउस सेल प्रकार के दर्जनों में लंबी दूरी के प्रमोटर बातचीत के एक एटलस उत्पंन करते हैं । इन प्रमोटर interactome मैप्स अपने लक्ष्य जीन को ख्यात विनियामक क्षेत्रों निर्दिष्ट और तरजीही स्थानिक प्रमोटर-प्रमोटर संपर्क नेटवर्क का खुलासा द्वारा स्तनधारी जीन अभिव्यक्ति नियंत्रण की एक बड़ी समझ में योगदान दिया है । यह भी जानकारी मानव आनुवंशिक रोग और संभावित रोग जीन की पहचान को समझने के लिए उच्च प्रासंगिकता है, गैर कोडिंग रोग-संबंधित अनुक्रम वेरिएंट में या नियंत्रण अनुक्रम के पास अपने लक्ष्य जीन को जोड़ने के द्वारा ।

Introduction

सबूत जमा पता चलता है कि तीन जीनोम के आयामी संगठन परमाणु प्रक्रियाओं की एक श्रेणी में एक महत्वपूर्ण कार्यात्मक भूमिका निभाता है, जीन सक्रियण सहित1,2,3, दमन4 ,5,6,7,8, पुनर्संयोजन9,10, डीएनए मरंमत11, डीएनए प्रतिकृति12,13, और सेलुलर वार्धक्य14. दूर बढ़ाने के प्रवर्तकों वे15,16,17, जो उचित spatio-लौकिक जीन अभिव्यक्ति नियंत्रण के लिए आवश्यक है विनियमित करने के लिए करीब स्थानिक निकटता में पाए जाते हैं । बढ़ाने हटाने से पता चलता है कि बाहर बढ़ाने लक्ष्य जीन प्रतिलेखन18,19,20,21,22के लिए आवश्यक हैं, और ' मजबूर क्रोमेटिन looping ' दर्शाता है कि इंजीनियर एक बढ़ाने और Hbb लोकस में अपने लक्ष्य प्रमोटर के बीच tethering transcriptional सक्रियण23ड्राइव करने के लिए पर्याप्त है । इसके अलावा, जीनोम reअस्थानिक बढ़ाने के नियंत्रण के तहत जीन लाने कि अनुपयुक्त जीन सक्रियकरण और रोग24,25,26में परिणाम कर सकते हैं । साथ में, इन उदाहरणों का वर्णन है कि प्रमोटर बढ़ाने बातचीत जीन नियंत्रण के लिए आवश्यक है और तंग विनियमन उचित जीन अभिव्यक्ति सुनिश्चित करने की आवश्यकता है । मानव और माउस जीनोम प्रत्येक १,०००,००० बढ़ाने के आसपास बंदरगाह का अनुमान है । इन बढ़ाने के विशाल बहुमत के लिए, लक्ष्य जीन अज्ञात हैं, और प्रवर्तकों और बढ़ाने के बीच ' सगाई के नियम ' खराब समझ रहे हैं । अपने लक्ष्य जीन को transcriptional बढ़ाने निर्दिष्ट इस प्रकार स्तनधारी जीन अभिव्यक्ति नियंत्रण का गूढ़ रहस्य में एक बड़ी चुनौती बनी हुई है ।

तीन आयामी जीनोम वास्तुकला की हमारी समझ 3 सी27 (गुणसूत्र अनुरूप कब्जा) की शुरूआत से क्रांति की गई है और उसके वेरिएंट28,29,30,31 . इन तकनीकों का सबसे शक्तिशाली, हाय-सी (उच्च प्रवाह गुणसूत्र अनुरूप कब्जा) एक सेल जनसंख्या के भीतर गुणसूत्र बातचीत की पूरी पहनावा की पहचान करने के लिए डिज़ाइन किया गया है । उच्च सी पुस्तकालयों, आमतौर पर कोशिकाओं के लाखों लोगों से उत्पंन, मानव जीनोम३२में एक अनुमानित 1011 के बीच स्वतंत्र बंधाव उत्पादों ~ 4 kb टुकड़े के साथ अत्यधिक जटिल हैं । एक परिणाम के रूप में, व्यक्तिगत प्रतिबंध टुकड़े के बीच बातचीत की विश्वसनीय और reproducible पहचान (जैसे एक प्रमोटर या बढ़ाने से युक्त उन के रूप में) उच्च सी डेटा से जब तक उच्च-सी पुस्तकालयों अल्ट्रा गहरे अनुक्रमण के अधीन है व्यवहार्य नहीं है, जो नियमित रूप से हाय-सी पुस्तकालयों की तैयारी करने वाली प्रयोगशालाओं के लिए आर्थिक रूप से व्यवहार्य समाधान नहीं है । इस कमियों को दरकिनार करने के लिए, हमने उच्च-सी पुस्तकालयों से प्रमोटर-युक्त बंधाव उत्पादों को विशेष रूप से समृद्ध करने के लिए प्रमोटर कैप्चर हाय-सी विकसित किया । हमने दो कारणों से प्रवर्तकों पर ध्यान केंद्रित किया । पहले, प्रमोटर-बढ़ाने के संपर्क के लिए कई अध्ययनों में उचित जीन अभिव्यक्ति के स्तर के लिए महत्वपूर्ण हो दिखाया गया है (ऊपर संदर्भ देखें), और दूसरा, के रूप में प्रवर्तक कोशिका प्रकार के बीच बड़े पैमाने पर अपरिवर्तनीय हैं, एक ही कब्जा चारा प्रणाली के लिए पूछताछ किया जा सकता है कई सेल प्रकार और शर्तों के पार नियामक सर्किट । हमारे दृष्टिकोण में biotinylated आरएनए के हजारों के साथ उच्च सी पुस्तकालयों के समाधान संकरण पर निर्भर करता है 120mers प्रमोटर-युक्त हाय-सी बंधाव उत्पादों और streptavidin लेपित चुंबकीय मोतियों पर बाद में कब्जा करने के लिए पूरक । PCHi-सी पुस्तकालयों में यह परिणाम बहुत कम जटिलता के साथ मूल उच्च सी पुस्तकालय की तुलना में, कि काफी अधिक आवृत्तियों पर प्रवर्तकों के लिए ligated हैं कि केवल टुकड़े की पहचान पर ध्यान केंद्रित.

हम मानव और माउस सेल प्रकार के एक नंबर में PCHi सी का इस्तेमाल किया है लंबी दूरी के बाहर प्रमोटर ख्यात विनियामक समारोह के साथ क्षेत्रों में बातचीत, साथ ही गैर यादृच्छिक द्वारा जीन अभिव्यक्ति नियंत्रण की एक बेहतर समझ में योगदान नाभिक के तीन आयामी अंतरिक्ष में प्रमोटर-प्रमोटर संपर्क । अध्ययनों से कई सेल प्रकार३३,३४,३५,३६,३७,३८ भर में प्रमोटर-बढ़ाने संपर्कों के हजारों की सैकड़ों मैप किया है, ३९, Polycomb दमनात्मक जटिल की पहचान की-माउस भ्रूण स्टेम सेल7में स्थानिक जीनोम संगठन मध्यस्थता, सेलुलर भेदभाव३७के दौरान प्रमोटर interactomes के बड़े पैमाने पर तारों का प्रदर्शन किया, ३८ , ३९, और लिंक्ड गैर कोडिंग रोग-जीन प्रवर्तकों३५के लिए अनुक्रम वेरिएंट जुड़े ।

PCHi-सी एक आदर्श के लिए डीएनए के जीनोम-व्यापक पहनावा के नक्शे को बढ़ावा देने वालों के साथ बातचीत के जुगाड़ के अनुकूल विधि है । संबंधित approaches, जैसे निरंतर जीनोमिक क्षेत्रों के कैप्चर हाय-C ( चर्चादेखें) चयनित जीनोमिक क्षेत्रों के लिए उच्च-रिज़ॉल्यूशन सहभागिता प्रोफ़ाइल प्राप्त करने के लिए पसंद की विधि हैं । PCHi-सी और कब्जा हाय-सी देखने के एक प्रयोगात्मक बिंदु से बेहद समान है (केवल अंतर कब्जा प्रणाली का विकल्प है), ताकि सलाह और दिशानिर्देश हम प्रदान दोनों तरीकों के लिए लागू होते हैं । यहाँ, हम PCHi-सी का विस्तृत वर्णन प्रस्तुत करते हैं । हम तर्क और एक PCHi-c प्रयोग के डिजाइन रूपरेखा, एक कदम दर कदम PCHi-सी पुस्तकालय पीढ़ी प्रोटोकॉल प्रदान करते हैं, और उदाहरण देकर स्पष्ट करना कि कैसे PCHi-सी पुस्तकालयों की गुणवत्ता के लिए उच्च गुणवत्ता वाले डेटा उपज प्रोटोकॉल में विभिंन चरणों में निगरानी की जा सकती है ।

Protocol

1. Formaldehyde निर्धारण

  1. सेल तैयारी: प्रति प्रयोग 2 x 107 कोशिकाओं की एक ंयूनतम के साथ शुरू करो ।
    1. संस्कृति में उगाई कोशिकाओं के लिए, संस्कृति माध्यम में कोशिकाओं reसस्पेंड । पूर्व वीवो कोशिकाओं के लिए, 1x Dulbecco में संशोधित ईगल मध्यम (DMEM), 10% के साथ पूरक में reसस्पेंड (vol/) भ्रूण गोजातीय सीरम (FBS) ।
    2. अनुयाई कक्षों के लिए, संस्कृति माध्यम को निकालें और 10% (vol/FBS) कमरे के तापमान (आरटी; 20-25 डिग्री सेल्सियस) में से ३०.६२५ मिलीलीटर ताजा मध्यम जोड़ें ।
    3. निलंबन कोशिकाओं के लिए, इकट्ठा करने और ४०० x g और 20 ° c 3 मिनट के लिए कोशिकाओं को केंद्रापसारक । निकालें supernatant और पुनः निलंबित मध्यम के ३०.६२५ मिलीलीटर में सेल गोली 10% (vol/
    4. ठोस ऊतकों के लिए, trypsin (०.०५% से २.५% अंतिम एकाग्रता, सेल प्रकार के आधार पर) का उपयोग करें या एक सेल निलंबन प्राप्त करने के लिए dounce अनुमन्य है । इस अतिरिक्त चरण के बाद, निलंबन कोशिकाओं की तरह कोशिकाओं का इलाज ।
  2. 16% मेथनॉल के ४.३७५ मिलीलीटर जोड़ें-मुक्त paraformaldehyde (ओपन शीशी बस का उपयोग करने से पहले) 2% की एक अंतिम एकाग्रता (vol/ एक झूली कुरसी पर कोमल मिश्रण के साथ आर टी पर 10 मिनट के लिए फिक्स ।
    सावधानी: Paraformaldehyde एक खतरनाक केमिकल है । उपयुक्त स्वास्थ्य और सुरक्षा नियमों का पालन करें ।
  3. नए सिरे से तैयार की 5 मिलीलीटर जोड़कर प्रतिक्रिया बुझाने-1 एम आइस-शीत glycine । RT में कोमल कमाल के साथ 5 मिनट के लिए मिश्रण है, और फिर सामयिक पलटन के साथ 15 मिनट के लिए बर्फ पर गर्मी ।
  4. धो लें और निश्चित कोशिकाओं को इकट्ठा ।
    1. अनुयाई कोशिकाओं के लिए, supernatant निकालें, प्लेट दीवार पर बर्फ ठंडा 1x पंजाबियों पीएच ७.४ के 10 मिलीलीटर जोड़ें और इसे हटा दें । बर्फ की 1 मिलीलीटर-ठंडा 1x पंजाब पीएच ७.४ जोड़ें, एक सेल खुरचनी और एक ५० मिलीलीटर ट्यूब में स्थानांतरण का उपयोग कर कोशिकाओं को इकट्ठा । यथासंभव अधिक से अधिक कक्षों को संग्रहीत करने के लिए दो बार दोहराएँ. बर्फ जोड़ें-शीत पंजाबियों ५० मिलीलीटर अंतिम मात्रा तक ।
    2. निलंबन कोशिकाओं के लिए, ७६० x g और 5 मिनट के लिए 4 डिग्री सेल्सियस पर कोशिकाओं के केंद्रापसारक, supernatant को हटाने, और फिर से ५० मिलीलीटर बर्फ ठंडा पंजाब पीएच ७.४ में सेल गोली निलंबित ।
  5. 10 मिनट के लिए ४०० x g और 4 ° c पर कोशिकाओं केंद्रापसारक और ध्यान से supernatant निकालें । सेल गोली तरल नाइट्रोजन में जमे हुए स्नैप हो सकता है और बाद में कई महीनों के लिए-८० डिग्री सेल्सियस पर संग्रहीत ।

2. सेल Lysis

  1. पुनः निलंबित ५० मिलीलीटर में हौसले से तैयार बर्फ शीत lysis बफर (10 मिमी Tris-एचसीएल पीएच 8, ०.२% (vol/Igepal सीए-६३०, 10 मिमी NaCl, और एक गोली चिढ़ाने के कॉकटेल) और मिश्रण... 30 मिनट के लिए बर्फ पर गर्मी, पलटने से कभी-कभार मिलाएं । 5 मिनट के लिए ७६० x g और 4 ° c पर नाभिक केंद्रापसारक और supernatant निकालें ।

3. हिनdIII पाचन

  1. 1.25 x प्रतिबंध बफ़र 2 के साथ कक्ष नाभिक धो लें । पुनः निलंबित बर्फ के 1 मिलीलीटर में सेल गोली-ठंड 1.25 x प्रतिबंध बफर 2 और एक १.५ मिलीलीटर ट्यूब में स्थानांतरण । 5 मिनट के लिए ७६० x g और 4 ° c पर नाभिक स्पिन और supernatant निकालें ।
  2. पुन: निलंबित सेल गोली १७९० में 1.25 x प्रतिबंध बफ़र 2 के µ l । 5 aliquots, प्रत्येक जिसमें 5-10 लाख कोशिकाओं को 1.25 x प्रतिबंध बफर 2 के ३५८ µ l में बनाओ ।
  3. 10% के 11 µ एल जोड़ें (wt/vol) एसडीएस प्रति aliquot और शेक पर 30 मिनट के लिए ९५० प्रति मिनट (rpm) में एक thermomixer में ३७ डिग्री सेल्सियस । अगर कोशिका के झुरमुट दिखाई देते हैं, pipetting द्वारा अलग कर देना, बुलबुले से परहेज ।
  4. जोड़ें ७५ µ प्रति 10% ट्राइटन X-१०० (vol/vol) aliquot और एक thermomixer में 15 मिनट के लिए ९५० rpm और ३७ ° c पर शेक । अगर कोशिका के झुरमुट दिखाई देते हैं, pipetting द्वारा अलग कर देना, बुलबुले से परहेज ।
  5. १०० U/µ l हिनdIII १०० (कुल में १,२०० इकाइयों) के 12 µ एल जोड़ें aliquot प्रति और ३७ डिग्री सेल्सियस पर रात भर (O/N) जबकि एक thermomixer में ९५० rpm पर मिलाते हुए ।
    1. पाचन नियंत्रण के लिए, एंजाइम (अपच नियंत्रण) जोड़ने से पहले एक नई ट्यूब में (प्रत्येक aliquot से 5 µ एल) नमूना के 25 µ एल हस्तांतरण और एंजाइम (पचा नियंत्रण) जोड़ने के बाद एक ही प्रक्रिया को दोहराने. हाय-सी पुस्तकालय के रूप में एक ही तरीके से दोनों ट्यूबों में मशीन ।
  6. निंनलिखित सुबह, १०० U/µ एल हिनdIII के 5 µ एल जोड़ें (कुल में ५०० इकाइयों) प्रति aliquot और 2 घंटे के लिए ३७ डिग्री सेल्सियस पर मशीन जबकि ९५० rpm में एक thermomixer में मिलाते हुए ।
  7. पाचन नियंत्रण: पचा और अपच नियंत्रण (3.5.1 देखें) के लिए, crosslink उत्क्रमण (चरण 6), Phenol: क्लोरोफॉर्म निष्कर्षण, और डीएनए वर्षण (चरण 7) प्रदर्शन करते हैं ।
    1. डिजाइन प्राइमरों की एक जोड़ी है कि अवधि एक हिनdIII साइट । एक ही क्षेत्र में, प्राइमरों की एक जोड़ी है कि एक हिनdIII साइट अवधि नहीं डिजाइन । मात्रात्मक पीसीआर के लिए डिजाइन प्राइमर (क्यू-पीसीआर) Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/) और निम्नलिखित मापदंडों का उपयोग:
      प्राइमर आकार: इष्टतम 20 (Min.: 18, अधिकतम.: 27); प्राइमर Tm: इष्टतम ६० (Min.: ५७, अधिकतम.: ६३); प्राइमर तटरक्षक% सामग्री: Min.: 20, अधिकतम.: ८०; Amplicon आकार: आरटी-पीसीआर ~ १०० bp (पारंपरिक पीसीआर के लिए ~ ३०० बीपी); भड़काना पुस्तकालय: मानव (मानव प्राइमरों) या कुतर और सरल (माउस प्राइमरों) ।
    2. 4 मतलब सीटीएस प्राप्त करने के लिए क्यू पीसीआर प्रदर्शन (दहलीज साइकिल): सीटी [डी; एच], पचा नमूना से प्राप्त [डी] प्राइमरों की जोड़ी के साथ कि एक हिनdIII साइट अवधि [एच]; सीटी [डी;-], पचा नमूना से प्राप्त [डी] प्राइमरों कि एक हिनdIII साइट अवधि नहीं है की जोड़ी के साथ [-]; सीटी [भ; एच], अजीर्ण नमूना से प्राप्त [यू] प्राइमरों की जोड़ी के साथ है कि एक हिनdIII साइट अवधि; सीटी [u;-], अजीर्ण नमूना से प्राप्त [यू] प्राइमरों कि एक हिनdIII साइट अवधि नहीं है की जोड़ी के साथ [-] । के रूप में पाचन के प्रतिशत की गणना:% पाचन = 100-100/2(सीटी [डी, एच]-सीटी [डी,-])-(सीटी [यू, एच]-सीटी [यू,-])

4. Biotinylation प्रतिबंध अंश को हैंग हो जाता है

  1. तैयार biotinylation मास्टर मिक्स: ३०.६ µ एल के 10x प्रतिबंध बफर 2, १०.२ µ एल के एच2ओ (आणविक जीवविज्ञान ग्रेड), ७.६५ µ एल के 10 मिमी dCTP, ७.६५ µ एल के 10 मिमी dGTP, ७.६५ µ एल के 10 मिमी dTTP, १९१.२५ µ एल के ०.४ मिमी बायोटिन-14-dATP, और ५१ µ l की ५,००० यू/एमएल डीएनए पोलीमरेज़ मैं बड़ी ( Klenow) अंश ।
  2. aliquot, मिश्रण, और 5 एस के लिए ७०० rpm (thermomixer) में 1 ज झटकों के लिए ३७ डिग्री सेल्सियस पर biotinylation मास्टर मिश्रण के ६० µ एल जोड़ें, हर 30 एस । 1 ज के बाद, बर्फ पर जगह aliquots ।

5. इन-नाभिक बंधाव

  1. बंधाव मास्टर मिक्स तैयार: 10x टी-4 डीएनए ligase बफर के ५१० µ एल, ५१ µ एल के 10 मिलीग्राम/एमएल गोजातीय सीरम एल्ब्युमिन (100x BSA), १७५४.४ µ एल ऑफ वॉटर (आण्विक जीव विज्ञान ग्रेड), और १२७.५ µ एल के 1 यू/µ एल टी-4 डीएनए ligase ( सामग्री की तालिकादेखें) ।
  2. जोड़ें ४७९ µ प्रति बंधाव मास्टर मिश्रण के एल aliquot मिश्रण और के लिए 16 ° c में गर्मी 4 एच ७०० rpm पर मिलाते 5 एस के लिए एक thermomixer में हर 2 मिनट ।
  3. आर टी पर 30 मिनट की मशीन

६. Crosslink उलटा

  1. एक ५० मिलीलीटर केंद्रापसारक ट्यूब में सभी aliquots गठबंधन (उच्च गति केंद्रापसारक के लिए उपयुक्त) ।
  2. जोड़ें ६२.५ µ एल के 10 मिलीग्राम/एमएल RNase एक, मिश्रण, और ३७ डिग्री सेल्सियस पर 30 मिनट के लिए मशीन ।
  3. जोड़ें ३०० µ एल के 10 मिलीग्राम/एमएल Proteinase कश्मीर, मिश्रण, और ३७ डिग्री सेल्सियस पर 30 मिनट के लिए मशीन ।
  4. ६५ ° c से कम 4 एच. ओ.// निंनलिखित सुबह, 10 मिलीग्राम/एमएल Proteinase कश्मीर, मिश्रण, और ६५ डिग्री सेल्सियस पर 1 ज के लिए मशीन के ३०० µ एल जोड़ें ।

7. डीएनए शुद्धि

  1. TLE बफर के ४३३७.५ µ एल जोड़ें (10 मिमी Tris-एचसीएल पीएच ८.०; ०.१ मिमी EDTA पीएच ८.०) और मिश्रण.
  2. 1 मात्रा जोड़ें (10 मिलीलीटर) phenol पीएच ८.०, भंवर 10 एस के लिए, और आरटी में और २०,००० x g के लिए 3 min. Transfer अपर (जलीय) चरण के 9 मिलीलीटर एक नई ५० मिलीलीटर ट्यूब के लिए ।
    सावधानी: Phenol एक खतरनाक केमिकल है । उपयुक्त स्वास्थ्य और सुरक्षा नियमों का पालन करें ।
  3. शेष जलीय चरण के लिए TLE बफर के 2 मिलीलीटर जोड़ें, 10 एस के लिए भंवर और RT पर और २०,००० x g के लिए 3 min. Transfer चरण ७.२ से नई ट्यूब में जलीय दौर की २.५ मिलीलीटर, अंतिम मात्रा ११.५ मिलीलीटर बना । कम (कार्बनिक) चरण युक्त ट्यूब त्यागें ।
  4. phenol के 1 खंड (११.५ मिलीलीटर) जोड़ें: क्लोरोफॉर्म: isoamyl शराब (25:24:1), 10 एस के लिए भंवर, और आरटी और २०,००० एक्स जी पर केंद्रापसारक 3 मिनट के लिए एक नया ५० एमएल ट्यूब के लिए ऊपरी (जलीय) चरण के 11 मिलीलीटर स्थानांतरण । चरण ७.३ दोहराएँ । अब कुल सैंपल की मात्रा १३.५ एमएल होगी ।
  5. 3 एम सोडियम एसीटेट पीएच ५.२ और ३३.७५ मिलीलीटर बर्फ ठंडा १००% इथेनॉल, मिश्रण, के १.३५ मिलीलीटर जोड़ें, और पर-८० ° c-४५ मिनट, या वैकल्पिक रूप से रात भर के लिए-20 डिग्री सेल्सियस ।
  6. 4 डिग्री सेल्सियस और 10 मिनट के लिए २०,००० x g पर केंद्रापसारक, हटाने supernatant, फिर से 1 मिलीलीटर में गोली निलंबित हौसले से तैयार ७०% (vol/) इथेनॉल, और एक नई ट्यूब के लिए स्थानांतरण ।
  7. 4 डिग्री सेल्सियस पर और एक benchtop केंद्रापसारक में 3 मिनट के लिए पूर्ण गति से पर केंद्रापसारक, तो supernatant हटा दें ।
  8. फिर से 1 बर्फ ठंडा ७०% (vol/इथेनॉल और दोहराएं ७.७ कदम के एमएल में गोली सस्पेंड । 10 मिनट के लिए ३७ ° c पर गोली सूखी और TLE बफर के ६५० µ एल में फिर से निलंबित । एक प्रतिदीप्ति आधारित परख का उपयोग करके डीएनए उपज का निर्धारण डबल-असहाय डीएनए यों तो ।
    नोट: प्रोटोकॉल स्नैप ठंड के द्वारा यहां रोका जा सकता है और समय की एक छोटी अवधि के लिए कई महीनों या पर-20 डिग्री सेल्सियस के लिए नमूना पर-८० ° c भंडारण ।

8. गुणवत्ता नियंत्रण

  1. निगरानी पुस्तकालय अखंडता और डीएनए ट्रो द्वारा बंधाव । भागो २०० एक ०.८% agarose/1x TBE जेल पर पुस्तकालय के एनजी । डीएनए 10 केबी से अधिक एक बैंड के रूप में चलाना चाहिए ।
  2. पारंपरिक पीसीआर द्वारा ज्ञात सेल-प्रकार के अपरिवर्तनीय लघु और लंबी दूरी की बातचीत का पता लगाएं । का प्रयोग करें १०० पीसीआर प्रतिक्रिया के प्रति टेंपलेट डीएनए के एनजी । पीसीआर प्राइमरों के करीब और ऊपर दिए गए निर्देशों का पालन प्रतिबंध साइटों की ओर डिजाइन (3.7.1 देखें) । माउस और मानव उच्च सी पुस्तकालयों की गुणवत्ता नियंत्रण के लिए प्राइमर दृश्यों तालिका 1में सूचीबद्ध हैं ।
  3. भरण और बंधाव नियंत्रण: जेल amplicons नियंत्रण ८.२, जेल निकालने डीएनए से युक्त बैंड में कटौती, और समान प्राइमर संयोजन के साथ 4 व्यक्तिगत पीसीआर प्रतिक्रियाओं के लिए टेम्पलेट के रूप में डीएनए का उपयोग करें ।
    1. पीसीआर शुद्धिकरण किट का उपयोग करके amplicons को शुद्ध करें और डीएनए एकाग्रता को बढ़ाता है ।
    2. चार पाचन प्रतिक्रियाओं तैयार (हिनdIII [एक], NheI [बी], हिनdIII + NheI [सी] और कोई एंजाइम [डी]) के एक अंतिम खंड में प्रत्येक amplicon के लिए 15 µ l: ५०० एनजी के amplicon, १.५ µ एल के 10x प्रतिबंध बफर २.१, ०.१५ µ एल के 10 मिलीग्राम/एमएल गोजातीय सीरम एल्ब्युमिन (100x BSA) , और ०.१ µ l (10 इकाइयां) के एंजाइम (हिनdIII [क], NheI [ख], हिनdIII + NheI [ग] या जल [डी]) ।
    3. ३७ ° c पर 1 ज के लिए डाइजेस्ट, फिर एक १.५% पर पाचन प्रतिक्रियाओं भागो (wt/vol) agarose/1x TBE जेल ।

9. डीएनए विखंडन

  1. स्थानांतरण ५०.५ एक नई ट्यूब में नमूना के µ जी और ६५५ µ एल के एक अंतिम खंड के लिए TLE बफर जोड़ें 5 sonication शीशियों में ( सामग्री की तालिकादेखें) १३० µ एल जोड़ने के द्वारा पुस्तकालय (10 µ जी) प्रत्येक शीशी के लिए । कतरनी एक अल्ट्रा में ~ ४०० बीपी के एक आकार के लिए-sonicator ( सामग्री की तालिकादेखें) निंनलिखित मापदंडों का उपयोग: शुल्क फैक्टर: 10%; पीक घटना शक्ति (डब्ल्यू): १४०; फट प्रति चक्र: २००; समय: ५५ s ।
  2. एक ताजा 2 मिलीलीटर ट्यूब में sonicated नमूना ले लीजिए ।

10. डबल पक्षीय SPRI-मनका आकार चयन

  1. मिश्रण SPRI (ठोस चरण प्रतिवर्ती स्थिरीकरण) मनका समाधान अच्छी तरह से पलटने से, एक नई ट्यूब के लिए मनका समाधान के १.८५ मिलीलीटर हस्तांतरण और 15 मिनट के लिए आर टी लाने के लिए ।
  2. जोड़ें ३५० µ पानी की एल (आणविक जीवविज्ञान ग्रेड) नमूना (अंतिम मात्रा 1 मिलीलीटर) ।
  3. नमूना के लिए SPRI मनका समाधान के ६०० µ l जोड़ें (कुल मात्रा १.६ मिलीलीटर; डीएनए के लिए SPRI समाधान का अनुपात: ०.६ के लिए 1), आरटी पर 5 मिनट के लिए मशीन, और 2 के लिए एक benchtop केंद्रापसारक में स्पिन के नमूने-3 एस के लिए नमूना इकट्ठा ।
  4. ढक्कन खोलें, 5 मिनट के लिए चुंबकीय जुदाई स्टैंड पर नमूना जगह एक नया ट्यूब में स्पष्ट supernatant हस्तांतरण और मोतियों को त्यागें ।
  5. दूसरा आकार चयन कदम के लिए SPRI मोती ध्यान लगाओ: स्थानांतरण ९३० µ एल SPRI मोतियों की एक नई ट्यूब में, 5 मिनट के लिए चुंबकीय जुदाई स्टैंड पर जगह है और स्पष्ट supernatant त्यागें । SPRI मनका समाधान के ३१० µ एल में मोतियों को फिर से निलंबित ।
  6. ३०० µ एल केंद्रित SPRI मोती (चरण १०.५) के नमूने के लिए जोड़ें (कुल मात्रा १.९ मिलीलीटर; अनुपात SPRI समाधान डीएनए के लिए है अब ०.९ करने के लिए 1), 5 मिनट के लिए आर टी पर मशीन, और एक benchtop केंद्रापसारक में स्पिन नमूना 2 के लिए-3 एस. ध्यान से ढक्कन खोलो , 5 मिनट के लिए चुंबकीय जुदाई स्टैंड पर ट्यूब जगह है, और supernatant त्यागें ।
  7. नए सिरे से तैयार ७०% इथेनॉल के 1 मिलीलीटर जोड़ें (vol/चुंबकीय जुदाई स्टैंड पर नमूना ट्यूब करने के लिए, 30 एस के लिए मशीन, और supernatant त्यागें । दोहराएं दो बार ।
  8. एक thermomixer में ३७ डिग्री सेल्सियस पर सूखी मोती (ट्यूब ढक्कन खुला) से अधिक नहीं 5 मिनट के लिए TLE बफर के ३०० µ एल जोड़ें नमूना, मिश्रण, और कमरे के तापमान पर 10 मिनट के लिए मशीन ।
  9. 2 के लिए एक benchtop केंद्रापसारक में स्पिन नमूना-3 एस, ढक्कन खोलने के लिए और चुंबकीय जुदाई पर ट्यूब जगह एक नया ट्यूब में स्पष्ट supernatant 5 मिनट के लिए खड़े हो जाओ और मोतियों को त्यागें ।

11. बायोटिन/Streptavidin पुल-बंधाव उत्पादों के नीचे

  1. बफ़र्स तैयार करें: 1x टीबी बफर (5 मिमी Tris-एचसीएल पीएच ८.०; 0.5 मिमी EDTA; 1 M NaCl; ०.०५% के बीच 20); 2x एनटीबी बफर (10 मिमी Tris-एचसीएल पीएच ८.०; 1 मिमी EDTA; 2 एम NaCl); 1x एनटीबी बफर (5 एमएम Tris-एचसीएल नं० ८.०; ०.५ एमएम EDTA; 1 एम NaCl) ।
  2. चुंबकीय streptavidin के २०० µ एल जोड़ें-युग्मित मोती एक नई ट्यूब में ( सामग्री की तालिकादेखें), यह 1 मिनट के लिए चुंबकीय जुदाई स्टैंड पर जगह है और supernatant हटा दें ।
  3. 1x टीबी बफर के ५०० µ एल के साथ दो बार मोतियों को धो लें ।
    1. प्रत्येक धोने कदम के लिए बायोटिन pull-डाउन के दौरान, अंत मरंमत और गैर में बायोटिन की हटाने-ligated डीएनए समाप्त होता है, dATP पूंछ, और अनुकूलक बंधाव कदम, इसी बफर में मोतियों को फिर से निलंबित, आरटी और 15 rpm को 3 मिनट के लिए घुमाएं, एक benchtop केंद्रापसारक में ट्यूब स्पिन 2 – 3 के लिए एस, 3 मिनट के लिए चुंबकीय जुदाई स्टैंड पर ट्यूब जगह है और supernatant को दूर ।
  4. फिर से सस्पेंड ३०० µ में मोती 2x एनटीबी बफर के एल । मिक्स मोती और नमूना (६०० µ एल कुल मात्रा) और 15 मिनट के लिए आर टी पर एक घूर्णन व्हील पर 3 rpm पर मशीन ।
  5. 3 मिनट के लिए चुंबकीय जुदाई खड़े हो जाओ पर पुनः प्राप्त मोती और स्पष्ट supernatant हटा दें । ५०० µ में दो बार मोतियों की माला 1x एनटीबी बफर के पहले और फिर २०० 1x बंधाव बफर के µ एल में । फिर से ५० µ में मोतियों को निलंबित 10x बंधाव बफर के एल ।

12. अंत मरंमत और गैर ligated डीएनए समाप्त होता है पर बायोटिन की हटाने

  1. नमूना (कुल में ५० µ l का मिश्रण) के साथ ५० µ l के २.५ mm dNTP मिश्रण (१२.५ µ l के 10 मिमी प्रत्येक dNTP), १८.१ µ l की ३,००० u/एमएल टी-4 डीएनए पोलीमरेज़, १८.१ µ एल के १०,००० u/एमएल टी-4 PNK, ३.७ µ एल के ५,००० यू/एमएल डीएनए पोलीमरेज़ मैं बड़ा (Klenow) टुकड़ा , और ३६०.१ µ l के ज2हे.
  2. मिश्रण और 1 एच के लिए 20 डिग्री सेल्सियस पर गर्मी, ७०० rpm पर 5 एस एक thermomixer में हर 2 मिनट मिलाते हुए ।
  3. चुंबकीय जुदाई खड़े हो जाओ पर पुनः प्राप्त मोती, स्पष्ट supernatant निकालें, और ५०० µ में दो बार मोती 1x टीबी बफर के एल धो लो ।
  4. 1x एनटीबी बफर के ५०० µ एल में धोने मोती, 1x TLE के ५०० µ एल में एक धोने के बाद ।
  5. चुंबकीय जुदाई खड़े हो जाओ पर पुनः प्राप्त मोती, स्पष्ट supernatant निकालें, और फिर से ४१५ µ में मोतियों को निलंबित 1x TLE बफर के एल ।

13. dATP मासा

  1. नमूना (४१५ µ एल) 10x प्रतिबंध बफर 2, 5 µ एल के 10 मिमी dATP के ५० µ एल के साथ गठबंधन, और 30 µ एल के 5 यू/µ एल Klenow exo-ऋण ।
  2. मिश्रण और 30 मिनट के लिए ३७ ° c में गर्मी, ७०० rpm पर 5 एस एक thermomixer में हर 2 मिनट मिलाते हुए ।
  3. चुंबकीय जुदाई खड़े हो जाओ पर पुनः प्राप्त मोती, स्पष्ट supernatant निकालें, और ५०० µ में दो बार मोती 1x टीबी बफर के एल धो लो ।
  4. ५०० µ में धो मोती 1x एनटीबी बफर के एल ।

14. एडेप्टर बंधाव

  1. २०० µ में धो मोती 1x बंधाव प्रतिक्रिया बफर के एल ( सामग्री की तालिकादेखें) ।
  2. फिर से निलंबित २०० µ में मोती 1x बंधाव प्रतिक्रिया बफर के एल । DNA ligase के 4 µ l को जोड़ें ( सामग्री की तालिकादेखें) और 16 µ l के 15 µ m प्री-annealed पे एडेप्टर्स (प्री-ऐनी द पे एडाप्टर पीई अनुकूलक 1 और पीई अनुकूलक 2 के बराबर संस्करणों को मिलाकर (दोनों 30 µ मीटर पर) और आरटी पर कुछ मिनट के लिए मशीनिंग) । 15 मिनट के लिए आर टी पर मशीन ।
  3. चुंबकीय जुदाई खड़े हो जाओ पर पुनः प्राप्त मोती, स्पष्ट supernatant निकालें, और ५०० µ में दो बार मोती 1x टीबी बफर के एल धो लो ।
  4. ५०० µ में धो मोती 1x एनटीबी बफर के एल । फिर, 1x प्रतिबंध बफर 2 के १०० µ एल में मोती धो, 1x प्रतिबंध बफर 2 के ५० µ एल में फिर से निलंबित मोती, और एक नया ट्यूब में स्थानांतरण ।

15. हाय-सी पुस्तकालय प्रवर्धन

  1. तैयार करें पीसीआर मास्टर मिक्स: १०० µ 5x Phusion बफर के एल; 6 µ l के 25 µ m पे पीसीआर प्राइमरी १.०; 6 µ l के 25 µ m पे पीसीआर प्राइमरी २.०; dNTP मिश्रण के 14 µ l (10 मिमी प्रत्येक); 6 µ l के Phusion पोलीमरेज़; ३१८ µ एल के एच2ओ.
  2. (कुल में ५०० µ एल) मोतियों के साथ मिक्स पीसीआर मास्टर मिक्स, ५० µ एल के 10 aliquots में विभाजित है, और पीसीआर द्वारा बढ़ाना निम्नलिखित स्थितियों का उपयोग:
    30 ९८ डिग्री सेल्सियस पर
    के 7 चक्र: 10 ९८ डिग्री सेल्सियस पर एस; ६५ डिग्री सेल्सियस पर 30 एस; 30 ७२ डिग्री सेल्सियस पर एस
    ७२ डिग्री सेल्सियस पर 7 मिनट
  3. एक नया ट्यूब में पीसीआर प्रतिक्रियाओं लीजिए, चुंबकीय जुदाई खड़े हो जाओ पर मोती पुनः प्राप्त, और एक नई ट्यूब में supernatant (५०० µ एल) हस्तांतरण ।
  4. SPRI मोतियों का उपयोग कर पुस्तकालय डीएनए शुद्ध ।
    1. मिश्रण SPRI मोती, एक नई ट्यूब में मोतियों की ४६० µ एल स्थानांतरण, और 15 मिनट के लिए आर टी लाने के लिए SPRI मोती के ४५० µ एल जोड़ें पीसीआर प्रतिक्रियाओं (अंतिम मात्रा ९५० µ एल), आरटी पर 5 मिनट के लिए मशीन, और 2 के लिए एक benchtop केंद्रापसारक में स्पिन नमूना-3 एस के लिए नमूना इकट्ठा ।
    2. ढक्कन खोलें, 5 मिनट के लिए चुंबकीय जुदाई स्टैंड पर नमूना जगह है, और supernatant हटा दें ।
    3. चुंबकीय जुदाई पर मोती रखते हुए खड़े हो जाओ, ७०% इथेनॉल के 1 मिलीलीटर (vol/मोती के एक क्षेत्र से अधिक नमूना ट्यूब को जोड़ने के लिए, 30 एस के लिए छोड़ दो, और supernatant त्यागें ।
    4. दोहराएं चरण 15.4.3 दो बार अधिक ।
    5. कोई अधिक से अधिक 5 मिनट के लिए एक thermomixer (ट्यूब ढक्कन खुला) में ३७ डिग्री सेल्सियस पर सूखी मोती ।
    6. नमूना, मिश्रण करने के लिए TLE बफर के ५१ µ एल जोड़ें, और ३७ डिग्री सेल्सियस पर 10 मिनट के लिए मशीन, एक thermomixer में ९५० rpm में मिलाते हुए ।
    7. 2 के लिए एक benchtop केंद्रापसारक में स्पिन नमूना-3 एस, ढक्कन खोलने के लिए और चुंबकीय जुदाई पर ट्यूब जगह एक नया ट्यूब में स्पष्ट supernatant 5 मिनट के लिए खड़े हो जाओ और मोतियों को त्यागें ।
    8. हाय-सी पुस्तकालय की एकाग्रता को बढ़ाता है । पीसीआर प्रवर्धन के 7 राउंड के बाद, हम नियमित रूप से 500-उच्च सी पुस्तकालय के एनजी-1500 प्राप्त करते हैं ।

16. संकर में समाधान पर कब्जा

नोट: अवरोधक और बफ़र (SHS1-4) समाधान नीचे SureSelect किट से है ( सामग्री की तालिकादेखें) ।

  1. स्थानांतरण ५०० एक नई ट्यूब में उच्च सी पुस्तकालय के 1 µ जी के लिए एनजी और एक निर्वात संकेन्द्रित पर नमूना लुप्त हो जाना ( सामग्री की तालिकादेखें; ४५ ° c; वैक्यूम दबाव: स्तर ३०.०, रैंप 5) सूखी जब तक ।
  2. Re-सस्पेंड एच2ओ (आणविक जीवविज्ञान ग्रेड) के ३.६ µ एल जोड़कर काफूर हाय-सी पुस्तकालय, ब्लॉकर 1, २.५ µ एल के २.५ µ एल, और कस्टम अवरोधक के ०.६ µ एल.
  3. एक नई पीसीआर ट्यूब पट्टी के एक कुआं में नमूना हस्तांतरण, एक पीसीआर कैप पट्टी और बर्फ पर जगह के साथ बंद । लेबल के रूप में "डी" (हाय-सी डीएनए के लिए) ।
  4. संकरण बफ़र तैयार करें: १२.५ µ l के SHS1 बफ़र; SHS2 बफर के ०.५ µ l; SHS3 बफर के 5 µ l; ६.५ µ l के SHS4 बफर.
  5. एक thermomixer में 5 मिनट के लिए ६५ ° c पर मशीन । एक नई पीसीआर ट्यूब पट्टी के एक कुआं में स्थानांतरण, एक पीसीआर कैप पट्टी के साथ बंद है और आरटी. लेबल में रखने के रूप में "एच" (संकरण बफर के लिए) ।
  6. एक नई पीसीआर ट्यूब पट्टी के एक कुआं में, मिश्रण 5 µ एल के १०० एनजी/µ एल biotinylated आरएनए जांच (स्टोर पर-८० डिग्री सेल्सियस और गल बर्फ पर बस का उपयोग करने से पहले); ०.५ µ एल ऑफ SRNase बी (RNase अवरोधक) और १.५ µ एल के एच2ओ (आणविक जीवविज्ञान ग्रेड).
  7. एक पीसीआर कैप स्ट्रिप और बर्फ पर जगह के साथ पीसीआर ट्यूब पट्टी बंद करें । लेबल के रूप में "आर" (आरएनए के लिए).
  8. निंनलिखित मापदंडों का उपयोग कर पीसीआर मशीन स्थापित करें:
    ९५ डिग्री सेल्सियस पर 5 मिनट; ६५ ° c पर 25 ज; ढक्कन गरम; 29 µ l पीसीआर प्रतिक्रिया मात्रा ।
    नोट: नमूना वाष्पीकरण से बचने के क्रम में पीसीआर मशीन चल रहा है, जबकि सभी प्रक्रियाओं के दौरान जितनी जल्दी हो सके आगे बढ़ें ।
  9. पीसीआर मशीन में ' डी ' पीसीआर ट्यूब स्ट्रिप लगाएं, पीसीआर मशीन का ढक्कन बंद करें, और पीसीआर रिएक्शन शुरू करें । जब पीसीआर प्रोग्राम ६५ डिग्री सेल्सियस तक पहुंचता है तो पीसीआर मशीन का ढक्कन खोलें और पीसीआर मशीन में "एच" पीसीआर ट्यूब स्ट्रिप लगाएं । पीसीआर मशीन ढक्कन बंद करो और 3 मिनट के लिए मशीन । पीसीआर मशीन का ढक्कन खोलकर, पीसीआर मशीन पर "आर" पीसीआर ट्यूब स्ट्रिप लगाएं, और पीसीआर मशीन को बंद कर ।
  10. 2 मिनट के बाद पीसीआर मशीन का ढक्कन और सभी पीसीआर ट्यूब स्ट्रिप्स को खोलें । अच्छी तरह से "एच" अच्छी तरह से "आर" में 13 µ एल स्थानांतरण, तो अच्छी तरह से "डी" अच्छी तरह से "आर" में सभी मात्रा । प्लास्टिक ऊपर और नीचे 3 बार प्रतिक्रिया मिश्रण करने के लिए, पीसीआर ट्यूब पट्टी बंद करो, "एच" और "डी" पीसीआर ट्यूब स्ट्रिप्स को हटा दें, और बंद पीसीआर मशीन ढक्कन । ६५ ° c पर प्रतिक्रिया गर्मी 24 एच के लिए

17. अलगाव के प्रवर्तक टुकड़ा युक्त बंधाव उत्पादों

नोट: निम्नलिखित चरणों SureSelect एडाप्टर किट और पुस्तकालय के साथ किया जा करने के लिए सिफारिश कर रहे हैं ( Materals की तालिकादेखें).

  1. अग्रिम में ६५ डिग्री सेल्सियस पर प्रति नमूना 2 धोने बफर के पूर्व गर्म १.५ मिलीलीटर ।
  2. जोड़ें ६० µ एल के streptavidin-युग्मित चुंबकीय मोती ( सामग्री की तालिकादेखें) में एक नया ट्यूब, जगह के लिए चुंबकीय जुदाई स्टैंड पर 1 मिनट और हटाने supernatant.
  3. धो मोती 1x बाध्यकारी बफर के २०० µ एल के साथ तीन बार ।
    नोट: के बाद एक धोने कदम के दौरान प्रमोटर-बंधाव उत्पादों से युक्त अलगाव-कब्जा, फिर से इसी बफर में मोतियों को सस्पेंड, आरटी में 3 मिनट और एक घूर्णन पहिया पर 15 rpm के लिए घुमाएगी, धीरे एक benchtop में ट्यूब स्पिन के लिए 2-3 एस इकट्ठा करने के लिए नमूना, 3 मिनट के लिए चुंबकीय जुदाई खड़े पर ट्यूब जगह है, और supernatant को हटा दें ।
  4. फिर से सस्पेंड २०० µ में मोती 1x बाध्यकारी बफर के एल । पीसीआर मशीन और पीसीआर ट्यूब स्ट्रिप खोलें (जबकि पीसीआर कार्यक्रम अभी भी चल रहा है) और चुंबकीय मोतियों के साथ ट्यूब में संकरण प्रतिक्रिया हस्तांतरण । 30 मिनट के लिए आरटी में 3 rpm पर एक घूर्णन व्हील पर मशीन ।
  5. चुंबकीय जुदाई स्टैंड पर पुनः प्राप्त मोती और स्पष्ट supernatant हटा दें । Re-reसस्पेंड ५०० µ एल धोने बफर 1, मिश्रण, और 20 ° c में 15 मिनट के लिए मशीन जबकि एक thermomixer में ९५० rpm में मिलाते में मोतियों की ।
  6. 3 मिनट के लिए चुंबकीय जुदाई खड़े हो जाओ पर पुनः प्राप्त मोती और स्पष्ट supernatant हटा दें । पुनः धो बफर 2 के ५०० µ एल में मोतियों को सस्पेंड, मिश्रण और ६५ डिग्री सेल्सियस पर 10 मिनट की मशीन जबकि एक thermomixer में ९५० rpm में मिलाते हुए । दोहराएं चरण १७.५ दो बार अधिक ।
  7. चुंबकीय जुदाई खड़े हो जाओ पर पुनः प्राप्त मोती, स्पष्ट supernatant को हटाने और २०० µ एल 1x प्रतिबंध बफर 2 में पुन: निलंबित मोतियों । चुंबकीय जुदाई खड़े हो जाओ पर पुनः प्राप्त मोती, supernatant हटाने और फिर से निलंबित मोती 1x प्रतिबंध बफर 2 के 30 µ एल में ।

18. PCHi-सी पुस्तकालय प्रवर्धन

  1. तैयार करें पीसीआर मास्टर मिक्स: ६० µ 5x पीसीआर बफर (Phusion बफर) के एल, ३.६ µ एल के 25 µ एम पे पीसीआर प्राइमरी १.०, ३.६ µ एल के 25 µ एम पे पीसीआर प्राइमरी २.०, ८.४ µ एल ऑफ dNTP मिक्स (10 एमएम प्रत्येक), ३.६ µ एल के Phusion पोलीमरेज़, और एच2ओ के १९०.८ µ एल.
  2. मिक्स पीसीआर मास्टर (कुल में ३०० µ एल) मोतियों के साथ मिश्रण, ५० µ एल के 6 aliquots में विभाजित है, और पीसीआर-बढ़ाना निम्नलिखित शर्तों का उपयोग:
    30 ९८ डिग्री सेल्सियस पर एस
    के 4 चक्र: 10 एस पर ९८ ° c, 30 s at ६५ ° c, 30 s at ७२ ° c
    ७२ डिग्री सेल्सियस पर 7 मिनट
  3. एक नई ट्यूब में सभी पीसीआर प्रतिक्रियाओं लीजिए, चुंबक पर मोतियों को पुनः प्राप्त, और स्थानांतरण supernatant (३०० µ l; शामिल PCHi-C पुस्तकालय) में एक नई ट्यूब के लिए ।
  4. १५.४ के तहत ऊपर बताए गए चरणों का पालन करते हुए, SPRI मोतियों का उपयोग करके PCHi-सी लाइब्रेरी को शुद्ध करें ।
  5. PCHi-सी पुस्तकालय की एकाग्रता को बढ़ाता है ।

Representative Results

प्रमोटर कैप्चरहाय-सी माउस को समृद्ध करने के लिए इस्तेमाल किया गया है7,३४,३६,३९ और मानव३३,३५,३७,३८ हाय-सी पुस्तकालयों के लिए प्रमोटर बातचीत । एक समान प्रोटोकॉल (नाम HiCap) Sandberg समूह४०द्वारा वर्णित किया गया है । चित्र 1a प्रवर्तक कैप्चर हाय-सी के लिए योजनाबद्ध कार्यप्रवाह दिखाता है. प्रोटोकॉल में यहां वर्णित, उच्च सी पुस्तकालयों में नाभिक बंधाव४१, जो नकली बंधाव उत्पादों४२की एक काफी कम संख्या में परिणाम का उपयोग कर उत्पंन कर रहे हैं । PCHi-सी के लिए, अत्यधिक जटिल माउस या मानव हाय-सी पुस्तकालयों में समाधान संकरण और कब्जा करने के लिए अधीन हैं ३९,०२१ biotinylated RNAs पूरक के लिए २२,२२५ माउस प्रमोटर-युक्त HindIII प्रतिबंध टुकड़े, या ३७,६०८ biotinylated RNAs लक्ष्यीकरण २२,०७६ मानव प्रमोटर-युक्त HindIII प्रतिबंध टुकड़े, क्रमशः । प्रतिबंध अंशों वाले प्रवर्तक को व्यक्तिगत biotinylated RNAs (आरेख 1b) द्वारा या तो या दोनों सिरों पर टार्गेट किया जा सकता है । हमने पाया है कि दोनों का कब्जा व्यक्तिगत प्रवर्तकों के बेहतर कवरेज समाप्त होता है (चित्रा 1C, कच्चे अनुक्रम पढ़ता है) लगभग दो गुना, के रूप में की उंमीद है । इस प्रकार, जब भी संभव हो (यानी, गैर-दोहराए क्षेत्रों में), हम biotinylated RNAs का उपयोग करने के लिए एक प्रतिबंध टुकड़ा के दोनों सिरों को पूरक पर कब्जा करने की सलाह ।

पुस्तकालय की तैयारी के दौरान एक प्रारंभिक चरण में PCHi-सी पुस्तकालय की गुणवत्ता का आकलन करने के लिए, हम डीएनए बंधाव और शुद्धि के बाद दो नियंत्रण प्रदर्शन, के रूप में पहले31वर्णित. पहले 3 सी27में के रूप में बंधाव उत्पादों बढ़ाना करने के लिए विशिष्ट प्राइमरी जोड़े का उपयोग करने के लिए है । हम प्राइमरी जोड़े (तालिका 1) का उपयोग करने के लिए सेल प्रकार अपरिवर्तनीय लंबी दूरी की बंधाव उत्पादों, जैसे Myc जीन और इसके ज्ञात बढ़ाने के बीच लगभग 2 एमबी दूर स्थित (चित्रा 2a) या Hist1 लोकस के जीन के बीच १.५ Mb से अलग), और दो बंद रेखीय निकटता (' शॉर्ट-रेंज नियंत्रण ') में स्थित क्षेत्रों के बीच ।

दूसरी गुणवत्ता नियंत्रण बाहर किया जाता है Klenow-मध्यस्थता भरने के दौरान बायोटिन शामिल करने की क्षमता का निर्धारण करने के लिए प्रतिबंध साइट के बायोटिन-dATP के साथ फांसी पर लटका । सफल Klenow भरने और बाद में कुंद-अंत एक बंधाव उत्पाद के डीएनए अणुओं के बीच मूल प्रतिबंध साइट के गायब होने में बंधाव परिणाम, और एक नई NheI मांयता साइट के गठन में HindIII के मामले में (चित्रा बी ). NheI पचता बंधाव उत्पाद के लिए HindIII का अनुपात बायोटिन शामिल करने की क्षमता का एक सीधा readout है । एक गरीब गुणवत्ता हाय-सी पुस्तकालय HindIII पाचन के एक उच्च स्तर दिखाएगा, जबकि उच्च गुणवत्ता वाले पुस्तकालयों बंधाव उत्पादों (चित्रा बी) के पास पूरा NheI पाचन है ।

उच्च सी पुस्तकालय की तैयारी के बाद (यानी, बायोटिन-streptavidin के बाद आकार-चयनित हाय-सी बंधाव उत्पादों, अनुकूलक बंधाव और पूर्व कैद पीसीआर के नीचे खींच), अखंडता और उच्च सी पुस्तकालय के आकार वितरण के द्वारा मूल्यांकन किया जाता है-विश्लेषक (चित्रा 2c). एक ही नियंत्रण PCHi-सी पुस्तकालय की तैयारी के अंत में किया जाता है (यानी, प्रमोटर युक्त बंधाव उत्पादों और बाद में कैद पीसीआर के संकरण कब्जा करने के बाद) । हाय-सी और PCHi-सी की तुलना विश्लेषक प्रोफाइल से पता चलता है कि के रूप में की उंमीद है, उच्च सी पुस्तकालयों इसी PCHi-सी पुस्तकालयों से ज्यादा केंद्रित कर रहे हैं, लेकिन पुस्तकालयों के आकार वितरण अत्यधिक समान है, यह दर्शाता है कि कब्जा कदम में PCHi-सी एक आकार पूर्वाग्रह (चित्रा 2c डी) परिचय नहीं है ।

युग्मित-अंत अनुक्रमण के बाद, PCHi-C पढ़ता मैप किए गए हैं, गुणवत्ता नियंत्रित और HiCUP पाइपलाइन४३का उपयोग कर फ़िल्टर किया गया । उच्च गुणवत्ता PCHi-सी पुस्तकालयों 70-90% के बीच होते हैं ' मान्य जोड़े ' (यानी, युग्मित अंत अनुक्रम रेखीय जीनोमिक नक्शे पर पड़ोसी नहीं हैं कि दो प्रतिबंध टुकड़े के बीच पढ़ता है; चित्र 3 ए, बी) । में नाभिक बंधाव प्रोटोकॉल४१,४२का उपयोग करना, ट्रांस पढ़ें जोड़े का प्रतिशत (यानी, युग्मित अंत अनुक्रम दो प्रतिबंध टुकड़े कि अलग गुणसूत्रों पर स्थित है के बीच पढ़ता है) आम तौर पर कम कर रहे हैं, 5 और 25% के बीच, गुणसूत्र क्षेत्रों के अस्तित्व को दर्शाती है, और अच्छी पुस्तकालय गुणवत्ता का संकेत है । हाय-सी पुस्तकालयों और उनके इसी PCHi-सी पुस्तकालयों३५के बीच ' मान्य जोड़े ' के प्रतिशत की प्रत्यक्ष तुलना, पता चलता है कि सभी मामलों में मान्य जोड़े का प्रतिशत PCHi-सी पुस्तकालयों में अधिक है (चित्र बी). यह गैर-मान्य ' समान अंश आंतरिक ' के प्रतिशत में कमी के साथ है PCHi-C (चित्र 3सी) में पढ़ता है । इस कैप्चर चरण न केवल promotion-युक्त बंधाव उत्पादों के लिए समृद्ध करता है, लेकिन यह भी प्रतिबंध अंश समाप्त होता है के लिए, प्रतिबंध अंशों पर कैप्चर ओलिगोस्पर्मिया की स्थिति के कारण ( चित्र 1bदेखें) के रूप में यह अपेक्षित है ।

HiCUP फ़िल्टरिंग के बाद, हम कैप्चर दक्षता निर्धारित करते हैं । PCHi-C लायब्रेरीज़ HiCUP फ़िल्टरिंग के बाद तीन प्रकार के मांय अनुक्रम पढ़ता है:
1.) प्रवर्तक: जीनोम पढ़ताहै (यानी, एक पर कब्जा कर लिया प्रमोटर टुकड़ा और एक गैर प्रमोटर HindIII प्रतिबंध टुकड़ा के बीच कहीं भी जीनोम में पढ़ता है)
2.) प्रवर्तक: प्रवर्तक पढ़ता है (दो कैप्चर किए गए प्रमोटर अंशों के बीच पढ़ता है)
3.) जीनोम: जीनोम पढ़ता (पृष्ठभूमि उच्च सी बंधाव उत्पादों जहां न तो बंधाव उत्पाद भागीदारों के एक कब्जा कर लिया प्रमोटर के लिए नक्शे) । इन अनुप्रवाह विश्लेषण करने से पहले छोड़ दिया जाता है ।

उच्च गुणवत्ता वाले PCHi-सी पुस्तकालयों 65-90% (चित्रा 3 डी) के बीच (श्रेणियों 1 और 2 से ऊपर की राशि) पर कब्जा क्षमता है । हाय-सी पुस्तकालयों के लिए एक सीधी तुलना से पता चलता है कि PCHi-c में परिणाम एक ~ 15-संवर्धन बंधाव उत्पादों (चित्रा 3 डी) युक्त, कुछ मामलों में 17 गुना के लिए समृद्धता गुना । यह काल्पनिक अधिकतम (१९.६-गुना) संवर्धन के करीब है PCHi-सी है, जो जीनोम प्रतिबंध कब्जा प्रणाली द्वारा कवर टुकड़े के प्रतिशत पर निर्भर है । अधिक से अधिक संवर्धन कैप्चर सिस्टम कम प्रतिबंध अंश४४,४५,४६लक्ष्यीकरण डिजाइन द्वारा प्राप्त किया जा सकता है ।

प्रमोटर interactomes का विश्लेषण सेल प्रकार और वंश-विशिष्टता३३,३४,३५, सेलुलर विभेद के दौरान स्पष्ट परिवर्तन के साथ प्रदर्शित करता है३७,३८,३९ . आंकड़े 4 और 5 वंश विशिष्टता और विशिष्ट प्रवर्तकों पर भेदभाव गतिशीलता के शो उदाहरण । उदाहरण के लिए, ALAD सभी कोशिकाओं में व्यक्त constitutively है, लेकिन इसकी अभिव्यक्ति erythroblasts४७में विनियमित है । ALAD प्रवर्तक सभी टेम कोशिकाओं में कई बाहर के टुकड़े संपर्क और erythroblasts (चित्रा 4) में विशेष रूप से अतिरिक्त बातचीत में संलग्न है । IL-8 बी कोशिकाओं में कोई सांख्यिकीय महत्वपूर्ण बातचीत, टी कोशिकाओं में बहुत कुछ बातचीत से पता चलता है, लेकिन माइलॉयड वंश की कोशिकाओं में बातचीत के दर्जनों, सेल सहित monocytes, न्यूट्रोफिल और megakaryocytes में विशिष्ट बातचीत प्रकार ( चित्रा 5) । ये उदाहरण प्रदर्शित करता है कि कैसे PCHi-C सेल-प्रकार विशिष्ट interactomes को जानने और नियामक क्षमता के साथ प्रमोटर-सहभागिता क्षेत्रों की पहचान करने के लिए उपयोग किया जा सकता है ।

Figure 1
चित्रा 1 : प्रवर्तक कब्जा हाय-सी तर्क और कब्जा चारा डिजाइन । (क) PCHi की योजनाबद्ध कार्यप्रवाह-सी. में-नाभिक बंधाव हाय-सी४१,४२ (I) में समाधान संकरण के बाद biotinylated आरएनए प्रलोभन (द्वितीय) सभी मानव (यहां चित्रित) या माउस जीन प्रमोटरों (III) के प्रतिबंध टुकड़े लक्ष्यीकरण । (ख) PCHi के लिए चारा डिजाइन-सी. Biotinylated आरएनए कैप्चर चारा (लाल घुमावदार लाइनें) प्रवर्तक-युक्त प्रतिबंध अंशों के सिरों के विरुद्ध डिज़ाइन किए गए हैं (धूसर; ध्यान दें कि प्रवर्तक स्वयं (लाल) अनुक्रम केवल आरएनए कैप्चर प्रलोभन द्वारा लक्षित कर रहे हैं यदि वे प्रतिबंध पर स्थित हैं अंश समाप्त होता है) । बंधाव उत्पादों से मिलकर प्रवर्तक-प्रतिबंध अंशों (धूसर) और उनके इंटरैक्ट प्रतिबंध अंशों (पीला और हरा) के माध्यम से पृथक किए जाते हैं-आरएनए चारा और डीएनए लक्ष्य के बीच अनुक्रम-complementarity संकरण, और बाद में बायोटिन-streptavidin pulldown, जैसा कि ए में दिखाया गया है । (ग) एक आरएनए चारा कब्जा जांच बनाम दो आरएनए चारा कब्जा जांच के द्वारा लक्षित प्रमोटर युक्त प्रतिबंध टुकड़े के लिए PCHi-सी कब्जा दक्षता की तुलना (बी में योजनाबद्ध देखें) । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2 : PCHi-C पूर्व अनुक्रमण गुणवत्ता नियंत्रण । (क) वामपंथी, प्रवर्तक और पीर के बीच स्थानिक मुक़ाबला की योजनाबद्ध, एक उच्च सी बंधाव एक प्रमोटर से मिलकर उत्पाद में जिसके परिणामस्वरूप-प्रतिबंध टुकड़ा (ग्रे; प्रमोटर अनुक्रम लाल में) और एक पीर प्रतिबंध टुकड़ा (पीला) । सही, डीएनए जेल ट्रो उच्च सी बंधाव उत्पादों के उदाहरण दिखा विशिष्ट प्राइमर जोड़े का उपयोग कर परिवर्धित (के रूप में बाईं ओर योजनाबद्ध में चित्रित) । (ख) वाम, HindIII, NheI और HindIII/NheI प्रतिबंध डाइजेस्ट के प्रतिनिधि उदाहरण Hi-C बंधाव उत्पादों (पीसीआर उत्पाद A में दिखाया गया है) । सही, डीएनए अनुक्रम के योजनाबद्ध के बाद उच्च सी बंधाव असफल (ऊपर) या सफल (नीचे) dNTP Klenow भरने के बाद प्रतिबंध जंक्शनों और बाद में बंधाव । (ग) प्रतिनिधि हाय-सी पुस्तकालय विश्लेषक प्रोफाइल (1/5 कमजोर पड़ने) । (डी) प्रतिनिधि PCHi-सी पुस्तकालय विश्लेषक प्रोफाइल (कोई कमजोर पड़ने) । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3 : PCHi-C पोस्ट अनुक्रमण गुणवत्ता नियंत्रण । (एक) प्रतिशत वैध अनुक्रम की तुलना PCHi में HiCUP४३ प्रसंस्करण के बाद जोड़े पढ़ें-सी इसी उच्च सी पुस्तकालयों (Javierre एट अल., २०१६३५से डेटा) बनाम । (ख) प्रतिनिधि HiCUP PCHi-ग परिणाम वैध पढ़ें जोड़े दिखा रहा है, और अंय अनुक्रम श्रेणियों है कि बहाव विश्लेषण से पहले छोड़ दिया जाता है (Javierre एट अलसे डेटा, २०१६३५) । (ग) ' प्रतिशत ही टुकड़ा ' आंतरिक की तुलना PCHi में HiCUP प्रोसेसिंग-सी इसी Hi-c पुस्तकालयों बनाम (डेटा Javierre एट अल., २०१६३५से) के बाद पढ़ता है । (घ) प्रतिशत अनुक्रम की तुलना PCHi में चारा पाऊडर टुकड़े (कब्जा दक्षता) शामिल पढ़ता-सी इसी हाय-सी पुस्तकालयों (Javierre एट अल., २०१६३५से डेटा) । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्रा 4: मानव टेम कोशिकाओं में ALAD PCHi-सी प्रोफाइल । माइलॉयड सेल प्रकार के प्रमोटर बातचीत नीले मेहराब के रूप में दिखाए जाते हैं, और लसीकावत् सेल प्रकार के प्रमोटर बातचीत बैंगनी मेहराब के रूप में दिखाए जाते हैं । Erythroblast-विशिष्ट बातचीत लाल तीर (Javierre एट अल., २०१६३५से डेटा) द्वारा संकेत दिया जाता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 5
चित्रा 5 : IL8 मानव टेम कोशिकाओं में PCHi-सी शख्सियत. माइलॉयड सेल प्रकार के प्रमोटर बातचीत नीले मेहराब के रूप में दिखाए जाते हैं, और लसीकावत् सेल प्रकार के प्रमोटर बातचीत बैंगनी मेहराब के रूप में दिखाए जाते हैं । Monocyte-विशिष्ट सहभागिताएं हरे तीरों द्वारा इंगित की जाती हैं, न्युट्रोफिल-विशिष्ट इंटरैक्शन लाल तीरों द्वारा दर्शाया जाता है, और एक megakaryocyte-विशिष्ट इंटरैक्शन भूरे रंग के तीर द्वारा दर्शाया जाता है (Javierre एट al., २०१६३५से डेटा). कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

मानव
नाम अनुक्रम गुणसूत्र कतरा Start GRCh38/hg38 समा GRCh38/hg38 प्राइमर संयोजन 3 सी बातचीत और बायोटिन निगमन परीक्षण के लिए
hs AHF64 डेकर GCATGCATTAGCCTCTGCTGTTCTCTGAAATC 11 + ११६८०३९६० ११६८०३९९१ एच एस AHF66 डेकर के साथ संयोजन में प्रयोग करें
hs AHF66 डेकर CTGTCCAAGTACATTCCTGTTCACAAACCC 11 + ११६८१०२१९ ११६८१०२४८ एच एस AHF64 डेकर के साथ संयोजन में प्रयोग करें
hs MYC लोकस GGAGAACCGGTAATGGCAAA 8 - १२७७३३८१४ १२७७३३८३३ एच एस MYC + १८२० या एच एस MYC के साथ संयोजन में प्रयोग करें-५३८
hs MYC + १८२० AAAATGCCCATTTCCTTCTCC 8 + १२९५५४५२७ १२९५५४५४७ एच एस MYC लोकस के साथ संयोजन में प्रयोग करें
एच एस MYC-५३८ TGCCTGATGGATAGTGCTTTC 8 - १२७१९५६९६ १२७१९५७१६ एच एस MYC लोकस के साथ संयोजन में प्रयोग करें
hs HIST1 च AAGCAGGAAAAGGCATAGCA 6 + २६२०७१७४ २६२०७१९३ एच एस HIST1 आर के साथ संयोजन में प्रयोग करें
hs HIST1 R TCTTGGGTTGTGGGACTTTC 6 + २७७७१५७५ २७७७१५९४ एच एस HIST1 एफ के साथ संयोजन में प्रयोग करें
माउस
अनुक्रम गुणसूत्र कतरा Start GRCm38/mm10 समा GRCm38/mm10 प्राइमर संयोजन 3 सी बातचीत और बायोटिन निगमन परीक्षण के लिए
TCATGAGTTCCCCACATCTTTG 8 + ८४८४१०९० ८४८४११११ मिमी Calr2 के साथ संयोजन में प्रयोग करें
CTGTGGGCACCAGATGTGTAAAT 8 + ८४८४८५१९ ८४८४८५४१ मिमी Calr1 के साथ संयोजन में प्रयोग करें
TATCAAGGGTGCCCGTCACCTTCAGC 6 + १२५१६३०९८ १२५१६३१२३ Gapdh4 डेकर के साथ संयोजन में प्रयोग करें
GGGCTTTTATAGCACGGTTATAAAGT 6 + १२५१६३७७४ १२५१६३७९९ Gapdh3 डेकर के साथ संयोजन में प्रयोग करें
GGAGGAGGGAAAAGGAGTGATT 6 + ५२२१२८२९ ५२२१२८५० मिमी Hoxa13 के साथ संयोजन में प्रयोग करें
CAGGCATTATTTGCTGAGAACG 6 - ५२२५३४९० ५२२५३५११ मिमी Hoxa7 के साथ संयोजन में प्रयोग करें
GGGTAATGGTGTCACTAACTGG 13 + २३५७१२८४ २३५७१३०५ मिमी Hist1h3e या मिमी Hist1h4i के साथ संयोजन में प्रयोग करें
GGGTTTGATGAGTTGGTGAAG 13 + २३५६६५४१ २३५६६५६१ मिमी Hist1h2ae के साथ संयोजन में प्रयोग करें
TTGGGCCAAAGCCTATATGA 13 + २२०४३०८५ २२०४३१०४ मिमी Hist1h2ae के साथ संयोजन में प्रयोग करें

तालिका 1: मानव और माउस हाय-सी पुस्तकालयों के गुणवत्ता नियंत्रण के लिए प्राइमर दृश्यों ।

Discussion

प्रमोटर कैप्चर हाय-सी की मॉड्यूलर डिजाइन

प्रमोटर कब्जा हाय-सी विशेष रूप से बढ़ावा देने वाले बातचीत के लिए उच्च सी पुस्तकालयों को समृद्ध बनाया गया है । इन बातचीत में एक उच्च सी पुस्तकालय में मौजूद बंधाव उत्पादों का केवल एक सबसेट शामिल हैं ।

कैप्चर हाय-सी आसानी से कब्जा प्रणाली को बदलकर किसी भी जीनोमिक क्षेत्र या ब्याज के क्षेत्रों के लिए उच्च सी पुस्तकालयों को समृद्ध करने के लिए संशोधित किया जा सकता है । कब्जा क्षेत्रों सतत जीनोमिक खंडों४४,४५,४६,४८, बढ़ाने कि PCHi-सी में पहचान की गई है हो सकता है (' रिवर्स कैप्चर हाय-सी '३५), या DNase मैं अनुभुत साइटें४९ . कैप्चर सिस्टम का आकार प्रायोगिक दायरे के आधार पर समायोजित किया जा सकता है । उदाहरण के लिए, Dryden एट अल. लक्ष्य ५१९ तीन जीन स्तन कैंसर४४के साथ जुड़े रेगिस्तान में चारा टुकड़े । मार्टिन एट अलद्वारा कब्जा प्रणाली । लक्ष्य दोनों सतत जीनोमिक सेगमेंट (' क्षेत्र कैप्चर ': २११ जीनोमिक क्षेत्रों में कुल; २,१३१ प्रतिबंध अंशों) और चयनित प्रवर्तकों (३,८५७ जीन प्रवर्तकों)४५.

SureSelect पुस्तकालयों विभिन्न आकार पर्वतमाला में उपलब्ध हैं: 1 kb से ४९९ kb (5190 – 4806), ५०० केबी करने के लिए २.९ एमबी (5190 – 4816), और 3 एमबी करने के लिए ५.९ एमबी (5190 – 4831). प्रत्येक व्यक्ति को पकड़ने के रूप में बायोटिन-आरएनए १२० न्यूक्लियोटाइड लंबी है, इन कैप्चर सिस्टम क्रमशः ४,१५८, २४,१६६ और ४९,१६६ व्यक्तिगत कब्जा जांच की एक अधिकतम समायोजित । यह २,०७९, १२,०८३, और २४,५८३ लक्षित प्रतिबंध अंशों से मेल खाती है, क्रमशः (ध्यान दें कि प्रतिबंध अंशों के लिए संख्याएं कम सीमा इस धारणा पर आधारित है कि दो व्यक्तिगत कैप्चर जांच हर प्रतिबंध के लिए डिज़ाइन किया जा सकता है टुकड़ा-वास्तव में दोहराव अनुक्रम के कारण यह हर प्रतिबंध अंश के लिए मामला नहीं होगा (यह भी आंकड़ा 1b, C), उपलब्ध कब्जा जांच की एक निरंतर संख्या के लिए लक्षित प्रतिबंध टुकड़े की एक उच्च संख्या में जिसके परिणामस्वरूप ).

प्रोटोकॉल यहां वर्णित एक 6 बीपी मांयता साइट के साथ एक प्रतिबंध एंजाइम के उपयोग के लिए लंबी दूरी की बातचीत को उजागर पर आधारित है । अधिक समीपस्थ बातचीत के अधिक से अधिक संकल्प के लिए एक 4 बीपी पहचान साइट के साथ एक प्रतिबंध एंजाइम का उपयोग भी४०,४९संभव है ।

PCHi-सी की सीमाएं

सभी गुणसूत्र अनुरूप कब्जा परख की एक अंतर्निहित सीमा है कि उनके संकल्प पुस्तकालय पीढ़ी के लिए इस्तेमाल प्रतिबंध एंजाइम द्वारा निर्धारित किया जाता है । एक ही प्रतिबंध अंश पर स्थित डीएनए तत्वों के बीच होने वाले इंटरैक्शन ' C-type ' की परख करने के लिए अदृश्य होते हैं. इसके अलावा, PCHi-सी में, कुछ मामलों में एक से अधिक प्रतिलेखन प्रारंभ साइट एक ही प्रवर्तक-प्रतिबंध अंश युक्त पर स्थित किया जा सकता है, और कुछ मामलों में PIRs दोनों सक्रिय और दमन हिस्टोन के निशान बंदरगाह, यह मुश्किल है जो नियामक को तुच्छ बनाने तत्वों बातचीत मध्यस्थता, और प्रमोटर बातचीत के विनियामक उत्पादन की भविष्यवाणी करने के लिए । 4 बीपी मांयता साइटों के साथ प्रतिबंध एंजाइमों का प्रयोग इस मुद्दे को कम करने पर आता है, लेकिन बेहद बढ़ी हुई हाय-सी पुस्तकालय जटिलता की कीमत पर आती है (4 बीपी पहचान साइट प्रतिबंध एंजाइमों के साथ उत्पंन उच्च सी पुस्तकालयों उच्च से कम १०० बार अधिक जटिल है सी 6 बीपी पहचान साइट प्रतिबंध एंजाइमों के साथ उत्पंन पुस्तकालयों), और अगली पीढ़ी के अनुक्रमण के लिए संबद्ध लागत ।

एक और सीमा है कि वर्तमान PCHi-सी प्रोटोकॉल सामग्री शुरू करने के रूप में कोशिकाओं के लाखों की आवश्यकता है, precluding दुर्लभ कोशिका प्रकार में प्रमोटर बातचीत के विश्लेषण । PCHi के एक संशोधित संस्करण-सी सेल आबादी में प्रमोटर संपर्कों के १०,००० १००,००० कोशिकाओं के साथ पूछताछ के लिए सक्षम करने के लिए (जल्दी भ्रूण विकास या टेम स्टेम सेल के दौरान उदाहरण कोशिकाओं के लिए) इसलिए कब्जा करने के लिए एक मूल्यवान इसके अतिरिक्त होगा हाय-सी toolbox.

अंत में, सभी तरीकों कि formaldehyde निर्धारण पर निर्भर की तरह, PCHi-सी केवल बातचीत कि निर्धारण के समय बिंदु पर ' जमे हुए है ' रिकॉर्ड । इस प्रकार, कैनेटीक्स और प्रमोटर बातचीत की गतिशीलता का अध्ययन करने के लिए, सुपर संकल्प लाइव सेल माइक्रोस्कोपी के रूप में तरीकों PCHi-सी के साथ आवश्यक हैं ।

उच्च रिज़ॉल्यूशन पर स्थानिक गुणसूत्र संगठन को काटना करने के तरीके

गुणसूत्र इंटरेक्शन लाइब्रेरी की विशाल जटिलता सांख्यिकीय महत्व के साथ दो विशिष्ट प्रतिबंध अंशों के बीच इंटरैक्शन उत्पादों की विश्वसनीय पहचान प्रतिबंधित करती है. इस समस्या को दरकिनार करने के लिए, अनुक्रम कैप्चर को या तो हाय-सी३३,३४,४०,४४ या 3 सी५०,विशिष्ट बातचीत के लिए५१ पुस्तकालयों को समृद्ध करने के लिए इस्तेमाल किया गया है । संवर्धन कदम के लिए 3 सी पुस्तकालयों पर हाय-सी पुस्तकालयों का उपयोग करने का प्रमुख लाभ यह है कि 3 सी के विपरीत हाय-सी, वास्तविक बंधाव उत्पादों के लिए एक संवर्धन कदम भी शामिल है । एक परिणाम के रूप में, मांय का प्रतिशत PCHi-सी पुस्तकालयों में पढ़ता है लगभग 10-कब्जा की तुलना में अधिक गुना-सी पुस्तकालयों५०, जो 5 के आसपास समाहित-8% मांय HiCUP फ़िल्टरिंग के बाद पढ़ता है । Sahlen एट अल. सीधे कब्जा-सी की तुलना में HiCap, जो PCHi-सी की तरह कब्जा संवर्धन के लिए हाय-सी पुस्तकालयों का उपयोग करता है, इसके विपरीत में कब्जा करने के लिए सी जो 3 सी पुस्तकालयों का उपयोग करता है । हमारे निष्कर्षों के अनुरूप, उंहोंने पाया कि कब्जा सी पुस्तकालयों मुख्य रूप से संयुक्त राष्ट्र के ligated टुकड़े४०से बना रहे हैं । इसके अलावा, HiCap पुस्तकालयों कब्जा-सी पुस्तकालयों४०से एक उच्च जटिलता था ।

कैप्चर-c का एक संस्करण, नामक अगली पीढ़ी पर कब्जा-c५२ (कब्जा एनजी-सी) प्रतिबंध टुकड़ा अंत प्रति एक oligo का उपयोग करता है, के रूप में पहले PCHi-c३३,३४में स्थापित, के बजाय अतिव्यापी जांच के मूल में इस्तेमाल किया कैप्चर-C प्रोटोकॉल५०। इस पर कब्जा-सी विनय की तुलना में वैध पढ़ता का प्रतिशत बढ़ जाती है, लेकिन कब्जा-सी एनजी कब्जा संवर्धन के दो क्रमिक दौर, और पीसीआर चक्र के एक अपेक्षाकृत उच्च संख्या (कुल में 20 से 24 चक्र, के लिए आम तौर पर 11 चक्र की तुलना में PCHi-c), जो अनिवार्य रूप से अनुक्रम डुप्लिकेट और कम पुस्तकालय जटिलता के उच्च संख्या में परिणाम है । PCHi-सी के अनुकूलन के दौरान परीक्षण प्रयोगों में, हमने पाया है कि अद्वितीय का प्रतिशत (यानी, डुप्लिकेट नहीं) पढ़ें जोड़े केवल 15% के आसपास था जब हम 19 पीसीआर चक्र (13 चक्र पूर्व कब्जा + 6 चक्रों के बाद कब्जा; डेटा नहीं दिखाया गया है), लेकिन पीसीआर चक्रों की कम संख्या के लिए अनुकूलन, आमतौर पर 75 पैदावार-90% अद्वितीय पढ़ें जोड़े । इस प्रकार, पीसीआर चक्र की संख्या को कम करने में काफी जानकारीपूर्ण अनुक्रम डेटा की मात्रा बढ़ जाती है ।

हाल ही में एक विधि हाय-सी के साथ चिप को जोड़ती है गुणसूत्र ब्याज की एक विशिष्ट प्रोटीन (HiChIP५३) द्वारा मध्यस्थता बातचीत पर ध्यान केंद्रित । चिया-पीईटी५४, जो एक समान तर्क पर आधारित है की तुलना में, HiChIP डेटा जानकारीपूर्ण अनुक्रम की एक उच्च संख्या में पढ़ता है, उच्च विश्वास बातचीत५३फोन करने के लिए अनुमति देता है । यह बहुत ही सीधे संगत HiChIP और कब्जा हाय-सी डेटा सेट की तुलना करने के लिए एक बार वे उपलब्ध हो दिलचस्प हो जाएगा (उदाहरण के लिए cohesin इकाई Smc1a के खिलाफ एक एंटीबॉडी का उपयोग HiChIP के साथ कब्जा हाय सभी Smc1a बाध्य प्रतिबंध के लिए सी टुकड़े) की ओर से । इन दो तरीकों के बीच एक अंतर्निहित अंतर यह है कि कब्जा हाय-सी क्रोमेटिन immunoprecipitation पर भरोसा नहीं करता है, और इसलिए प्रोटीन अधिभोग के गुणसूत्र बातचीत चाहे पूछताछ करने में सक्षम है । इस उपस्थिति या विशिष्ट कारक बाध्यकारी की अनुपस्थिति में 3 डी जीनोम संगठन की तुलना में सक्षम बनाता है, के रूप में माउस ESC स्थानिक जीनोम वास्तुकला7के एक प्रमुख नियामक के रूप में PRC1 की पहचान करने के लिए इस्तेमाल किया गया है ।

PCHi-सी और GWAS

जीनोम-वाइड एसोसिएशन अध्ययन (GWAS) से पता चला है कि अधिक से अधिक ९५% की बीमारी से जुड़े अनुक्रम वेरिएंट गैर में स्थित हैं, जीनोम के क्षेत्र कोडिंग, प्रोटीन के लिए महान दूरी पर अक्सर-कोडिंग जीन५५। GWAS वेरिएंट अक्सर DNase मैं अनुभुत साइटों के करीब निकटता में पाया जाता है, जो संभावित नियामक गतिविधि के साथ दृश्यों की एक बानगी है । PCHi-सी और कब्जा हाय-सी बड़े पैमाने पर इस्तेमाल किया गया है GWAS जोखिम loci स्तन कैंसर४४, कोलोरेक्टल कैंसर४८, और स्व-प्रतिरक्षित रोग३५,४५,४६में फंसा के लिए प्रमोटरों लिंक । 17 विभिंन मानव टेम कोशिका प्रकार पर एक PCHi-सी अध्ययन पाया SNPs स्व-प्रतिरक्षित रोग के साथ जुड़े लसीकावत् कोशिकाओं में PIRs में समृद्ध थे, जबकि अनुक्रम प्लेटलेट और लाल रक्त कोशिका विशिष्ट लक्षण के साथ जुड़े वेरिएंट में मुख्य रूप से पाए गए मैक्रोफेज और erythroblasts, क्रमशः३५,५६. इस प्रकार, ऊतक प्रकार विशिष्ट प्रवर्तक interactomes PCHi-सी द्वारा खुला गैर कोडिंग रोग जुड़े अनुक्रम वेरिएंट के समारोह को समझने में मदद मिलेगी और उपचारात्मक हस्तक्षेप के लिए नए संभावित रोग जीन की पहचान कर सकते हैं ।

प्रमोटर के लक्षण-आदान-प्रदान क्षेत्र

जीन अभिव्यक्ति नियंत्रण के लिए सबूत लिंक प्रमोटर interactomes के कई लाइनें । सबसे पहले, कई PCHi-सी अध्ययनों का प्रदर्शन किया है कि जीनोमिक क्षेत्रों (अत्यधिक) के प्रवर्तकों के साथ बातचीत व्यक्त की जीन बढ़ाने गतिविधि के साथ जुड़े निशान में समृद्ध कर रहे हैं, जैसे H3K27 acetylation और p300 बंधन३३,३४ , ३७. हमें जीन अभिव्यक्ति स्तर और आदान-प्रदान बढ़ाने वालों की संख्या के बीच सकारात्मक संबंध पाया गया, सुझाव है कि बढ़ाने वाले जीन अभिव्यक्ति के स्तर में वृद्धि के additive प्रभाव३४,३५. दूसरा, स्वाभाविक रूप से होने वाली अभिव्यक्ति मात्रात्मक विशेषता loci (eQTLs) PIRs में समृद्ध होती है जो उसी जीन से जुड़े होते हैं जिनकी अभिव्यक्ति eQTLs३५से प्रभावित होती है. तीसरे, यात्रा५७ और PCHi-सी डेटा को एकीकृत करके, केर्न्स एट अल । पाया गया कि ट्रिप रिपोर्टर जीन में PIRs को मानचित्रण माउस ESCs दिखाएं मजबूत रिपोर्टर जीन की तुलना में गैर-प्रवर्तक में एकीकरण स्थलों पर रिपोर्टर जीनों-क्षेत्रों बातचीत ५८, यह दर्शाता है कि PIRs transcriptional विनियामक गतिविधि के अधिकारी हैं । साथ में, इन निष्कर्षों का सुझाव है कि प्रवर्तक interactomes PCHi द्वारा खुला-विभिंन माउस और मानव कोशिका प्रकार में सी जीन अभिव्यक्ति नियंत्रण के लिए प्रमुख नियामक मॉड्यूल शामिल हैं ।

यह ध्यान देने योग्य है कि बढ़ाने के लायक केवल एक छोटा सा अंश का प्रतिनिधित्व (~ 20%) सभी PIRs PCHi-C३३,३४द्वारा खुला । अंय PIRs संरचनात्मक या टोपोलॉजिकल भूमिकाओं के बजाय प्रत्यक्ष transcriptional विनियामक कार्य हो सकता है । हालांकि, वहां भी सबूत है कि PCHi-सी है कि शास्त्रीय बढ़ाने के निशान बंदरगाह नहीं है विनियामक समारोह के साथ डीएनए तत्वों को उजागर कर सकते हैं । एक मानव लसीकावत् सेल लाइन में, BRD7 प्रमोटर को बढ़ाने के निशान है कि रिपोर्टर जीन परख३३में बढ़ाने गतिविधि के अधिकारी दिखाया गया था की एक क्षेत्र के साथ बातचीत पाया गया । समान विशेषताओं के साथ विनियामक तत्व वर्तमान में सराहना की तुलना में अधिक प्रचुर मात्रा में हो सकते हैं । उदाहरण के लिए, नियामक डीएनए तत्वों के लिए एक CRISPR आधारित स्क्रीन की पहचान की अचिह्नित विनियामक तत्व (UREs) है कि जीन अभिव्यक्ति नियंत्रण लेकिन बढ़ाने के निशान से रहित है५९

अन्य मामलों में, PIRs को transcriptional दमन से जुड़े हार्बर क्रोमेटिन चिह्नों को दिखाया गया है । PIRs और बातचीत के प्रवर्तकों में माउस ESCs PRC1 से बंधे दमित जीन दमन मार्क H3K27me37असर के एक व्यापक स्थानिक नेटवर्क में लगे थे । मानव lymphoblastoid कोशिकाओं में, एक दूर BCL6 प्रमोटर दमित transgene रिपोर्टर जीन अभिव्यक्ति३३के साथ बातचीत के तत्व, सुझाव है कि यह अपने मूल संदर्भ में BCL6 प्रतिलेखन दमन के लिए कार्य कर सकते हैं ।

PIRs मानव ESCs और एनईसीएस३७ में क्रोमेटिन इंसुलेटर प्रोटीन CTCF के अधिभोग के लिए समृद्ध PIRs का एक और वर्ग अभी तक प्रतिनिधित्व कर सकते हैं । सामूहिक रूप से, इन परिणामों का सुझाव है कि PIRs अभी तक जीन विनियामक गतिविधियों का संग्रह करने के लिए कार्यात्मक विशेषता है ।

Disclosures

लेखकों के पास कुछ भी खुलासा नहीं है.

Acknowledgments

हम चित्र 1 के साथ पांडुलिपि और विशेषज्ञ की मदद के महत्वपूर्ण पढ़ने के लिए Valeriya Malysheva धंयवाद । यह काम चिकित्सा अनुसंधान परिषद द्वारा समर्थित किया गया था, uk (MR/L007150/और uk जैव प्रौद्योगिकी और जैव विज्ञान अनुसंधान परिषद्, यूके (BB/J004480/

Materials

Name Company Catalog Number Comments
16% (vol/vol) paraformaldehyde solution Agar Scientific R1026
Dulbecco's Modified Eagle Medium (DMEM) 1x Life Technologies 41965-039
Fetal bovine serum (FBS) sterile filtered Sigma  F9665
Low-retention filter tips  Starlab S1180-3810, S1180-1810, S1180-8810 and S1182-1830
10x PBS pH 7.4 Life Technologies 70011-036
Molecular biology grade water Sigma-Aldrich W4502
1 M Tris-HCl pH 8.0 Life Technologies 15568-025
IGEPAL CA-630  Sigma-Aldrich I8896
5 M NaCl  Life Technologies 24740-011
Protease inhibitor cocktail (EDTA-free)  Roche Diagnostics 11873580001
Restriction buffer 2 (10x NEBuffer 2) New England Biolabs B7002
DNA LoBind tube, 1.5 mL  Eppendorf 0030 108.051
DNA LoBind tube, 2 mL Eppendorf 30108078
20% (wt/vol) SDS   Bio-Rad Laboratories 161-0418
20% (vol/vol) Triton X-100  Sigma-Aldrich T8787
HindIII, 100 U/uL New England Biolabs R0104
10 mM dCTP  Life Technologies 18253-013
10 mM dGTP Life Technologies 18254-011
10 mM dTTP  Life Technologies 18255-018
0.4 mM Biotin-14-dATP Life Technologies 19524-016
DNA polymerase I large (Klenow) fragment 5000 units/mL New England Biolabs M0210
10x T4 DNA ligase reaction buffer  New England Biolabs B0202
100x 10mg/ml Bovine Serum Albumin  New England Biolabs B9001
T4 DNA ligase, 1 U/μL  Invitrogen 15224-025
RNase A  Roche 10109142001
Proteinase K, recombinant, PCR grade  Roche 3115836001
20 000×g 50 ml centrifuge tube VWR 525-0156
0.5 M EDTA pH 8.0  Life Technologies 15575-020
Phenol pH 8.0  Sigma P4557
Phenol: Chloroform: Isoamyl Alcohol 25:24:1  Sigma P3803
Sodium acetate pH 5.2  Sigma S7899
Quant-iT PicoGreen  Invitrogen P7589
QIAquick Gel Extraction Kit Qiagen 28704
QIAquick PCR Purification Kit Qiagen 28104
Restriction buffer 2.1 (10x NEBuffer 2.1) New England Biolabs B7202
NheI, 100U/uL New England Biolabs R0131
Micro TUBE AFA Fiber Pre-slit snap cap 6x16mm vials  Covaris 520045 For sonication
SPRI beads (Agencourt AMPure XP)  Beckman Coulter A63881
Dynabeads MyOne Streptavidin C1 beads  Invitrogen 65001
Tween 20  Sigma P9416
10 mM dATP  Life Technologies 18252-015
T4 DNA polymerase 3000 units/mL New England Biolabs M0203
T4 PNK 10000 units/mL New England Biolabs M0201
Klenow exo minus 5000 units/mL  New England Biolabs M0212
Quick ligation reaction buffer  New England Biolabs B6058
NEB DNA Quick ligase  New England Biolabs M2200
PE adapter 1.0 (5'-P-GATCGGAAGAGCGGTTCAGC
AGGAATGCCGAG-3')
Illumina
PE adapter 2.0 (5'-ACACTCTTTCCCTACACGACGCT
CTTCCGATCT-3')
Illumina
NEB Phusion PCR kit  New England Biolabs M0530
PE PCR primer 1.0 (5'-AATGATACGGCGACCACCGA
GATCTACACTCTTTCCCTAC
ACGACGCTCTTCCGATCT-3')
Illumina
PE PCR primer 2.0 (5'-CAAGCAGAAGACGGCATACGA
GATCGGTCTCGGCATTCCT
GCTGAACCGCTCTTCCGATCT-3') 
Illumina
PCR strips  Agilent Technologies 410022 and 401425
SureSelect SSEL TE Reagent ILM PE full adaptor kit  Agilent Technologies 931108
SureSelect custom 3-5.9 Mb library  Agilent Technologies 5190-4831 custom design mouse or human PCHi-C system
Dynabeads MyOne Streptavidin T1 beads  Invitrogen 65601
E220  high-performance focused ultra-sonicator Corvaris E220

DOWNLOAD MATERIALS LIST

References

  1. Osborne, C. S., et al. Active genes dynamically colocalize to shared sites of ongoing transcription. Nature Genetics. 36, 1065-1071 (2004).
  2. Schoenfelder, S., et al. Preferential associations between co-regulated genes reveal a transcriptional interactome in erythroid cells. Nature Genetics. 42, 53-61 (2010).
  3. de Wit, E., et al. The pluripotent genome in three dimensions is shaped around pluripotency factors. Nature. 501, 227-231 (2013).
  4. Bantignies, F., et al. Polycomb-dependent regulatory contacts between distant Hox loci in Drosophila. Cell. 144, 214-226 (2011).
  5. Engreitz, J. M., et al. The Xist lncRNA exploits three-dimensional genome architecture to spread across the X chromosome. Science. 341, 1237973 (2013).
  6. Denholtz, M., et al. Long-range chromatin contacts in embryonic stem cells reveal a role for pluripotency factors and polycomb proteins in genome organization. Cell Stem Cell. 13, 602-616 (2013).
  7. Schoenfelder, S., et al. Polycomb repressive complex PRC1 spatially constrains the mouse embryonic stem cell genome. Nature Genetics. 47, 1179-1186 (2015).
  8. Kundu, S., et al. Polycomb Repressive Complex 1 generates discrete compacted domains that change during differentiation. Molecular Cell. 65, 432-446 (2017).
  9. Skok, J. A., Gisler, R., Novatchkova, M., Farmer, D., de Laat, W., Busslinger, M. Reversible contraction by looping of the Tcra and Tcrb loci in rearranging thymocytes. Nature Immunology. 8, 378-387 (2007).
  10. Zhang, Y., et al. Spatial organization of the mouse genome and its role in recurrent chromosomal translocations. Cell. 148, 908-921 (2012).
  11. Aymard, F., et al. Genome-wide mapping of long-range contacts unveils clustering of DNA double-strand breaks at damaged active genes. Nature Structural & Molecular Biology. 24, 353-361 (2017).
  12. Ryba, T., et al. Evolutionarily conserved replication timing profiles predict long-range chromatin interactions and distinguish closely related cell types. Genome Research. 20, 761-770 (2010).
  13. Pope, B. D., et al. Topologically associating domains are stable units of replication-timing regulation. Nature. 515, 402-405 (2014).
  14. Chandra, T., et al. Global reorganization of the nuclear landscape in senescent cells. Cell Reports. 10, 471-483 (2015).
  15. Carter, D., Chakalova, L., Osborne, C. S., Dai, Y. F., Fraser, P. Long-range chromatin regulatory interactions in vivo. Nature Genetics. 32, 623-626 (2002).
  16. Tolhuis, B., Palstra, R. J., Splinter, E., Grosveld, F., de Laat, W. Looping and interaction between hypersensitive sites in the active beta-globin locus. Molecular Cell. 10, 1453-1465 (2002).
  17. Amano, T., Sagai, T., Tanabe, H., Mizushina, Y., Nakazawa, H., Shiroishi, T. Chromosomal dynamics at the Shh locus: limb bud-specific differential regulation of competence and active transcription. Developmental Cell. 16, 47-57 (2009).
  18. Zuniga, A., et al. Mouse limb deformity mutations disrupt a global control region within the large regulatory landscape required for Gremlin expression. Genes & Development. 18, 1553-1564 (2004).
  19. Sagai, T., Hosoya, M., Mizushina, Y., Tamura, M., Shiroishi, T. Elimination of a long-range cis-regulatory module causes complete loss of limb-specific Shh expression and truncation of the mouse limb. Development. 132, 797-803 (2005).
  20. D'Haene, B., et al. Disease-causing 7.4 kb cis-regulatory deletion disrupting conserved non-coding sequences and their interaction with the FOXL2 promotor: implications for mutation screening. PLoS Genet. 5, e1000522 (2009).
  21. Sur, I. K., et al. Mice lacking a Myc enhancer that includes human SNP rs6983267 are resistant to intestinal tumors. Science. 338, 1360-1363 (2012).
  22. Herranz, D., et al. A NOTCH1-driven MYC enhancer promotes T cell development, transformation and acute lymphoblastic leukemia. Nature Medicine. 20, 1130-1137 (2014).
  23. Deng, W., et al. Controlling long-range genomic interactions at a native locus by targeted tethering of a looping factor. Cell. 149, 1233-1244 (2012).
  24. Groschel, S., et al. A single oncogenic enhancer rearrangement causes concomitant EVI1 and GATA2 deregulation in leukemia. Cell. 157, 369-381 (2014).
  25. Lupianez, D. G., et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell. 161, 1012-1025 (2015).
  26. Franke, M., et al. Formation of new chromatin domains determines pathogenicity of genomic duplications. Nature. 538, 265-269 (2016).
  27. Dekker, J., Rippe, K., Dekker, M., Kleckner, N. Capturing chromosome conformation. Science. 295, 1306-1311 (2002).
  28. Simonis, M., et al. Nuclear organization of active and inactive chromatin domains uncovered by chromosome conformation capture-on-chip (4C). Nature Genetics. 38, 1348-1354 (2006).
  29. Zhao, Z., et al. Circular chromosome conformation capture (4C) uncovers extensive networks of epigenetically regulated intra- and interchromosomal interactions. Nature Genetics. 38, 1341-1347 (2006).
  30. Dostie, J., et al. Chromosome Conformation Capture Carbon Copy (5C): A massively parallel solution for mapping interactions between genomic elements. Genome Research. 16, 1299-1309 (2006).
  31. Lieberman-Aiden, E., et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 326, 289-293 (2009).
  32. Belton, J. M., McCord, R. P., Gibcus, J. H., Naumova, N., Zhan, Y., Dekker, J. Hi-C: a comprehensive technique to capture the conformation of genomes. Methods. 58, 268-276 (2012).
  33. Mifsud, B., et al. Mapping long-range promoter contacts in human cells with high-resolution capture Hi-C. Nature Genetics. 47, 598-606 (2015).
  34. Schoenfelder, S., et al. The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements. Genome Res. 25, 582-597 (2015).
  35. Javierre, B. M., et al. Lineage-specific genome architecture links enhancers and non-coding disease variants to target gene promoters. Cell. 167, 1369-1384 (2016).
  36. Wilson, N. K., et al. Integrated genome-scale analysis of the transcriptional regulatory landscape in a blood stem/progenitor cell model. Blood. 127, e12-e23 (2016).
  37. Freire-Pritchett, P., et al. Global reorganisation of cis-regulatory units upon lineage commitment of human embryonic stem cells. Elife. 6, (2017).
  38. Rubin, A. J., et al. Lineage-specific dynamic and pre-established enhancer-promoter contacts cooperate in terminal differentiation. Nature Genetics. 49, 1522-1528 (2017).
  39. Siersbaek, R., et al. Dynamic rewiring of promoter-anchored chromatin loops during adipocyte differentiation. Molecular Cell. 66, 420-435 (2017).
  40. Sahlen, P., et al. Genome-wide mapping of promoter-anchored interactions with close to single-enhancer resolution. Genome Biology. 16, 156 (2015).
  41. Nagano, T., et al. Single-cell Hi-C reveals cell-to-cell variability in chromosome structure. Nature. 502, 59-64 (2013).
  42. Nagano, T., Varnai, C., Schoenfelder, S., Javierre, B. M., Wingett, S. W., Fraser, P. Comparison of Hi-C results using in-solution versus in-nucleus ligation. Genome Biology. 16, 175 (2015).
  43. Wingett, S., et al. HiCUP: pipeline for mapping and processing Hi-C data. F1000 Res. 4, 1310 (2015).
  44. Dryden, N. H., et al. Unbiased analysis of potential targets of breast cancer susceptibility loci by Capture Hi-C. Genome Research. 24, 1854-1868 (2014).
  45. Martin, P., et al. Capture Hi-C reveals novel candidate genes and complex long-range interactions with related autoimmune risk loci. Nature Communications. 6, 10069 (2015).
  46. McGovern, A., et al. Capture Hi-C identifies a novel causal gene, IL20RA, in the pan-autoimmune genetic susceptibility region 6q23. Genome Biol.ogy. 17, 212 (2016).
  47. Hodge, D., et al. A global role for EKLF in definitive and primitive erythropoiesis. Blood. 107, 3359-3370 (2006).
  48. Jager, R., et al. Capture Hi-C identifies the chromatin interactome of colorectal cancer risk loci. Nature Communications. 6, 6178 (2015).
  49. Joshi, O., et al. Dynamic reorganization of extremely long-range promoter-promoter Interactions between two states of pluripotency. Cell Stem Cell. 17, 748-757 (2015).
  50. Hughes, J. R., et al. Analysis of hundreds of cis-regulatory landscapes at high resolution in a single, high-throughput experiment. Nature Genetics. 46, 205-212 (2014).
  51. Kolovos, P., et al. Targeted Chromatin Capture (T2C): A novel high-resolution high-throughput method to detect genomic interactions and regulatory elements. Epigenetics Chromatin. 7, 10 (2014).
  52. Davies, J. O., et al. Multiplexed analysis of chromosome conformation at vastly improved sensitivity. Nature Methods. 13, 74-80 (2016).
  53. Mumbach, M. R., et al. HiChIP: efficient and sensitive analysis of protein-directed genome architecture. Nature Methods. 13, 919-922 (2016).
  54. Fullwood, M. J., et al. An oestrogen-receptor-alpha-bound human chromatin interactome. Nature. 462, 58-64 (2009).
  55. Maurano, M. T., et al. Systematic localization of common disease-associated variation in regulatory DNA. Science. 337, 1190-1195 (2012).
  56. Petersen, R., et al. Platelet function is modified by common sequence variation in megakaryocyte super enhancers. Nat. Commun. 8, 16058 (2017).
  57. Akhtar, W., et al. Chromatin position effects assayed by thousands of reporters integrated in parallel. Cell. 154, 914-927 (2013).
  58. Cairns, J., et al. CHiCAGO: Robust detection of DNA looping interactions in Capture Hi-C data. Genome Biology. 17, 127 (2016).
  59. Rajagopal, N., et al. High-throughput mapping of regulatory DNA. Nature Biotechnology. 34, 167-174 (2016).
प्रमोटर कब्जा हाय-सी: उच्च संकल्प, जीनोम-व्यापक प्रमोटर बातचीत की रूपरेखा
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Schoenfelder, S., Javierre, B. M., Furlan-Magaril, M., Wingett, S. W., Fraser, P. Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions. J. Vis. Exp. (136), e57320, doi:10.3791/57320 (2018).More

Schoenfelder, S., Javierre, B. M., Furlan-Magaril, M., Wingett, S. W., Fraser, P. Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions. J. Vis. Exp. (136), e57320, doi:10.3791/57320 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter