Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Promotoren fange Hei-C: Med høy oppløsning, genomet-bred profilering av arrangøren interaksjoner

doi: 10.3791/57320 Published: June 28, 2018
* These authors contributed equally

Summary

DNA regulatoriske elementer, for eksempel enhancers, kontrollere genuttrykk ved fysisk å kontakte målet genet arrangører, ofte gjennom langtrekkende chromosomal interaksjoner spenner genomisk distanser. Promotoren fange Hi-C (PCHi-C) identifiserer betydelig interaksjon mellom arrangører og distale regioner, aktivere tilordningen av potensielle regulatoriske sekvenser til sine mål gener.

Abstract

Tredimensjonale organiseringen av genomet er knyttet til sin funksjon. For eksempel styre regulatoriske elementer som transcriptional enhancers spatio-temporale uttrykk for sine mål gener gjennom fysisk kontakt, ofte bygge bro betydelig (i noen tilfeller hundrevis av kilobases) genomisk avstander og omgåelsen nærliggende gener. Det menneskelige genomet havner en anslagsvis én million enhancers, de aller fleste som har ukjente genet mål. Tilordne distale regulatoriske regioner til sine mål gener er derfor avgjørende å forstå gene expression kontroll. Vi utviklet selskapet fange Hi-C (PCHi-C) for å aktivere genomet hele påvisning av distale promoter-samspill regioner (PIRs), alle arrangører i ett enkelt eksperiment. I PCHi-C, er svært komplekse Hi-C biblioteker spesielt beriket for arrangøren sekvenser gjennom i-løsning hybrid utvalg med tusenvis av biotinylated RNA agn utfyllende til endene av alle promoter inneholder begrensning fragmenter. Målet er å deretter rullegardinmenyen promoter sekvenser og deres hyppige samhandling partnere som enhancers og andre potensielle regulatoriske elementer. Etter høy gjennomstrømming sammen-end sekvensering brukes en statistisk test hver promoter-samskrevet begrensning fragment å identifisere viktige PIRs på fragment begrensningsnivå. PCHi-C har vi brukt til å generere en atlas av langtrekkende Promotoren samhandling i dusinvis av menneskelige og mus celletyper. Disse arrangøren interactome kartene har bidratt til en større forståelse av pattedyr gene expression kontroll av tilordne antatte regulatoriske regioner til sine mål gener og avslørende fortrinnsrett romlige promoter-arrangøren samhandling nettverk. Denne informasjonen også har høy relevans å forstå menneskelig genetisk sykdom og identifisering av potensielle sykdom gener, ved å koble ikke-koding sykdomsassosierte sekvens varianter i eller nær kontroll sekvenser til sine mål gener.

Introduction

Samler bevis antyder at tredimensjonale organiseringen av genomet spiller en viktig funksjonelle rolle i en rekke kjernefysisk prosessene, inkludert gene aktivisering1,2,3, undertrykkelse4 ,5,6,7,8, rekombinasjon9,10, DNA reparasjon11, DNA replikering12,13, og mobilnettet senescence14. Fjern enhancers finnes i romlig nærhet til arrangørene de regulerer15,16,17, som er avgjørende for riktig spatio-temporale gene expression kontroll. Enhancer slettinger viser at distale enhancers er avgjørende for målet genet transkripsjon18,19,20,21,22og "tvunget chromatin looper" viser at utviklet deling mellom en enhancer og dens mål formidler i Hbb locus er tilstrekkelig til å kjøre transcriptional aktivisering23. Videre kan genomet rearrangements som bringer gener under kontroll av ektopisk enhancers resultere i upassende genet aktivisering og sykdom24,25,26. Sammen viser disse eksemplene at arrangøren-enhancer interaksjoner er avgjørende for gen kontroll og krever tett forskrift for å sikre riktig genuttrykk. Menneskelige og mus genomer hver anslås for å havn rundt en million enhancers. De aller fleste av disse enhancers, målet gener er ukjent og 'engasjementsreglene' mellom arrangørene og enhancers er dårlig forstått. Tilordne transcriptional enhancers til sine mål gener dermed fortsatt en stor utfordring i tyde pattedyr gene expression kontroll.

Vår forståelse av tredimensjonale genomet arkitektur er blitt revolusjonert av innføring av 3C27 (kromosom konformasjon fange) og dens varianter28,29,30,31 . Den mektigste av disse teknikkene, Hi-C (høy gjennomstrømning kromosom konformasjon fange) er utformet for å identifisere hele ensemblet av chromosomal interaksjoner i cellen innbyggere. Hei-C biblioteker, vanligvis genereres fra millioner av celler, er svært kompleks med en beregnede 1011 uavhengige ligation produkter mellom ~ 4 kb fragmenter i det menneskelige genom32. Som en konsekvens, pålitelig og reproduserbar identifikasjon av samspillet mellom individuelle begrensning fragmenter (som de som inneholder en formidler eller enhancer) fra er Hi-C data ikke mulig med mindre Hi-C biblioteker er utsatt for ultra-dypt sekvensering, som er ikke en økonomisk løsning for laboratorier forbereder Hi-C biblioteker rutinemessig. For å omgå dette brist, utviklet vi Promoter fange Hi-C for å berike spesielt promoter inneholder ligation produkter fra Hi-C biblioteker. Vi fokusert på arrangører av to grunner. Først selskapet-enhancer kontakter har vist seg å være avgjørende for riktig gene expression nivåer i en rekke studier (se referanser ovenfor), og andre som arrangører er i stor grad invariant mellom celletyper, samme fange agn system kan brukes til å forhøre det regulatoriske kretsløpet over flere celletyper og betingelser. Vår tilnærming er avhengig av-løsning hybridisering Hi-C biblioteker med titusenvis av biotinylated RNA 120mers utfyllende til arrangøren inneholder Hi-C ligation produkter og påfølgende fangst streptavidin-belagt magnetiske perler. Dette resulterer i PCHi-C biblioteker med mye redusert kompleksitet i forhold til den opprinnelige Hi-C biblioteket, fokuserer bare på identifisering av fragmenter som er samskrevet til arrangører ved betydelig høye frekvenser.

Vi har brukt PCHi-C i en rekke menneskelige og mus celletyper å bidra til en bedre forståelse av gene expression kontroll av avdekke langtrekkende distale promoter samspill regioner med antatte regulatoriske funksjonen, samt ikke tilfeldig Promotoren-arrangøren kontakter i tredimensjonale løpet av kjernen. Studier har kartlagt hundretusener av arrangøren-enhancer kontakter over mange celle typer33,34,35,36,37,38, 39, identifisert Polycomb undertrykkende komplekse-mediert romlige genomet organisasjon i mus embryonale stamceller7, viste store rewiring av arrangøren interactomes under differensiering37, 38 , 39og koblet ikke-koding sykdomsassosierte sekvens varianter til genet arrangører35.

PCHi-C er en godt egnet metode for å tilordne genomet hele ensemblet av DNA-sekvenser samarbeidsstil arrangører. Relaterte tilnærminger, som fange Hi-C kontinuerlig genomisk regioner (se diskusjon) er metoden for valg å få høyoppløselige samhandling profiler for utvalgte genomisk regioner. PCHi-C og fange Hi-C er svært like fra en eksperimentelle synspunkt (den eneste forskjellen er valg av systemet), slik at råd og retningslinjer tilbyr gjelder for begge tilnærminger. Her presenterer vi en detaljert beskrivelse av PCHi-C. Vi skissere begrunnelsen og utformingen av en PCHi-C eksperiment, gi en trinnvis PCHi-C biblioteket generasjon protokoll, og illustrerer hvordan kvaliteten på PCHi-C biblioteker kan overvåkes på ulike trinn i protokollen for å gi høy kvalitet dataene.

Protocol

1. formaldehyd fiksering

  1. Celle forberedelse: starte med et minimum av 2 x 107 celler per eksperiment.
    1. For celler dyrket i kultur, resuspend cellene i kultur medium. For ex vivo celler, resuspend i 1 x Dulbeccos endret Eagle Medium (DMEM), supplert med 10% (vol/vol) fetal bovin serum (FBS).
    2. For tilhenger celler, fjerner kultur medium og legge 30.625 mL frisk medium med 10% (vol/vol) FBS ved romtemperatur (RT, 20-25 ° C).
    3. For suspensjon celler, samle inn og sentrifuge cellene på 400 x g og 20 ° C til 3 min. Fjern nedbryting og re avbryte celle pellet 30.625 mL medium med 10% (vol/vol) FBS på RT.
    4. Solid vev, bruke trypsin (0,05% til 2,5% siste konsentrasjon, avhengig av celle type) eller dounce homogenisere for å få en enkeltcelle suspensjon. Etter dette ekstra trinnet behandle celler som suspensjon celler.
  2. Legge til 4.375 mL av 16% metanol-gratis paraformaldehyde (åpne ampullen bare før bruk) i en siste konsentrasjon på 2% (vol/vol). Løsning 10 min på RT med mild blande på en rocker.
    FORSIKTIG: Paraformaldehyde er en farlig kjemisk. Følg de aktuelle helse- og sikkerhetsforskrifter.
  3. Slukke reaksjon ved å legge til 5 mL av nylagde 1 M iskald glysin. Bland i 5 min med milde rocking på RT deretter ruge på isen i 15 min med sporadiske invertere.
  4. Vask og samle fast celler.
    1. For tilhenger celler, fjerne nedbryting, legge til 10 mL av iskalde 1 x PBS pH 7.4 på plate veggen og fjerne den. Legg 1 mL av iskalde 1 x PBS pH 7.4, samle celler ved hjelp av en celle skraper og overføre til en 50 mL tube. Gjenta to ganger for å samle så mange celler som mulig. Legge iskald PBS opp til 50 mL siste volum.
    2. For suspensjon celler, sentrifuger celler 760 x g og 4 ° C i 5 minutter, Fjern nedbryting, og å suspendere celle pellet i 50 mL av iskalde PBS pH 7.4.
  5. Sentrifuge cellene på 400 x g og 4 ° C i 10 min og fjern forsiktig nedbryting. Cellen pellets kan snapin frosset i flytende nitrogen og deretter lagret på-80 ° C i flere måneder.

2. celle Lysis

  1. Nytt suspendere celle pellet i 50 mL av nylagde iskald lyseringsbuffer (10 mM Tris-HCl pH 8 0,2% (vol/vol) Igepal CA-630, 10 mM NaCl, og en tablett protease hemmer cocktail) og bland. Ruge på is 30 min, bland noen ganger ved å snu. Sentrifuge kjerner på 760 x g og 4 ° C i 5 min og fjerne nedbryting.

3. hindIII fordøyelse

  1. Vask celle kjerner med 1,25 x begrensning buffer 2. Nytt suspendere celle pellet i 1 mL av iskalde 1,25 x begrensning buffer 2 og overføre til en 1,5 mL tube. Spinn kjerner på 760 x g og 4 ° C i 5 min og fjerne nedbryting.
  2. Nytt avbryte celle pellet 1790 µL 1,25 x begrensning bufferen 2. Gjør 5 dele, hver med 5-10 millioner celler i 358 µL på 1,25 x begrensning-buffer 2.
  3. Legge til 11 µL på 10% (wt/vol) SDS per aliquot og riste på 950 omdreininger per min (rpm) i 30 min på 37 ° C i en thermomixer. Hvis cellen klumper vises, distansere av pipettering, unngå bobler.
  4. Legge til 75 µL av 10% Triton X-100 (vol/vol) per aliquot og riste på 950 rpm og 37 ° C i 15 min i en thermomixer. Hvis cellen klumper vises, distansere av pipettering, unngå bobler.
  5. Legg til 12 µL av 100 U/µL HindIII 100 (1200 enheter totalt) per aliquot og ruge på 37 ° C over natten (O/N) mens riste på 950 rpm i en thermomixer.
    1. For fordøyelsen kontroll, overføre 25 µL av prøven (5 µL fra hver aliquot) i en ny tube ør enzymet (ufordøyd kontroll) og gjenta samme etter enzymet (fordøyd kontroll). Inkuber både rør på samme måte som Hi-C biblioteket.
  6. På morgenen legge 5 µL av 100 U/µL HindIII (500 enheter totalt) per aliquot og ruge på 37 ° C for 2t mens riste på 950 rpm i en thermomixer.
  7. Fordøyelsen kontroll: av fordøyd og ufordøyd kontrollene (se 3.5.1), utføre krysskobling tilbakeføring (trinn 6), fenol: kloroform utvinning og DNA nedbør (trinn 7).
    1. Utforme et par primere som dekker en HindIII nettsted. I samme region, kan du utforme et par primere som ikke omfatter en HindIII nettsted. Utforme primere for kvantitative PCR (Q-PCR) med Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/) og følgende parametere:
      Primer størrelse: Optimal 20 (Min.: 18, maks: 27); Primer Tm: Optimal 60 (Min.: 57, maks: 63); Primer CG % innhold: Min.: 20 maks: 80; Amplicon størrelse: RT PCR ~ 100 bp (for konvensjonelle PCR ~ 300 bp); Mispriming bibliotek: human (menneskelige primere) eller gnagere og enkel (mus primere).
    2. Utføre Q PCR for å få 4 betyr Cts (terskel syklus): Ct [D; H], fra fordøyd prøven [D] med to primere som dekker en HindIII nettsted [H]; CT [D;-], fra fordøyd prøven [D] med to primere som ikke omfatter en HindIII nettsted [-]; CT [U; H], fra ufordøyd prøven [U] med to primere som dekker en HindIII området. CT [U;-], fra ufordøyd prøven [U] med to primere som ikke omfatter en HindIII nettsted [-]. Beregning av fordøyelsen som: % fordøyelsen = 100-100/2(Ct[D,H]-Ct[D,-]) - (Ct[U,H]-Ct[U,-]).

4. Biotinylation av begrensning Fragment overheng

  1. Klargjør biotinylation master blandingen: 30.6 µL av 10 x begrensning buffer 2 10.2 µL av H2O (molekylærbiologi grad), 7,65 µL av 10 mM dCTP, 7,65 µL av 10 mM dGTP, 7,65 µL av 10 mM dTTP, 191.25 µL av 0.4 mM biotin-14-dATP og 51 µL av 5000 U/mL DNA polymerase jeg store ( Klenow) fragment.
  2. Legge til 60 µL biotinylation master Mix per aliquot, mix og ruge på 37 ° C 1t rister på 700 rpm (thermomixer) 5 s, hver 30 s. Etter 1 h, plasserer du dele på is.

5. i-kjernen Ligation

  1. Klargjør ligation master blandingen: 510 µL av 10 x T4 DNA ligase buffer, 51 µL av 10 mg/mL Bovine Serum Albumin (100 x BSA), 1754.4 µL av vann (molekylærbiologi grad), og 127.5 µL av 1 U/µL T4 DNA ligase (se Tabell for materiale).
  2. Legg 479 µL av hemorroider master blanding per aliquot blanding og ruge på 16 ° C 4 h rister på 700 rpm for 5 s hver 2 minutter i en thermomixer.
  3. Inkuber 30 min på RT.

6. krysskobling reversering

  1. Kombiner alle dele i et 50 mL sentrifuge rør (passer for høyhastighets sentrifugering).
  2. Legg 62.5 µL av 10 mg/mL RNase A, mix, og ruge i 30 min på 37 ° C.
  3. Legger 300 µL av 10 mg/mL proteinasen K, mix, og ruge i 30 min på 37 ° C.
  4. Inkuber reaksjon O/N (eller minst 4 h) på 65 ° C. På morgenen legger 300 µL av 10 mg/mL proteinasen K, mix, og ruge 1t på 65 ° C.

7. DNA rensing

  1. Legg 4337.5 µL av TLE buffer (10 mM Tris-HCl pH 8.0, 0,1 mM EDTA pH 8.0) og bland.
  2. Legge 1 volum (10 mL) fenol pH 8.0, vortex for 10 s og sentrifuger RT og 20.000 x g for 3 min. overføre 9 mL av øvre (vannbasert) fase til en ny 50 mL tube.
    FORSIKTIG: Fenol er et farlig stoff. Følg de aktuelle helse- og sikkerhetsforskrifter.
  3. Legg 2 mL TLE buffer den gjenværende vandige fasen, vortex for 10 s og sentrifuger RT og 20.000 x g for 3 min. overføre 2,5 mL av den vandige fasen i det nye røret fra trinn 7.2, gjør det siste bindet 11,5 mL. Kast rør som inneholder den lavere (organiske) fasen.
  4. Legge til 1-volum (11.5 mL) av fenol: kloroform: isoamyl alkohol (25:24:1), vortex for 10 s og sentrifuger på RT og 20.000 x g for 3 min. overføre 11 mL av øvre (vannbasert) fase i en ny 50 mL tube. Gjenta trinn 7.3. Totalt eksempel volumet vil nå være 13,5 mL.
  5. Legge til 1.35 mL av 3 M natrium acetate pH 5.2 og 33.75 mL av iskalde 100% etanol, mix, og ruge ved-80 ° C i 45 min, eller alternativt overnatting på 20 ° C.
  6. Sentrifuge 4 ° C og 20.000 x g i 10 min, fjerne nedbryting, å suspendere pellet i 1 mL av nylagde 70% (vol/vol) etanol og overføre til en ny tube.
  7. Sentrifuge 4 ° C og full fart i 3 min i en Borstemmaskin sentrifuge, deretter fjerne nedbryting.
  8. Nytt suspendere pellet i 1 mL av is kaldt 70% (vol/vol) etanol og gjentar trinn 7.7. Tørr pellet ved 37 ° C i 10 min og å avbryte 650 µL TLE bufferen. Finne DNA avkastningen ved hjelp av en fluorescens-baserte analysen for å kvantifisere double-strandet DNA.
    Merk: Protokollen kan pauses her ved snapin frysing og lagre utvalget på-80 ° C i flere måneder eller på 20 ° C for en kortere periode.

8. kvalitetskontroll

  1. Overvåke biblioteket integritet og ligatur av DNA geleelektroforese. Kjør 200 ng bibliotek på en 0,8% agarose/1 x TBE gel. DNA bør kjøre som et band over 10 kb.
  2. Oppdage kjente celle-type konstant kort - og langtrekkende interaksjoner ved konvensjonelle PCR. Bruk 100 ng av DNA per PCR reaksjon. Utforme PCR primere tett og mot webområdene begrensning følge instruksjonene (se 3.7.1). Primer sekvenser for kvalitetskontroll av musen og menneskelige Hi-C biblioteker vises i tabell 1.
  3. Utfylling og ligatur: kutte ut gel bandene som inneholder amplicons fra kontrollere 8.2 gel-ekstrakt DNA og bruke DNA som mal for 4 individuelle PCR reaksjoner med identiske primer kombinasjoner.
    1. Rens amplicons ved hjelp av en PCR rensing kit og kvantifisere DNA konsentrasjonen.
    2. Forberede fire fordøyelsen reaksjoner (HindIII [a], NheI [b], HindIII + NheI [c] og ingen enzym [d]) for hver amplicon i et siste volum på 15 µL: 500 ng av amplicon, 1,5 µL av 10 x begrensning buffer 2.1, 0,15 µL av 10 mg/mL Bovine Serum Albumin (100 x BSA) , og 0,1 µL (10 enheter) av enzym (HindIII [a], NheI [b], HindIII + NheI [c] eller vann [d]).
    3. Fordøye 1t på 37 ° C, og deretter kjøre fordøyelsen reaksjoner på en 1,5% (wt/vol) agarose/1 x TBE gel.

9. DNA fragmentering

  1. Overføre 50.5 µg av prøve i et nytt rør og legge TLE buffer til et endelig antall 655 µL. Split eksempelkode i 5 sonication ampuller (se Tabell for materiale) ved å legge til 130 µL av biblioteket (10 µg) hvert hetteglass. Skjær til en størrelse på ~ 400 bp i en ultra-sonicator (se Tabell for materiale) med følgende parametere: plikt faktor: 10%. Peak hendelsen strøm (w): 140; sykluser per briste: 200; tid: 55 s.
  2. Samle sonicated utvalg i en fersk 2 mL tube.

10. dobbeltsidig SPRI-perle størrelse utvalg

  1. Blanding SPRI (Solid fase reversibel immobilisering) perle løsningen godt ved å snu, overføre 1,85 mL perle løsning til en ny tube og bringe til RT i 15 min.
  2. Legge til 350 µL av vann (molekylærbiologi grad) i prøven (siste volum 1 mL).
  3. Legge til 600 µL SPRI perle løsning til prøven (totalt volum 1.6 mL, forholdet mellom SPRI løsning på DNA: 0,6-1), ruge i 5 min på RT og spinne eksemplet på en Borstemmaskin centrifuge for 2-3 s å samle prøven.
  4. Åpne lokket, plasser prøven på magnetiske separasjon står for 5 min, overføring klart supernatant inn i et nytt rør og kaste perler.
  5. Konsentrere SPRI perler for andre størrelse utvalg trinn: overføre 930 µL av SPRI perler inn i et nytt rør, sted på magnetiske separasjon står for 5 min og Forkast klart supernatant. Nytt avbryte perlene 310 µL SPRI perle løsning.
  6. Legger 300 µL av konsentrert SPRI perler (trinn 10.5) til prøven (totalt volum 1,9 mL; forholdet SPRI løsning på DNA er nå 0,9 til 1), ruge på RT i 5 min og spinn smake i en Borstemmaskin centrifuge for 2-3 s. nøye åpne lokket , sett røret på magnetiske separasjon står for 5 min og forkaste nedbryting.
  7. Legg 1 mL av nylagde 70% etanol (vol/vol) til eksempel røret på magnetiske separasjon standen, ruge for 30 s og Forkast nedbryting. Gjenta to ganger.
  8. Tørr perler på 37 ° C i en thermomixer (rør lokk åpent) for mer enn 5 min. legger 300 µL TLE bufferen til prøven, mix, og ruge i 10 min ved romtemperatur.
  9. Spin eksemplet på en Borstemmaskin centrifuge for 2-3 s, åpne lokket og sted røret på magnetiske separasjon står for 5 min. overføring klart nedbryting inn i et nytt rør og kaste perler.

11. biotin/Streptavidin rullegardin Ligation produkter

  1. Forberede buffere: 1 TB buffer (5mM Tris-HCl pH 8.0, 0,5 mM EDTA, 1 M NaCl, 0,05% mellom 20); 2 x NTB buffer (10 mM Tris-HCl pH 8.0; 1 mM EDTA, 2 M NaCl); 1 x NTB buffer (5 mM Tris-HCl pH 8.0, 0,5 mM EDTA, 1 M NaCl).
  2. Legge til 200 µL av magnetiske streptavidin-kombinert perler (se Tabell for materiale) i en ny tube, plassere den på magnetiske separasjon står for 1 min og fjerne nedbryting.
  3. Vask perler to ganger med 500 µL 1 x TB bufferen.
    1. For hver wash trinn under biotin rullegardinmenyen, slutten reparasjon og fjerning av biotin på ikke-samskrevet DNA ender og dATP tailing kortet ligation trinnene, å suspendere perlene i tilsvarende bufferen, rotere på RT og 15 rpm for 3 min, spin røret i en Borstemmaskin sentrifuge for 2-3 s, sett røret på magnetiske separasjon står for 3 min og fjerne nedbryting.
  4. Nytt avbryte perler 300 µL av 2 x NTB buffer. Bland perler og prøve (600 µL totalt volum) og ruge på RT i 15 min på et roterende hjul på 3 rpm.
  5. Gjenvinne perler på magnetiske separasjon står for 3 min og fjerne klart nedbryting. Vask perler to ganger i 500 µL av 1 x NTB buffer først og deretter i 200 µL 1 x ligation bufferen. Nytt avbryte perlene 50 µL 10 x ligation bufferen.

12. ende reparasjon og fjerning av Biotin i ikke-samskrevet DNA ender

  1. Kombinere prøven (50 µL totalt) med 50 µL av 2,5 dNTP blanding (12.5 µL 10 mm hver dNTP), 18.1 µL av 3000 U/mL T4 DNA Polymerase, 18.1 µL av 10.000 U/mL T4 PNK, 3,7 µL av 5000 U/mL DNA polymerase fragmentere jeg store (Klenow) , og 360.1 µL av H2O.
  2. Bland og ruge ved 20 ° C i 1 time, risting 5 s på 700 rpm hver 2 minutter i en thermomixer.
  3. Gjenvinne perler på magnetiske separasjon standen, fjerne klart nedbryting og vaske perler to ganger i 500 µL av 1 x TB buffer.
  4. Vaske perler i 500 µL av 1 x NTB buffer, etterfulgt av en vask i 500 µL av 1 x TLE.
  5. Gjenvinne perler på magnetiske separasjon standen, fjerne klart nedbryting og å suspendere perler i 415 µL av 1 x TLE buffer.

13. dATP Tailing

  1. Kombiner utvalg (415 µL) med 50 µL av 10 x begrensning buffer 2, 5 µL av 10 mM dATP og 30 µL av 5 U/µL Klenow exo-minus.
  2. Bland og ruge på 37 ° C i 30 min, risting 5 s på 700 rpm hver 2 minutter i en thermomixer.
  3. Gjenvinne perler på magnetiske separasjon standen, fjerne klart nedbryting og vaske perler to ganger i 500 µL av 1 x TB buffer.
  4. Vask perler i 500 µL av 1 x NTB buffer.

14. kort Ligation

  1. Vaske perler i 200 µL av 1 x ligation reaksjon buffer (se Tabell for materiale).
  2. Nytt avbryte perler 200 µL 1 x ligation reaksjon bufferen. Legge til 4 µL av DNA ligase (se Tabell for materiale) og 16 µL av 15 µM pre herdet PE adaptere (pre anneal PE kortene ved å blande like volum av PE kortet 1 og PE kortet 2 (både på 30 µM) rugende i noen minutter på RT). Ruge på RT i 15 min.
  3. Gjenvinne perler på magnetiske separasjon standen, fjerne klart nedbryting og vaske perler to ganger i 500 µL av 1 x TB buffer.
  4. Vask perler i 500 µL av 1 x NTB buffer. Så, vask perler i 100 µL av 1 x begrensning buffer 2, nytt suspendere perler i 50 µL av 1 x begrensning-buffer 2, og overføre til en ny tube.

15. Hei-C biblioteket forsterkning

  1. Klargjør PCR master blandingen: 100 µL av 5 x Phusion buffer; 6 µL av 25 µM PE PCR primer 1.0; 6 µL av 25 µM PE PCR primer 2.0. 14 µL dNTP mix (10 mM hver); 6 µL av Phusion utvalg; 318 µL av H2O.
  2. Mix PCR master mix med perler (500 µL totalt), deler i 10 dele 50 µL og forsterke av PCR ved hjelp av følgende:
    30s 98 ° c
    7 sykluser: 10 s på 98 ° c. 30 er på 65 ° C; 30 s ved 72 ° C
    7 min ved 72 ° C
  3. Samle PCR reaksjoner i en ny tube, gjenvinne perler på magnetiske separasjon stå og overføre supernatant (500 µL) inn i et nytt rør.
  4. Rense biblioteket DNA bruker SPRI perler.
    1. Blanding SPRI perler, overføre 460 µL av perlene i en ny tube, og bringe til RT for 15 min. legge 450 µL av SPRI perler til PCR reaksjoner (siste bindet 950 µL), ruge i 5 min på RT og spinne eksemplet på en Borstemmaskin centrifuge for 2-3 s å samle prøven.
    2. Åpne lokket, plasser prøven på magnetiske separasjon står for 5 min og fjerne nedbryting.
    3. Holde perler på magnetiske separasjon stativet, Legg 1 mL av 70% etanol (vol/vol) å prøve rør over et område klar av perler, la for 30 s og Forkast nedbryting.
    4. Gjenta trinn 15.4.3 to ganger mer.
    5. Tørr perler på 37 ° C i en thermomixer (rør lokk åpent) for mer enn 5 minutter.
    6. Legg 51 µL TLE bufferen til prøven, mix, og ruge i 10 min ved 37 ° C, rister på 950 rpm i en thermomixer.
    7. Spin eksemplet på en Borstemmaskin centrifuge for 2-3 s, åpne lokket og sted røret på magnetiske separasjon står for 5 min. overføring klart nedbryting inn i et nytt rør og kaste perler.
    8. Kvantifisere konsentrasjonen av Hi-C biblioteket. Etter 7 runder PCR forsterkning får vi rutinemessig 500-1500 ng Hi-C biblioteket.

16. hybrid i-løsning fange

Merk: Blokkering og buffer (SHS1-4) løsninger nedenfor er fra SureSelect kit (se Tabell for materiale).

  1. Overføre 500 ng til 1 µg Hi-C biblioteket til en ny tube og fordampe prøve på et vakuum konsentrator (se Tabell av materialer, 45 ° C, tomrommet trykket: nivå 30,0, rampen 5) til tørr.
  2. Nytt suspendere fordampet Hi-C-biblioteket ved å legge til 3,6 µL av H2O (molekylærbiologi grad), 2,5 µL av blokkering 1, 2,5 µL av blokkering 2 og 0,6 µL av egendefinerte blokkering.
  3. Overføre utvalg til et godt av en ny PCR tube stripe, tett med en PCR cap stripe og plassere på is. Etiketten som "D" (for Hei-C DNA).
  4. Forberede hybridisering bufferen: 12.5 µL av SHS1 buffer; 0,5 µL av SHS2 buffer; 5 µL av SHS3 buffer; 6.5 µL SHS4 bufferen.
  5. Inkuber ved 65 ° C i 5 minutter i en thermomixer. Overføre til et godt av en ny PCR tube stripe, tett med en PCR cap stripe og holde på RT. etiketten som "H" (for hybridisering buffer).
  6. I et godt av en ny PCR tube stripe, blande 5 µL av 100 ng/µL biotinylated RNA sonder (butikken på-80 ° C og tine på is like før bruk); 0,5 µL av SRNase B (RNase hemmer) og 1,5 µL av H2O (molekylærbiologi grad).
  7. Lukk PCR tube stripen med PCR cap stripe og sted på is. Etiketten som "R" (for RNA).
  8. Definere PCR maskin med følgende parametere:
    5 minutter til 95 ° c. 25 h på 65 ° C; lokk oppvarmet; 29 µL PCR reaksjon volum.
    Merk: Fortsett så raskt som mulig under alle prosedyrer mens PCR maskinen kjører for å unngå eksempel fordampning.
  9. Plasser "D" PCR tube stripen i PCR maskinen, stenger PCR maskin lokket og starte PCR reaksjonen. Når programmet PCR når 65 ° C, åpne PCR maskin lokket og sted "H" PCR tube stripen i PCR maskinen. Lukk PCR maskin lokket og ruge for 3 min. Åpne PCR maskin lokket, "R" PCR røret stripe på PCR maskinen og lukke den PCR-maskinen.
  10. Etter 2 min, åpne PCR maskin lokk og alle PCR tube strimler. Overføre 13 µL av godt "H" i godt "R", så alle volum av godt "D" til godt "R". Pipetter opp og ned 3 ganger å blande reaksjonen, nær PCR tube stripen, fjerne "H" og "D" PCR rør strimler og lukke PCR maskin lokket. Inkuber reaksjonen på 65 ° C i 24 timer.

17. isolering av arrangøren Fragment som inneholder Ligation produkter

Merk: Følgende er anbefalt gjøres med SureSelect adaptersettet og biblioteket (se Tabell av Materals).

  1. Forvarm 1,5 mL vaskebuffer 2 per prøve på 65 ° C på forhånd.
  2. Legg 60 µL av streptavidin-kombinert magnetiske perler (se Tabell of Materials) til en ny tube, plassere på magnetiske separasjon stativ for 1 min og fjerne nedbryting.
  3. Vask perler tre ganger med 200 µL av 1 x bindende buffer.
    Merk: For hvert vask trinn under post fangst isolering av arrangøren inneholder ligation produkter å suspendere perler i tilsvarende bufferen, rotere i 3 minutter på RT og 15 rpm på et roterende hjul, sakte spinne røret i en Borstemmaskin centrifuge for 2-3 s å samle eksempel, sted røret på magnetiske separasjon står for 3 min, og fjern nedbryting.
  4. Nytt avbryte perler 200 µL av 1 x bindende buffer. Åpne PCR maskinen og PCR tube strip (mens PCR-programmet kjøres) og overføre hybridisering reaksjonen til røret med magnetiske perler. Ruge på RT i 30 min på et roterende hjul på 3 rpm.
  5. Gjenvinne perler på magnetiske separasjon stand og fjerne klart nedbryting. Nytt suspendere perler til 500 µL av vaskebuffer 1, mix, og ruge i 15 min ved 20 ° C mens riste på 950 rpm i en thermomixer.
  6. Gjenvinne perler på magnetiske separasjon står for 3 min og fjerne klart nedbryting. Nytt suspendere perler til 500 µL av vaskebuffer 2, bland og ruge 10 minutter til 65 ° C mens riste på 950 rpm i en thermomixer. Gjenta trinn 17,5 to ganger mer.
  7. Gjenvinne perler på magnetiske separasjon standen, fjerne klart nedbryting og å suspendere perler i 200 µL av 1 x begrensning-buffer 2. Gjenvinne perler på magnetiske separasjon standen, fjerne nedbryting og å suspendere perler inn 30 µL av 1 x begrensning-buffer 2.

18. PCHi-C biblioteket forsterkning

  1. Klargjør PCR master blandingen: 60 µL av 5 x PCR buffer (Phusion buffer), 3,6 µL av 25 µM PE PCR primer 1.0, 3,6 µL av 25 µM PE PCR primer 2.0, 8.4 µL dNTP blanding (10 mM hver), 3,6 µL av Phusion utvalg og 190.8 µL av H2O.
  2. Mix PCR master mix med perler (300 µL totalt), skillet i 6 dele 50 µL, og PCR-forsterke bruker følgende betingelser:
    30 s på 98 ° C
    4 sykluser: 10 s på 98 ° C, 30 s på 65 ° C, 30 s ved 72 ° C
    7 min ved 72 ° C
  3. Samle alle PCR reaksjoner i et nytt rør, gjenvinne perlene på magneten og overføre nedbryting (300 µL; inneholder PCHi-C bibliotek) i slik ny.
  4. Rense PCHi-C biblioteket med SPRI perler, fremgangsmåten beskrevet ovenfor under 15,4.
  5. Kvantifisere konsentrasjonen av PCHi-C biblioteket.

Representative Results

Promotoren fange Hi-C er brukt til å berike musen7,34,36,39 og menneskelige33,35,37,38 Hi-C biblioteker for Promotoren samhandling. En lignende protokoll (kalt HiCap) har blitt beskrevet av Sandberg gruppe40. Figur 1A viser skjematisk arbeidsflyten for arrangøren fange Hi-C. I protokollen beskrevet her, er Hi-C biblioteker generert ved hjelp i kjernen ligation41, som resulterer i en betydelig redusert antall falske ligation produkter42. PCHi-c, svært komplekse musen eller menneskelig Hi-C biblioteker er utsatt for-løsning hybridisering og fange 39,021 biotinylated RNAs utfyllende 22,225 musen promoter inneholder HindIII begrensning fragmenter eller 37,608 biotinylated RNAs målretting 22,076 menneskelige promoter inneholder HindIII begrensning fragmenter, henholdsvis. Arrangøren som inneholder begrensningen fragmenter kan være målrettet på en eller begge sider av personlige biotinylated RNAs (figur 1B). Vi fant at erobringen av begge ender bedre dekning av personlige arrangører (figur 1 c, rå sekvens leser) nesten to ganger, som forventet. Således, når mulig (dvs. i ikke-gjentatte områder), anbefaler vi for å bruke biotinylated RNAs utfyllende til begge ender av en begrensning fragment å bli tatt.

For å vurdere PCHi-C biblioteket kvalitet på et tidlig tidspunkt under bibliotek forberedelse, utfører vi to kontroller etter DNA ligatur og rensing, som beskrevet tidligere31. Først er å bruke bestemte primer par for å forsterke ligation produkter som 3 C27. Vi bruker primer par (tabell 1) for å forsterke celle-type konstant langtrekkende ligation produkter, eksempel mellom Myc genet og de kjente enhancers ligger ca 2 Mb unna (figur 2A) eller mellom gener av Hist1 locus ( atskilt med 1,5 Mb), og mellom to regioner lineær nærhet ('kort rekkevidde control').

Den andre kvalitetskontrollen er gjennomført for å fastslå effektiviteten av biotin innlemmelse under Klenow-mediert utfylling av begrensning området overheng med biotin-dATP. Vellykket Klenow utfylling og påfølgende Butt-end ligation resultatene i forsvinningen av den opprinnelige begrensning området mellom DNA-molekyler ligation produktet, og i tilfelle HindIII i dannelsen av en ny NheI anerkjennelse webområdet (figur 2B ). HindIII NheI fordøyd ligation produktet er en direkte presentasjon av biotin innlemmelse effektivitet. Et dårlig kvalitet Hi-C bibliotek viser høy HindIII fordøyelsen, mens høy kvalitet bibliotekene har nesten fullstendig NheI fordøyelsen av hemorroider produkter (figur 2B).

Etter Hi-C biblioteket forberedelse (dvs. etter biotin-streptavidin trekke ned av størrelse valgt Hi-C ligation produkter, kortet ligatur og før fange PCR), er integritet og størrelse distribusjon av Hi-C biblioteket vurdert ved Bioanalyzer (figur 2 C). den samme kontrollen utføres på slutten av PCHi-C biblioteket forberedelse (dvs. etter hybridisering erobringen av arrangøren inneholder ligation produkter og etter fangst PCR). Sammenligning av Hi-C og PCHi-C Bioanalyzer profiler viser at som forventet, Hi-C bibliotekene er mye mer konsentrert enn tilsvarende PCHi-C bibliotekene, men størrelsesDistribusjon av bibliotekene er svært lik, som angir at fange trinn i PCHi-C innføre ikke en størrelse bias (figur 2C, D).

Etter par-end sekvensering, den PCHi-C lest tilordnes, kontrollert og filtrert bruke HiCUP rørledning43. Høykvalitets PCHi-C biblioteker inneholder mellom 70-90% "gyldig parene" (dvs. sammen-end sekvens leser mellom to begrensning fragmenter som ikke er nabolandet på lineær genomisk kartet; Figur 3A, B). Bruker i kjernen ligation protokoll41,42, lest prosentandelen av trans par (dvs. sammen-end sekvens leser mellom to begrensning fragmenter som er plassert på ulike kromosomer) er vanligvis lav, mellom 5 og 25%, reflekterer kromosom territorier, og viser godt bibliotek kvalitet. Direkte sammenligning av andelen "gyldig parene" mellom Hi-C biblioteker og deres tilsvarende PCHi-C biblioteker35, viser at i alle tilfeller prosentandelen av gyldig parene er høyere i PCHi-C bibliotekene (figur 3B). Dette er ledsaget av en reduksjon i prosent for ugyldig 'samme fragmentere interne"leser i PCHi-C (Figur 3 c). Dette er forventet, fange trinnet ikke bare beriker for arrangøren inneholder ligation produkter, men også for begrensning fragment ender, på grunn av plasseringen av fange oligos om begrensning fragmenter (se figur 1B).

Etter HiCUP filtrering, bestemmer vi fange effektiviteten. PCHi-C biblioteker inneholder tre typer gyldig sekvens leser etter HiCUP filtrering:
1.) promoter: genomet leser (dvs. leser mellom et fanget promoter fragment og et ikke-arrangøren HindIII begrensning fragment overalt i genomet)
2.) promoter: arrangøren leser (leser mellom to fanget promoter fragmenter)
3.) genom: genomet leser (bakgrunn Hi-C ligation produkter der ingen av hemorroider produktet tilordnes en fanget promoter). Disse forkastes før nedstrøms analyser.

Høykvalitets PCHi-C biblioteker har fange effektivitet (summen av 1 og 2 over) mellom 65 – 90% (figur 3D). En direkte sammenligning til Hi-C biblioteker viser at PCHi-C resulterer i en ~ 15-fold berikelse for arrangøren inneholder ligation produkter (figur 3D), i noen tilfeller 17-fold. Dette er nær den hypotetiske maksimalt (19.6-fold) berikelse for PCHi-C, som er avhengig av andelen genomet begrensning fragmenter dekket av fange systemet. Større berikelse kan oppnås ved å utforme fange systemer målretting færre restriksjoner fragmenter44,45,46.

Analyse av arrangøren interactomes demonstrerer celle type og avstamning-spesifisitet33,34,35, uttales endringer under differensiering37,38,39 . Tallene 4 og 5 viser eksempler på avstamning spesifisitet og differensiering dynamikk på bestemte arrangørene. For eksempel ALAD er constitutively uttrykt i alle celler, men uttrykket er upregulated erythroblasts47. ALAD selskapet kontakter flere distale fragmenter i alle blodkreft cellene og han ekstra samspill i erythroblasts (Figur 4). IL-8 viser ingen statistisk signifikante interaksjoner i B-celler, svært få interaksjoner i T celler og dusinvis av interaksjoner i celle av myeloide linjen, inkludert celle-type spesifikke interaksjoner i megakaryocytes, monocytter og nøytrofile ( Figur 5). Disse eksemplene viser hvordan PCHi-C kan brukes til å løse celle-type spesifikke interactomes og identifisere promoter-samspill områder med regulatoriske potensial.

Figure 1
Figur 1 : Promoter fange Hi-C begrunnelsen og fange agn design. (A) skjematisk arbeidsflyten av PCHi-C. I kjernen ligation Hi-C41,42 (I) etterfulgt av-løsning hybridisering med biotinylated RNA agn (II) målretting begrensning fragmenter av alle menneskelige (avbildet her) eller mus gen arrangører (III). (B) agn design for PCHi-C. Biotinylated RNA fange agn (røde buede linjer) er utformet mot endene av arrangøren inneholder begrensning fragmenter (grå, Merk at arrangøren sekvensene seg (rød) bare nås med RNA fange agn hvis de ligger på begrensning fragment ender). Hemorroider produkter promoter inneholder begrensning fragmenter (grå) og deres samspill begrensning fragmenter (gul og grønn) er isolert gjennom sekvens-komplementaritet hybridisering mellom RNA agn og DNA mål, og påfølgende biotin-streptavidin pulldown, som vist i A. (C) sammenligning av PCHi-C fange effektivitet for arrangøren inneholder begrensning fragmenter målrettet av en RNA agn fange sonde vs to RNA agn fange sonder (se skjematisk i B). Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : PCHi-C før sekvensering kvalitetskontroll. (A) igjen, skjematisk av romlige sidestilling mellom selskapet og PIR, noe som resulterer i et Hi-C ligation produkt som består av et promoter inneholder begrensning fragment (grå, formidler sekvens i rødt) og en PIR begrensning fragment (gul). Høyre, DNA gel geleelektroforese viser eksempler på Hi-C ligation produkter forsterket bruker bestemte primer parene (som vist skjematisk til venstre). (B) igjen, HindIII, NheI og HindIII/NheI begrensning eksemplene fordøyer Hi-C ligation produkter (PCR produkter vises i A). Høyre, skjematisk av DNA sekvens etter Hi-C ligation etter mislykket (øverst) eller vellykket (nederst) dNTP Klenow utfylling av begrensning veikryss og påfølgende hemorroider. (C) representant Hi-C biblioteket bioanalyzer profil (1/5 fortynning). (D) representant PCHi-C biblioteket bioanalyzer profil (ingen utvanning). Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : PCHi-C etter sekvensering kvalitetskontroll. (A) sammenligning av prosentandel gyldig sekvens lese par etter HiCUP43 behandling i PCHi-C vs tilsvarende Hi-C-bibliotek (data fra Javierre et al., 201635). (B) representant HiCUP PCHi-C resultatet viser gyldig lese par og andre rekkefølge kategorier som forkastes før nedstrøms analyser (data fra Javierre et al., 201635). (C) sammenligning av 'samme fragment interne' leser etter HiCUP på PCHi-C vs tilsvarende Hi-C-bibliotek (data fra Javierre et al., 201635). (D) sammenligning av prosentandel leser med agnet promoter fragmenter (fange effektivitet) i PCHi-C vs tilsvarende Hi-C biblioteker (data fra Javierre et al., 201635). Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: ALAD PCHi-C profil i blodkreft menneskeceller. Promotoren samhandling myelogen celletyper vises som blå buer, og formidler interaksjoner lymfoide celletyper vises som purpur buer. Erythroblast-spesifikke interaksjoner indikeres av røde piler (data fra Javierre et al., 201635). Klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5 : IL8 PCHi-C profil i blodkreft menneskeceller. Promotoren samhandling myelogen celletyper vises som blå buer, og formidler interaksjoner lymfoide celletyper vises som purpur buer. Monocytt-spesifikke interaksjoner angis med grønne pilene, nøytrofile-spesifikke interaksjoner indikeres av røde piler og en megakaryocyte-spesifikke interaksjon angis av en brun pil (data fra Javierre et al., 201635). Klikk her for å se en større versjon av dette tallet.

Menneskelige
navn Sekvens Kromosom Strand Start GRCh38/hg38 Slutten GRCh38/hg38 Primer kombinasjoner å teste 3C interaksjoner og biotin inkorporering
HS AHF64 Dekker GCATGCATTAGCCTCTGCTGTTCTCTGAAATC 11 + 116803960 116803991 sammen med hs AHF66 Dekker
HS AHF66 Dekker CTGTCCAAGTACATTCCTGTTCACAAACCC 11 + 116810219 116810248 sammen med hs AHF64 Dekker
HS MYC locus GGAGAACCGGTAATGGCAAA 8 - 127733814 127733833 bruke i kombinasjon med hs MYC +1820 eller hs MYC-538
HS MYC +1820 AAAATGCCCATTTCCTTCTCC 8 + 129554527 129554547 sammen med hs MYC locus
HS MYC-538 TGCCTGATGGATAGTGCTTTC 8 - 127195696 127195716 sammen med hs MYC locus
HS HIST1 F AAGCAGGAAAAGGCATAGCA 6 + 26207174 26207193 sammen med hs HIST1 R
HS HIST1 R TCTTGGGTTGTGGGACTTTC 6 + 27771575 27771594 sammen med hs HIST1 F
Mus
Sekvens Kromosom Strand Start GRCm38/mm10 Slutten GRCm38/mm10 Primer kombinasjoner å teste 3C interaksjoner og biotin inkorporering
TCATGAGTTCCCCACATCTTTG 8 + 84841090 84841111 sammen med mm Calr2
CTGTGGGCACCAGATGTGTAAAT 8 + 84848519 84848541 sammen med mm Calr1
TATCAAGGGTGCCCGTCACCTTCAGC 6 + 125163098 125163123 sammen med Gapdh4 Dekker
GGGCTTTTATAGCACGGTTATAAAGT 6 + 125163774 125163799 sammen med Gapdh3 Dekker
GGAGGAGGGAAAAGGAGTGATT 6 + 52212829 52212850 sammen med mm Hoxa13
CAGGCATTATTTGCTGAGAACG 6 - 52253490 52253511 sammen med mm Hoxa7
GGGTAATGGTGTCACTAACTGG 13 + 23571284 23571305 sammen med mm Hist1h3e eller mm Hist1h4i
GGGTTTGATGAGTTGGTGAAG 13 + 23566541 23566561 sammen med mm Hist1h2ae
TTGGGCCAAAGCCTATATGA 13 + 22043085 22043104 sammen med mm Hist1h2ae

Tabell 1: Primer sekvenser for kvalitetskontroll av menneskelige og mus Hi-C biblioteker.

Discussion

Modulær utforming av arrangøren fange Hi-C

Arrangøren fange Hi-C er utformet for å berike spesielt Hi-C biblioteker for samhandlinger med arrangører. Denne samhandlingen omfatter bare et delsett av hemorroider produkter i et Hi-C-bibliotek.

Fange Hi-C kan enkelt endres for å berike Hi-C biblioteker for genomisk regionen eller regioner av interesse ved å endre fange system. Fange regioner kan være kontinuerlig genomisk segmenter44,45,46,48, enhancers som har blitt identifisert i PCHi-C (omvendt fange Hi-C35) og DNase jeg overfølsom nettsteder49 . Størrelsen på systemet kan justeres avhengig av eksperimentelle området. For eksempel Dryden et al. målrette 519 agn fragmenter i tre genet ørkener tilknyttet bryst kreft44. Fange systemet av Martin et al. mål både kontinuerlig genomisk segmenter ('Regionen fange': 211 genomisk regioner totalt; 2,131 begrensning fragmenter) og valgt arrangører (3,857 gen arrangører)45.

SureSelect bibliotek er tilgjengelig i forskjellige størrelse områder: 1 kb 499 KB (5 190-4,806), 500 kb 2.9 MB (5 190-4,816), og 3 Mb til 5,9 Mb (5 190-4,831). Hver enkelt fange biotin-RNA er 120 nukleotider lang, disse fange systemer innkvartere maksimalt 4,158, 24,166 og 49,166 personlige fange sonder, henholdsvis. Dette tilsvarer 2,079, 12,083 og 24,583 målrettet begrensning fragmenter, henholdsvis (Merk at tallene for begrensning fragmenter er nedre basert på antagelsen at to individuelle fange sonder kan være konstruert for hver begrensning fragment — i virkeligheten på grunn av gjentatte sekvenser vil dette ikke være tilfelle for hver begrensning fragmentere (se også figur 1B, C), som resulterer i mange av targetable begrensning for et konstant antall tilgjengelige fange sonder ).

Protokollen beskrevet her er basert på bruk av en begrensning enzym med en 6 bp anerkjennelse webområdet å avdekke langtrekkende interaksjoner. Bruke en begrensning enzym med en 4 bp anerkjennelse webområdet for høyere oppløsning på mer proksimale interaksjoner er også mulig40,49.

Begrensningene for PCHi-C

En iboende begrensning av alle kromosom konformasjon fange analyser er at oppløsningen bestemmes av begrensning enzymet brukes til generering av biblioteket. Samhandlinger som oppstår mellom DNA elementer på samme begrensning fragmentet er usynlige for 'C-type-analyser. Videre, i PCHi-C, i noen tilfeller flere transkripsjon startwebstedet kan være plassert på samme promoter inneholder begrensning fragmentet og PIRs i noen tilfeller havn både aktive og undertrykkende histone merker, gjør det vanskelig å finne som regulatoriske elementer megle interaksjoner, og forutsi regulatoriske utdataene for arrangøren interaksjoner. Bruker begrensningen enzymer med 4 bp anerkjennelse nettsteder dette problemet men kommer på bekostning av vesentlig økt Hi-C biblioteket kompleksitet (Hi-C biblioteker generert med 4 bp anerkjennelse området begrensning enzymer er minst 100 ganger mer komplekse enn Hi-C biblioteker generert med 6 bp anerkjennelse området begrensning enzymer) og tilhørende kostnader for neste generasjons sekvensering.

En annen begrensning er at den nåværende PCHi-C-protokollen krever millioner av celler som starter materiale, slik at analyse av arrangøren interaksjoner i sjeldne celletyper. En modifisert versjon av PCHi-C for å aktivere avhør av arrangøren kontakter i celle populasjoner med 10 000 til 100.000 celler (for eksempel celler under embryonale utviklingen eller blodkreft stamceller) vil derfor være et verdifullt tillegg til fange Hei-C verktøykasse.

Til slutt, som alle metoder som er avhengige av formaldehyd fiksering, PCHi-C bare registrerer interaksjoner som er "frosset" på tidspunktet for fiksering. Dermed for å studere kinetics og dynamikken i Promotoren samhandling, er metoder som Super-oppløsning levende celle mikroskopi nødvendig sammen med PCHi-C.

Metoder for å analysere romlige kromosom organisasjon med høy oppløsning

Store kompleksiteten av chromosomal samhandling biblioteker forbyr pålitelig identifikasjon av samspillet mellom to spesifikk begrensning fragmenter med statistiske betydning. For å omgå dette problemet, har sekvens fangst blitt brukt til å berike Hi-C33,34,40,44 eller 3 C50,51 biblioteker for spesifikke interaksjoner. Den største fordelen ved hjelp Hi-C biblioteker over 3C biblioteker for berikelse trinn er at Hi-C, i motsetning til 3C, inneholder en berikelse trinn for ekte ligation produkter. Som en konsekvens, er ønsket gyldig leser i PCHi-C biblioteker ca 10-fold høyere enn i fangst-C biblioteker50, som inneholdt rundt 5-8% gyldig leser etter HiCUP filtrering. Sahlen et al. sammenlignet direkte fangst-C for å HiCap, som i likhet PCHi-C bruker Hi-C biblioteker for fangst berikelse, i motsetning Capture-C som bruker 3 C-biblioteker. I samsvar med våre funn, fant de at fange-C biblioteker er hovedsakelig sammensatt av un ligated fragmenter40. I tillegg hadde HiCap biblioteker en høyere kompleksitet enn fangst-C biblioteker40.

En variant av fangst-C, kalt neste generasjons fangst-C52 (NG fangst-C) bruker en oligo per begrensning fragment slutten, tidligere etablert i PCHi-C33,34, i stedet for overlappende sonder brukes i opprinnelige Fange-C protokoll50. Dette øker andelen gyldig leser forhold til fange-C beskjedent, men NG fangst-C sysselsetter sekvensiell budrundene fange berikelse, og et relativt høyt antall PCR sykluser (20-24 sykluser totalt sammenlignet 11 sykluser vanligvis PCHi-c), som uunngåelig resulterer i høyere antall sekvens duplikater og lavere biblioteket kompleksitet. I rettssaken eksperimenter i optimalisering av PCHi-C, fant vi at prosentandelen av unike (dvs. ikke dupliseres) lese par var rundt bare 15% når vi brukte 19 PCR sykluser (13 sykluser før fange + 6 sykluser etter fange; dataene ikke), men optimalisering til et lavere antall PCR sykluser, vanligvis gir 75 – 90% unike Les par. Dermed øker reduserer PCR sykluser vesentlig mengden informativ sekvens data.

En nyere metode kombinerer ChIP med Hi-C for å fokusere på chromosomal interaksjoner formidlet av et bestemt protein av interesse (HiChIP53). Sammenlignet med ChIA-PET54, som er basert på en lignende begrunnelse, inneholder HiChIP dataene mange informative sekvens lyder, slik at høyere interaksjon ringer53. Det vil være svært interessant for direkte sammenligne de tilsvarende HiChIP og fange Hi-C datasett de blir når tilgjengelig (for eksempel HiChIP bruke et antistoff mot cohesin enhet Smc1a53 med fange Hi-C for alle Smc1a bundet begrensning fragmenter) side ved side. En iboende forskjellen mellom disse to tilnærmingene er at fange Hi-C ikke er avhengig av chromatin immunoprecipitation, og derfor er i stand til å forhøre chromosomal interaksjoner uansett protein innkvartering. Dette gjør sammenligning av 3D genomet organisasjon på tilstedeværelse eller fravær av momentet bindende som er brukt til å identifisere PRC1 som en viktig regulator av musen ESC romlige genomet arkitektur7.

PCHi-C og GWAS

Genomet hele association studier (GWAS) har avdekket at mer enn 95% av sykdomsassosierte sekvens varianter finnes i ikke-koding regioner i genomet, ofte på store avstander til protein-koding gener55. GWAS varianter er ofte funnet i nærheten DNase jeg overfølsom områder, som er et kjennetegn på sekvenser med potensielle regulatoriske aktivitet. PCHi-C og fange Hi-C har blitt brukt mye koble arrangører til GWAS risiko loci innblandet i brystkreft kreft44, tykktarmskreft48og autoimmune sykdommer35,45,46. En PCHi-C studier på 17 ulike menneskelige blodkreft celle typer funnet SNPs tilknyttet autoimmun sykdom ble anriket på PIRs i lymfoide celler, mens sekvens varianter tilknyttet blodplater og røde blodlegemer særtrekk fant hovedsakelig i makrofager og erythroblasts, henholdsvis35,56. Dermed vev-type bestemt arrangøren interactomes avdekket ved PCHi-C kan bidra til å forstå funksjonen av ikke-koding sykdomsassosierte sekvens varianter og identifisere nye potensielle sykdom gener for terapeutisk intervensjon.

Egenskapene til arrangøren-samspill regioner

Flere linjer av bevis link arrangøren interactomes gene expression kontroll. Først flere PCHi-C studier har vist at genomisk regioner samarbeidsstil arrangører av (svært) uttrykt gener er beriket i merker tilknyttet enhancer aktivitet, for eksempel H3K27 acetylation og p300 bindende33,34 , 37. vi fant en positiv korrelasjon mellom gene expression nivå og antall samspill enhancers, antyder at additiv effekter av enhancers resultere i økt genuttrykk nivåer34,35. Andre naturlig forekommende uttrykk kvantitative egenskap loci (eQTLs) er beriket i PIRs som er koblet til samme gener som uttrykk er påvirket av eQTLs35. Tredje ved å integrere tur57 og PCHi-C data, funnet Cairns et al. at turen reporter gener tilordning til PIRs i musen ESCs vise sterkere reporter genuttrykk enn reporter gener på integrering steder i ikke-arrangøren-samspill regioner 58, som angir at PIRs har transcriptional regulatoriske aktivitet. Sammen tyder disse funnene på at selskapet interactomes avdekket ved PCHi-C i forskjellige mus og menneskelige celletyper inkluderer viktige forskrifter moduler for gene expression kontroll.

Det er verdt å merke seg at enhancers representerer bare en liten brøkdel (~ 20%) av alle PIRs avdekket ved PCHi-C33,34. Andre PIRs kan ha strukturelle eller topologisk roller i stedet for direkte transcriptional regulatoriske funksjoner. Men er det også bevis for at PCHi-C kan avdekke DNA elementer med regelverket som ikke havn klassisk enhancer merker. I en human lymfoide celle linje, ble BRD7 selskapet funnet for å samhandle med et område uten enhancer merker som ble vist å ha enhancer aktivitet reporter genet analyser33. Regulatoriske elementer med lignende egenskaper kan være mer rikelig enn er verdsatt. For eksempel markerer en CRISPR-basert skjerm for regulatoriske DNA elementer identifisert umerkede regulatoriske elementer (utfall) kontrollere genuttrykk er blottet for enhancer59.

I andre tilfeller har PIRs vist å havn chromatin merker knyttet transcriptional undertrykkelse. PIRs og samspill arrangører bundet av PRC1 i musen ESCs var engasjert i et omfattende romlige nettverk av fortrengte gener bærer det undertrykkende merke H3K27me37. I menneskelig lymphoblastoid celler, en Fjern element samspill med BCL6 arrangøren undertrykt transgene reporter gene expression33, tyder på at det kan fungere for å undertrykke BCL6 transkripsjon i sin opprinnelige sammenheng.

PIRs beriket for bruk av chromatin isolator protein CTCF i menneskelig ESCs og NECs37 kan representere enda en klasse av PIRs. Samlet tyder disse resultatene på at PIRs havn samling genet regulatoriske aktiviteter ennå å være funksjonelt preget.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Vi takker Valeriya Malysheva for kritisk lesing av manuskriptet og eksperthjelp med figur 1. Dette arbeidet ble støttet av i Medical Research Council, UK (MR/L007150/1) og UK bioteknologi og Biological Sciences Research Council, UK (BB/J004480/1).

Materials

Name Company Catalog Number Comments
16% (vol/vol) paraformaldehyde solution Agar Scientific R1026
Dulbecco's Modified Eagle Medium (DMEM) 1x Life Technologies 41965-039
Fetal bovine serum (FBS) sterile filtered Sigma  F9665
Low-retention filter tips  Starlab S1180-3810, S1180-1810, S1180-8810 and S1182-1830
10x PBS pH 7.4 Life Technologies 70011-036
Molecular biology grade water Sigma-Aldrich W4502
1 M Tris-HCl pH 8.0 Life Technologies 15568-025
IGEPAL CA-630  Sigma-Aldrich I8896
5 M NaCl  Life Technologies 24740-011
Protease inhibitor cocktail (EDTA-free)  Roche Diagnostics 11873580001
Restriction buffer 2 (10x NEBuffer 2) New England Biolabs B7002
DNA LoBind tube, 1.5 mL  Eppendorf 0030 108.051
DNA LoBind tube, 2 mL Eppendorf 30108078
20% (wt/vol) SDS   Bio-Rad Laboratories 161-0418
20% (vol/vol) Triton X-100  Sigma-Aldrich T8787
HindIII, 100 U/uL New England Biolabs R0104
10 mM dCTP  Life Technologies 18253-013
10 mM dGTP Life Technologies 18254-011
10 mM dTTP  Life Technologies 18255-018
0.4 mM Biotin-14-dATP Life Technologies 19524-016
DNA polymerase I large (Klenow) fragment 5000 units/mL New England Biolabs M0210
10x T4 DNA ligase reaction buffer  New England Biolabs B0202
100x 10mg/ml Bovine Serum Albumin  New England Biolabs B9001
T4 DNA ligase, 1 U/μL  Invitrogen 15224-025
RNase A  Roche 10109142001
Proteinase K, recombinant, PCR grade  Roche 3115836001
20 000×g 50 ml centrifuge tube VWR 525-0156
0.5 M EDTA pH 8.0  Life Technologies 15575-020
Phenol pH 8.0  Sigma P4557
Phenol: Chloroform: Isoamyl Alcohol 25:24:1  Sigma P3803
Sodium acetate pH 5.2  Sigma S7899
Quant-iT PicoGreen  Invitrogen P7589
QIAquick Gel Extraction Kit Qiagen 28704
QIAquick PCR Purification Kit Qiagen 28104
Restriction buffer 2.1 (10x NEBuffer 2.1) New England Biolabs B7202
NheI, 100U/uL New England Biolabs R0131
Micro TUBE AFA Fiber Pre-slit snap cap 6x16mm vials  Covaris 520045 For sonication
SPRI beads (Agencourt AMPure XP)  Beckman Coulter A63881
Dynabeads MyOne Streptavidin C1 beads  Invitrogen 65001
Tween 20  Sigma P9416
10 mM dATP  Life Technologies 18252-015
T4 DNA polymerase 3000 units/mL New England Biolabs M0203
T4 PNK 10000 units/mL New England Biolabs M0201
Klenow exo minus 5000 units/mL  New England Biolabs M0212
Quick ligation reaction buffer  New England Biolabs B6058
NEB DNA Quick ligase  New England Biolabs M2200
PE adapter 1.0 (5'-P-GATCGGAAGAGCGGTTCAGC
AGGAATGCCGAG-3')
Illumina
PE adapter 2.0 (5'-ACACTCTTTCCCTACACGACGCT
CTTCCGATCT-3')
Illumina
NEB Phusion PCR kit  New England Biolabs M0530
PE PCR primer 1.0 (5'-AATGATACGGCGACCACCGA
GATCTACACTCTTTCCCTAC
ACGACGCTCTTCCGATCT-3')
Illumina
PE PCR primer 2.0 (5'-CAAGCAGAAGACGGCATACGA
GATCGGTCTCGGCATTCCT
GCTGAACCGCTCTTCCGATCT-3') 
Illumina
PCR strips  Agilent Technologies 410022 and 401425
SureSelect SSEL TE Reagent ILM PE full adaptor kit  Agilent Technologies 931108
SureSelect custom 3-5.9 Mb library  Agilent Technologies 5190-4831 custom design mouse or human PCHi-C system
Dynabeads MyOne Streptavidin T1 beads  Invitrogen 65601
E220  high-performance focused ultra-sonicator Corvaris E220

DOWNLOAD MATERIALS LIST

References

  1. Osborne, C. S., et al. Active genes dynamically colocalize to shared sites of ongoing transcription. Nature Genetics. 36, 1065-1071 (2004).
  2. Schoenfelder, S., et al. Preferential associations between co-regulated genes reveal a transcriptional interactome in erythroid cells. Nature Genetics. 42, 53-61 (2010).
  3. de Wit, E., et al. The pluripotent genome in three dimensions is shaped around pluripotency factors. Nature. 501, 227-231 (2013).
  4. Bantignies, F., et al. Polycomb-dependent regulatory contacts between distant Hox loci in Drosophila. Cell. 144, 214-226 (2011).
  5. Engreitz, J. M., et al. The Xist lncRNA exploits three-dimensional genome architecture to spread across the X chromosome. Science. 341, 1237973 (2013).
  6. Denholtz, M., et al. Long-range chromatin contacts in embryonic stem cells reveal a role for pluripotency factors and polycomb proteins in genome organization. Cell Stem Cell. 13, 602-616 (2013).
  7. Schoenfelder, S., et al. Polycomb repressive complex PRC1 spatially constrains the mouse embryonic stem cell genome. Nature Genetics. 47, 1179-1186 (2015).
  8. Kundu, S., et al. Polycomb Repressive Complex 1 generates discrete compacted domains that change during differentiation. Molecular Cell. 65, 432-446 (2017).
  9. Skok, J. A., Gisler, R., Novatchkova, M., Farmer, D., de Laat, W., Busslinger, M. Reversible contraction by looping of the Tcra and Tcrb loci in rearranging thymocytes. Nature Immunology. 8, 378-387 (2007).
  10. Zhang, Y., et al. Spatial organization of the mouse genome and its role in recurrent chromosomal translocations. Cell. 148, 908-921 (2012).
  11. Aymard, F., et al. Genome-wide mapping of long-range contacts unveils clustering of DNA double-strand breaks at damaged active genes. Nature Structural & Molecular Biology. 24, 353-361 (2017).
  12. Ryba, T., et al. Evolutionarily conserved replication timing profiles predict long-range chromatin interactions and distinguish closely related cell types. Genome Research. 20, 761-770 (2010).
  13. Pope, B. D., et al. Topologically associating domains are stable units of replication-timing regulation. Nature. 515, 402-405 (2014).
  14. Chandra, T., et al. Global reorganization of the nuclear landscape in senescent cells. Cell Reports. 10, 471-483 (2015).
  15. Carter, D., Chakalova, L., Osborne, C. S., Dai, Y. F., Fraser, P. Long-range chromatin regulatory interactions in vivo. Nature Genetics. 32, 623-626 (2002).
  16. Tolhuis, B., Palstra, R. J., Splinter, E., Grosveld, F., de Laat, W. Looping and interaction between hypersensitive sites in the active beta-globin locus. Molecular Cell. 10, 1453-1465 (2002).
  17. Amano, T., Sagai, T., Tanabe, H., Mizushina, Y., Nakazawa, H., Shiroishi, T. Chromosomal dynamics at the Shh locus: limb bud-specific differential regulation of competence and active transcription. Developmental Cell. 16, 47-57 (2009).
  18. Zuniga, A., et al. Mouse limb deformity mutations disrupt a global control region within the large regulatory landscape required for Gremlin expression. Genes & Development. 18, 1553-1564 (2004).
  19. Sagai, T., Hosoya, M., Mizushina, Y., Tamura, M., Shiroishi, T. Elimination of a long-range cis-regulatory module causes complete loss of limb-specific Shh expression and truncation of the mouse limb. Development. 132, 797-803 (2005).
  20. D'Haene, B., et al. Disease-causing 7.4 kb cis-regulatory deletion disrupting conserved non-coding sequences and their interaction with the FOXL2 promotor: implications for mutation screening. PLoS Genet. 5, e1000522 (2009).
  21. Sur, I. K., et al. Mice lacking a Myc enhancer that includes human SNP rs6983267 are resistant to intestinal tumors. Science. 338, 1360-1363 (2012).
  22. Herranz, D., et al. A NOTCH1-driven MYC enhancer promotes T cell development, transformation and acute lymphoblastic leukemia. Nature Medicine. 20, 1130-1137 (2014).
  23. Deng, W., et al. Controlling long-range genomic interactions at a native locus by targeted tethering of a looping factor. Cell. 149, 1233-1244 (2012).
  24. Groschel, S., et al. A single oncogenic enhancer rearrangement causes concomitant EVI1 and GATA2 deregulation in leukemia. Cell. 157, 369-381 (2014).
  25. Lupianez, D. G., et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell. 161, 1012-1025 (2015).
  26. Franke, M., et al. Formation of new chromatin domains determines pathogenicity of genomic duplications. Nature. 538, 265-269 (2016).
  27. Dekker, J., Rippe, K., Dekker, M., Kleckner, N. Capturing chromosome conformation. Science. 295, 1306-1311 (2002).
  28. Simonis, M., et al. Nuclear organization of active and inactive chromatin domains uncovered by chromosome conformation capture-on-chip (4C). Nature Genetics. 38, 1348-1354 (2006).
  29. Zhao, Z., et al. Circular chromosome conformation capture (4C) uncovers extensive networks of epigenetically regulated intra- and interchromosomal interactions. Nature Genetics. 38, 1341-1347 (2006).
  30. Dostie, J., et al. Chromosome Conformation Capture Carbon Copy (5C): A massively parallel solution for mapping interactions between genomic elements. Genome Research. 16, 1299-1309 (2006).
  31. Lieberman-Aiden, E., et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 326, 289-293 (2009).
  32. Belton, J. M., McCord, R. P., Gibcus, J. H., Naumova, N., Zhan, Y., Dekker, J. Hi-C: a comprehensive technique to capture the conformation of genomes. Methods. 58, 268-276 (2012).
  33. Mifsud, B., et al. Mapping long-range promoter contacts in human cells with high-resolution capture Hi-C. Nature Genetics. 47, 598-606 (2015).
  34. Schoenfelder, S., et al. The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements. Genome Res. 25, 582-597 (2015).
  35. Javierre, B. M., et al. Lineage-specific genome architecture links enhancers and non-coding disease variants to target gene promoters. Cell. 167, 1369-1384 (2016).
  36. Wilson, N. K., et al. Integrated genome-scale analysis of the transcriptional regulatory landscape in a blood stem/progenitor cell model. Blood. 127, e12-e23 (2016).
  37. Freire-Pritchett, P., et al. Global reorganisation of cis-regulatory units upon lineage commitment of human embryonic stem cells. Elife. 6, (2017).
  38. Rubin, A. J., et al. Lineage-specific dynamic and pre-established enhancer-promoter contacts cooperate in terminal differentiation. Nature Genetics. 49, 1522-1528 (2017).
  39. Siersbaek, R., et al. Dynamic rewiring of promoter-anchored chromatin loops during adipocyte differentiation. Molecular Cell. 66, 420-435 (2017).
  40. Sahlen, P., et al. Genome-wide mapping of promoter-anchored interactions with close to single-enhancer resolution. Genome Biology. 16, 156 (2015).
  41. Nagano, T., et al. Single-cell Hi-C reveals cell-to-cell variability in chromosome structure. Nature. 502, 59-64 (2013).
  42. Nagano, T., Varnai, C., Schoenfelder, S., Javierre, B. M., Wingett, S. W., Fraser, P. Comparison of Hi-C results using in-solution versus in-nucleus ligation. Genome Biology. 16, 175 (2015).
  43. Wingett, S., et al. HiCUP: pipeline for mapping and processing Hi-C data. F1000 Res. 4, 1310 (2015).
  44. Dryden, N. H., et al. Unbiased analysis of potential targets of breast cancer susceptibility loci by Capture Hi-C. Genome Research. 24, 1854-1868 (2014).
  45. Martin, P., et al. Capture Hi-C reveals novel candidate genes and complex long-range interactions with related autoimmune risk loci. Nature Communications. 6, 10069 (2015).
  46. McGovern, A., et al. Capture Hi-C identifies a novel causal gene, IL20RA, in the pan-autoimmune genetic susceptibility region 6q23. Genome Biol.ogy. 17, 212 (2016).
  47. Hodge, D., et al. A global role for EKLF in definitive and primitive erythropoiesis. Blood. 107, 3359-3370 (2006).
  48. Jager, R., et al. Capture Hi-C identifies the chromatin interactome of colorectal cancer risk loci. Nature Communications. 6, 6178 (2015).
  49. Joshi, O., et al. Dynamic reorganization of extremely long-range promoter-promoter Interactions between two states of pluripotency. Cell Stem Cell. 17, 748-757 (2015).
  50. Hughes, J. R., et al. Analysis of hundreds of cis-regulatory landscapes at high resolution in a single, high-throughput experiment. Nature Genetics. 46, 205-212 (2014).
  51. Kolovos, P., et al. Targeted Chromatin Capture (T2C): A novel high-resolution high-throughput method to detect genomic interactions and regulatory elements. Epigenetics Chromatin. 7, 10 (2014).
  52. Davies, J. O., et al. Multiplexed analysis of chromosome conformation at vastly improved sensitivity. Nature Methods. 13, 74-80 (2016).
  53. Mumbach, M. R., et al. HiChIP: efficient and sensitive analysis of protein-directed genome architecture. Nature Methods. 13, 919-922 (2016).
  54. Fullwood, M. J., et al. An oestrogen-receptor-alpha-bound human chromatin interactome. Nature. 462, 58-64 (2009).
  55. Maurano, M. T., et al. Systematic localization of common disease-associated variation in regulatory DNA. Science. 337, 1190-1195 (2012).
  56. Petersen, R., et al. Platelet function is modified by common sequence variation in megakaryocyte super enhancers. Nat. Commun. 8, 16058 (2017).
  57. Akhtar, W., et al. Chromatin position effects assayed by thousands of reporters integrated in parallel. Cell. 154, 914-927 (2013).
  58. Cairns, J., et al. CHiCAGO: Robust detection of DNA looping interactions in Capture Hi-C data. Genome Biology. 17, 127 (2016).
  59. Rajagopal, N., et al. High-throughput mapping of regulatory DNA. Nature Biotechnology. 34, 167-174 (2016).
Promotoren fange Hei-C: Med høy oppløsning, genomet-bred profilering av arrangøren interaksjoner
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Schoenfelder, S., Javierre, B. M., Furlan-Magaril, M., Wingett, S. W., Fraser, P. Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions. J. Vis. Exp. (136), e57320, doi:10.3791/57320 (2018).More

Schoenfelder, S., Javierre, B. M., Furlan-Magaril, M., Wingett, S. W., Fraser, P. Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions. J. Vis. Exp. (136), e57320, doi:10.3791/57320 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter