Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Zebrafish जल्दी भ्रूण और ट्यूमर में सेलुलर विद्युत गतिविधि के दृश्य

doi: 10.3791/57330 Published: April 25, 2018

Summary

यहां, हम एक सेलुलर बिजली वोल्टेज रिपोर्टर zebrafish लाइन बनाने की प्रक्रिया दिखाने के लिए भ्रूण विकास, आंदोलन, और vivo मेंमछली ट्यूमर कोशिकाओं कल्पना ।

Abstract

जैव विद्युत, अंतर्जात विद्युत सिग्नलिंग आयन चैनलों और पंपों सेल झिल्ली पर स्थित द्वारा मध्यस्थता, उत्तेजित न्यूरॉन और मांसपेशियों की कोशिकाओं और भ्रूण के रूप में कई अन्य जैविक प्रक्रियाओं, के संकेत प्रक्रियाओं में महत्वपूर्ण भूमिका निभाता है विकास की परिपाटी । हालांकि, हड्डीवाला embryogenesis में vivo इलेक्ट्रिकल गतिविधि मॉनिटरिंग में एक की जरूरत है । आनुवंशिक रूप से इनकोडिंग फ्लोरोसेंट वोल्टेज संकेतकों (GEVIs) के अग्रिम यह इस चुनौती के लिए एक समाधान प्रदान करने के लिए संभव बना दिया है । यहां, हम का वर्णन कैसे एक ट्रांसजेनिक वोल्टेज संकेतक zebrafish स्थापित वोल्टेज संकेतक का उपयोग कर बनाने के लिए, ASAP1 (कार्रवाई क्षमता 1 के त्वरित संवेदक), एक उदाहरण के रूप में । इस अध् ययन में Tol2 किट और एक सर्वव्यापी zebrafish प्रवर्तक, यूबीआई, चुना गया । हम भी गेटवे साइट विशेष क्लोनिंग, Tol2 transposon आधारित zebrafish transgenesis, और प्रारंभिक चरण मछली भ्रूण और मछली नियमित epifluorescent माइक्रोस्कोप का उपयोग ट्यूमर के लिए इमेजिंग प्रक्रिया की प्रक्रियाओं की व्याख्या । इस मछली लाइन का प्रयोग, हमने पाया कि zebrafish embryogenesis के दौरान सेलुलर बिजली वोल्टेज परिवर्तन कर रहे हैं, और मछली लार्वा आंदोलन । इसके अलावा, यह देखा गया कि कुछ zebrafish घातक परिधीय तंत्रिका म्यान ट्यूमर में, ट्यूमर कोशिकाओं को आम तौर पर आसपास के सामान्य ऊतकों की तुलना में ध्रुवीकरण किया गया.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

अंतर्जात बिजली आयन चैनलों और सेल झिल्ली1पर स्थित पंपों द्वारा मध्यस्थता संकेतन विद्युतीकरण करने के लिए संदर्भित करता है । ईओण सेलुलर झिल्ली के पार एक्सचेंजों, और युग्मित विद्युत क्षमता और वर्तमान परिवर्तन, उत्तेजित ंयूरॉंस और मांसपेशियों की कोशिकाओं की प्रक्रिया संकेतन के लिए आवश्यक हैं । इसके अलावा, जैव शक्ति और आयन ढाल ऊर्जा भंडारण, संश्लेषण, और metabolite परिवहन सहित अन्य महत्वपूर्ण जैविक कार्यों की एक किस्म है । इलेक्ट्रिक संकेतन भी भ्रूण पैटर्न गठन के एक नियामक के रूप में खोज की थी, शरीर कुल्हाड़ियों के रूप में, सेल चक्र, और सेल भेदभाव1। इस प्रकार, यह कई मानव जंमजात रोगों को समझने के लिए महत्वपूर्ण है कि एमआईएस से परिणाम संकेतन के इस प्रकार के विनियमन । हालांकि पैच दबाना व्यापक रूप से एकल कोशिकाओं रिकॉर्डिंग के लिए इस्तेमाल किया गया है, यह अभी भी vivo मेंभ्रूण विकास के दौरान कई कोशिकाओं के एक साथ निगरानी के लिए आदर्श से दूर है । इसके अलावा, वोल्टेज संवेदनशील छोटे अणु भी उनके विशिष्टताओं, संवेदनशीलता, और विषाक्तता के कारण vivo अनुप्रयोगों में के लिए आदर्श नहीं हैं.

आनुवंशिक रूप से इनकोडिंग फ्लोरोसेंट वोल्टेज संकेतकों (GEVIs) की एक किस्म के निर्माण के लिए इस मुद्दे पर काबू पाने के लिए एक नया तंत्र प्रदान करता है, और आसान आवेदन के लिए भ्रूण विकास का अध्ययन करने के लिए अनुमति देता है, भले ही वे मूल रूप से थे तंत्रिका निगरानी के लिए इरादा कक्ष2,3। वर्तमान में उपलब्ध GEVIs में से एक कार्रवाई क्षमता 1 (ASAP1) के त्वरित संवेदक है4। यह वोल्टेज संवेदनशील फॉस्फेट और एक परिपत्र permuted हरी फ्लोरोसेंट प्रोटीन की एक वोल्टेज सेंसिंग डोमेन के एक extracellular पाश से बना है । इसलिए, ASAP1 सेलुलर बिजली संभावित परिवर्तन (ध्रुवीकरण: चमकीले हरे रंग; ध्रुवीकरण: डार्क ग्रीन) के दृश्य की अनुमति देता है । ASAP1 में 2 ms है और बंद कैनेटीक्स है, और उपथ्रेशोल्ड संभावित परिवर्तन4को ट्रैक कर सकते हैं । इस प्रकार, इस आनुवंशिक उपकरण लाइव कोशिकाओं में वास्तविक समय में बिजली की निगरानी में प्रभावकारिता के एक नए स्तर के लिए अनुमति देता है । इस तरह के कैंसर के रूप में भ्रूण विकास और कई मानव रोगों में, बिजली की भूमिकाओं के आगे की समझ, अंतर्निहित तंत्र है, जो रोग के उपचार और रोकथाम के लिए महत्वपूर्ण है पर नई रोशनी बहा देंगे ।

Zebrafish5,6कैंसर सहित विकासक जीवविज्ञान और मानव रोगों का अध्ययन करने के लिए एक शक्तिशाली पशु मॉडल साबित किया गया है । वे मनुष्यों के साथ ७०% orthologous जीन का हिस्सा है, और वे इसी तरह हड्डीवाला जीव विज्ञान है7। Zebrafish अपेक्षाकृत आसान देखभाल, अंडे की एक बड़ी क्लच आकार, तंत्रीय आनुवंशिकी, आसान transgenesis, और पारदर्शी बाहरी भ्रूण विकास, जो उंहें vivo इमेजिंग5,6 में के लिए एक बेहतर प्रणाली बनाने प्रदान करते हैं । उत्परिवर्ती मछली लाइनों का एक बड़ा स्रोत पहले से ही मौजूद है और एक पूरी तरह से अनुक्रम जीनोम के साथ, zebrafish वैज्ञानिक खोज के एक अपेक्षाकृत असीमित रेंज प्रदान करेगा ।

सेल की रीयल-टाइम इलेक्ट्रिकल गतिविधि में वीवो की जांच करने के लिए, हम zebrafish मॉडल प्रणाली और ASAP1 का लाभ उठाते हैं । इस पत्र में, हम का वर्णन कैसे zebrafish जीनोम में फ्लोरोसेंट वोल्टेज Tol2 transposon transgenesis का उपयोग कर ASAP1 शामिल करने के लिए, और भ्रूण विकास, मछली लार्वा आंदोलन के दौरान सेलुलर विद्युत गतिविधि कल्पना, और जीवित ट्यूमर में .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

zebrafish एक AAALAC-अनुमोदित पशु सुविधा में स्थित हैं, और सभी प्रयोगों इन्होने पशु देखभाल और उपयोग समिति (PACUC) द्वारा अनुमोदित प्रोटोकॉल के अनुसार किए गए थे ।

१. Tol2 Transposon प्लाज्मिड निर्माण तयारी

नोट: Tol2, एक transposon कि medaka मछली में खोज की थी, व्यापक रूप से zebrafish अनुसंधान समुदाय में इस्तेमाल किया गया है8,9। यह गेटवे साइट-विशिष्ट पुनर्संयोजन आधारित क्लोनिंग प्रणाली को सफलतापूर्वक अपनाया गया है और Tol2 किट10के रूप में जाना जाता है । Tol2 किट अनुकूलित अभिव्यक्ति निर्माण का एक और अधिक सुविधाजनक तरीका के लिए अनुमति देता है, जबकि भी transgenesis की क्षमता में वृद्धि । इस प्रकार, यह एक आसान इस प्रणाली का लाभ लेने का निर्णय था, और एक सर्वव्यापी ASAP1 अभिव्यक्ति zebrafish लाइन एक सत्यापित ubiquitin प्रमोटर का उपयोग करने ASAP111ड्राइव बनाने के लिए ।

  1. एक मिडिल एंट्री बनाना ASAP1 का निर्माण: pDONR221-ASAP1
    1. अधिग्रहण आनुवंशिक रूप से इनकोडिंग वोल्टेज संवेदक ASAP1 निर्माण, pcdna 3.1/पूरो-सीएजी-ASAP1 (प्लाज्मिड # 52519), Addgene से । ASAP1 कोडन क्षेत्र को बढ़ाना, एक के लिए अनुकूलित प्राइमरों (attB1-ASAP1F और attB2-ASAP1R) का उपयोग कर पीसीआर की स्थापना की attB दृश्यों के साथ पार्श्व में ' 5 प्राइमरों के अंत (चित्रा 1) । Phusion डीएनए पोलीमरेज़ अपनी उच्च दक्षता के लिए चुना गया था, और पीसीआर शर्तों पहले प्रकाशित प्रोटोकॉल12के आधार पर अनुकूलित किया गया था ।
    2. ५० µ l पीसीआर उत्पादों को 1% ताे जेल में लोड करें २०० µ एल टिप्स के साथ एक नियमित पिपेट का उपयोग कर, और लगभग 30 मिनट के लिए एक क्षैतिज जेल टैंक में १६० V पर ट्रो प्रदर्शन करते हैं ।
    3. एक यूवी transilluminator (३५३ एनएम) के तहत जेल की जांच करें, एक यूवी transilluminator के तहत पहले से प्रकाशित के रूप में एक ब्लेड/स्केलपेल का उपयोग कर वांछित बैंड बाहर एक्साइज13,14, और एक साफ १.५ मिलीलीटर में जेल नमूना युक्त डीएनए डाल दिया microcentrifuge ट्यूब.
    4. ASAP1 पीसीआर उत्पादों के लिए जेल शुद्धिकरण करते हैं । निर्माता के निर्देश के बाद एक वाणिज्यिक डीएनए जेल शुद्धि किट का उपयोग कर एक्साइज जेल में डीएनए ठीक है, और पानी की 20 µ एल में डीएनए elute । एक नमूने के रूप में 1 µ एल ले लो, और एक spectrophotometer का उपयोग डीएनए एकाग्रता उपाय । एक रिक्त नियंत्रण के रूप में पानी का उपयोग कर सॉफ्टवेयर निर्देश15प्रवाह ।
    5. शुद्ध पीसीआर उत्पाद के १०० एनजी ले और यह pDONR221 प्लाज्मिड के 10 µ एल में से १५० एनजी के साथ मिश्रण बफर (10 मिमी Tris, 1 मिमी EDTA पीएच ८.०)16। प्रतिक्रिया में बीपी Clonase द्वितीय के 2 µ एल जोड़ें और रात भर कमरे के तापमान पर प्रतिक्रिया की मशीन ।
    6. दूसरे दिन, प्रतिक्रिया में proteinase K के 1 µ एल जोड़ें और 30 मिनट के लिए ३७ ° c पर प्रतिक्रिया की मशीन ।
    7. रूपांतरण निष्पादित करें । प्रतिक्रिया स्थानांतरण और यह Top10 सक्षम ई. कोलाई कोशिकाओं के ५० µ एल के साथ मिश्रण है और 30 मिनट के लिए बर्फ पर कोशिकाओं को गर्मी । फिर, 1 मिनट के लिए एक ४२ ° c पानी स्नान में रिएक्शन ट्यूब हस्तांतरण । तुरंत ट्यूब और 2 मिनट के लिए बर्फ पर मशीन को हटा दें । अगले, एक ३७ डिग्री सेल्सियस शेखर में ट्यूब डाल दिया है और यह 1 एच के लिए मशीन ।
    8. ट्यूब बाहर ले जाओ और एक कनमीसिन पौंड की थाली पर कोशिकाओं प्लेट । अगले, रात भर थाली मशीन (16-18 ज) ३७ डिग्री सेल्सियस पर ।
    9. एकल और अच्छी तरह से अलग कालोनियों उठाओ और पौंड मध्यम के 3 मिलीलीटर के साथ 14 मिलीलीटर सेल संस्कृति ट्यूबों में उन्हें inoculate । संस्कृति उंहें ३७ ° c में एक शेखर में रातोंरात २५० rpm के रोटेशन की गति के साथ (प्रति मिनट रोटेशन) ।
    10. अपने अनुदेश मैनुअल17के बाद एक वाणिज्यिक miniprep किट का उपयोग कर miniprep करते हैं ।
    11. M13F और M13R अनुक्रमण प्राइमरों का उपयोग कर सकारात्मक pDONR221-ASAP1 क्लोन की पहचान करने के लिए सैंज अनुक्रमण के साथ अनुक्रम 3-4 plasmids ।
  2. microinjection के लिए Tol2 निर्माण: pDestTol2-यूबीआई-ASAP1
    1. अनुक्रमण सत्यापित pDONR221-ASAP1 क्लोन चुनें और एक खाली नियंत्रण के रूप में पानी का उपयोग कर सॉफ्टवेयर अनुदेश निम्नलिखित एक spectrophotometer का उपयोग कर अपने डीएनए एकाग्रता को मापने15.
    2. pDONR221-ASAP1 के १०० µ g को लें और इसे १०० µ g के साथ Tol2 किट 5-end प्लाज्मिड (pENTR5'_ubi, Addgene #27320), १०० µ g की p3E-polyA (Tol2 kit #302) और १५० µ g of pDestTol2pA2 (Tol2 kit #394) के साथ मिलाएं । कुल मात्रा को समायोजित करने के लिए 8 µ l का उपयोग कर बफर (10 मिमी Tris, 1 मिमी EDTA, पीएच ८.०) में एक १.५ मिलीलीटर microcentrifuge ट्यूब और एक 2-5 एस संक्षिप्त भंवर द्वारा अच्छी तरह से मिश्रण. फिर, एलआर Clonase द्वितीय प्लस के 2 µ एल जोड़ने के लिए, और रात भर कमरे के तापमान पर प्रतिक्रिया गर्मी ।
    3. दूसरे दिन, एक 10 µ l पिपेट का उपयोग कर प्रतिक्रिया में proteinase K के 1 µ l जोड़ें, और 30 मिनट के लिए ३७ ° c पर प्रतिक्रिया गर्मी.
    4. परिवर्तन करें और ऊपर वर्णित के रूप में सकारात्मक क्लोन की पहचान (steps 1.1.7-11) ।
    5. sequencing सत्यापित pDestTol2-यूबीआई-ASAP1 क्लोन (चित्र 1b) एक spectrophotometer15का उपयोग कर के डीएनए एकाग्रता को मापने । आमतौर पर एकाग्रता 200ng/µ एल के आसपास होती है ।

2. तैयार Tol2 Transposase mRNA और इंजेक्शन समाधान

  1. लकीर एक पौंड प्लेट पर pCS2FA-transposase प्लाज्मिड (Tol2 किट #396) के ई. कोलाई ग्लिसरॉल स्टॉक (१०० µ जी/एमएल एम्पीसिलीन के साथ) एक निष्फल टीका पाश का उपयोग कर । रात में एक मशीन में ३७ ° c पर थाली मशीन । अगले दिन, एक ही कॉलोनी उठाओ और इसे inoculate पौंड (१०० µ g/ml एम्पीसिलीन) के 3 मिलीलीटर में एक निष्फल 10 µ l पिपेट टिप का उपयोग कर । संस्कृति यह ३७ डिग्री सेल्सियस पर एक शेखर में २५० rpm की एक रोटेशन की गति के साथ रातोंरात ।
  2. अपने अनुदेश मैनुअल के बाद एक वाणिज्यिक miniprep किट का उपयोग कर ई. कोलाई संस्कृति पर miniprep प्रदर्शन करते हैं । Elute प्लाज्मिड डीएनए में 30-50 µ एल ते बफर द्वारा 1 मिनट के केंद्रापसारक पर १४,००० rpm, और एक spectrophotometer के साथ अपने डीएनए एकाग्रता उपाय ।
  3. Linearize 1-2 के साथ प्लाज्मिड के µ जी मैं endonuclease और नहीं मैं पाचन के बाद अपनी अनुदेश मैनुअल निंनलिखित एक डीएनए सफाई किट के साथ डीएनए शुद्ध । 1 मिनट के लिए १४,००० rpm पर केंद्रापसारक द्वारा पानी की 5 µ एल में डीएनए Elute । उंमीद की एकाग्रता के बारे में 200-300 एनजी/µ एल है ।
  4. इन विट्रो में प्रतिलेखन नहीं के साथ मैं रैखिक pCS2FA-transposase एक डीएनए एक वाणिज्यिक SP6 प्रतिलेखन किट का उपयोग कर टेंपलेट के रूप में ।
  5. एक बार प्रतिक्रिया समाप्त हो गया है, एक वाणिज्यिक आरएनए सफाई किट का उपयोग कर Tol2 transposase mRNA शुद्ध निर्माता के निर्देशों का पालन । अंत में, elute 20 µ एल RNAase में mRNA-मुक्त पानी और एक spectrophotometer में आरएनए एकाग्रता उपाय । अपेक्षित एकाग्रता के बारे में 1-3 µ g/µ l नमूने एक-८० डिग्री सेल्सियस फ्रीजर में संग्रहित किया जा सकता है अगर जरूरत है ।
  6. Tol2 द्वारा एक transposase ट्यूब में 20 एनजी/µ एल pDestTol2-यूबीआई-ASAP1 और mRNA µ microcentrifuge (१०० एनजी/pipetting एल) को मिलाकर microinjection समाधान तैयार करें । दोहराया गल और ठंड की वजह से न्यूक्लिक एसिड गिरावट को रोकने के लिए, ट्यूब प्रति aliquot 6 µ एल और भविष्य के उपयोग के लिए एक-८० डिग्री सेल्सियस फ्रीजर में यह दुकान ।

3. Microinjection

  1. सेट अप के साथ 4-6 प्रजनन टैंकों कम 2 पुरुषों और 2 इंजेक्शन से पहले दोपहर महिलाओं । इन मछलियों को दोपहर में खिलाया नहीं जाना चाहिए । यह कदम मछली बर्बाद की मात्रा कम हो जाएगा और समय बचाने के लिए उंहें बाहर साफ अगली सुबह, जबकि भी एक प्रजनन प्रतिक्रिया प्रेरित मदद करते हैं ।
  2. निम्नलिखित सुबह, तैयार इंजेक्शन समाधान (pDestTol2-यूबीआई-ASAP1 construction और Tol2 mRNA) से-८० डिग्री सेल्सियस फ्रीजर, और यह बर्फ पर जगह निकालें.
  3. मछली प्रजनन टैंक में डिवाइडर खींचो और दोस्त के लिए मछली की अनुमति । सामांय में, मछली बाहर डिवाइडर खींचने के बाद 20-30 मिनट के भीतर अंडे देना । यदि नहीं, तो 1-2 घंटे तक इंतजार करें । कुछ मछली अंडे बिल्कुल नहीं करना हो सकता है । इस मामले में, मछली भ्रूण संग्रह के लिए इस प्रयोग को दोहराएँ ।
  4. प्रतीक्षा करते समय, सुनिश्चित करें कि वहां सुई संदंश के साथ एक बेवल बढ़त बनाने के कोण पर टूट टिप के साथ तैयार कर रहे हैं, या एक नाजुक कार्य वाइपर पर तोड़कर ।
    1. निम्नलिखित मापदंडों का उपयोग कर एक micropipette खींचने पर केशिका कांच से सुई खींचो: हीट ५४५; पुल ६०; वेग ८०; समय २५०; दबाव ५०० । एक विच्छेदन क्षेत्र के नीचे संदंश के साथ सुई तोड़ो (व्यास आकलन के लिए आँख टुकड़ा शासक के साथ) एक कोण पर संदंश धारण करके लगभग ४५ °. वांछित सुई व्यास microinjector सेटिंग्स के आधार पर चर जा सकता है, लेकिन छोटे व्यास भ्रूण मृत्यु दर को कम करने के लिए पसंद है ।
  5. एक बार मछली अंडे रखी है, उंहें एक 10 सेमी व्यास पेट्री पकवान में इकट्ठा और उंहें विच्छेदन दायरे में ले आओ । सभी असामान्य भ्रूण और मछली अपशिष्ट निकालें ।
  6. तैयार 3% agarose इंजेक्शन मोल्ड में निषेचित भ्रूण प्लास्टिक । जगह में भ्रूण रखने में मदद करने के लिए अतिरिक्त पानी निकालें ।
  7. एक बार पंक्तियों के सभी व्यवहार्य भ्रूण से भर रहे हैं, उंहें इतनी व्यवस्था है कि एकल कोशिकाओं को सभी सुई, जो एक ४५ ° कोण क्षैतिज के बारे में है की ओर एक ही दिशा का सामना । यह इंजेक्शन बहुत आसान बाद में कर देगा ।
  8. जबकि दस्ताने पहनने, एक 20 µ एल लोड हो रहा है प्लास्टिक टिप का उपयोग करें और बर्फ पर ट्यूब से तैयार निर्माण के 5 µ एल हटा दें ।
  9. ध्यान से टूटी केशिका ट्यूब के पीछे के अंत में टिप डालें जहां यह टापर करने के लिए शुरू होता है सभी तरह, के रूप में टिप के करीब के रूप में रिएजेंट पाने के लिए । अगर अभी भी हवा के बुलबुले हैं, सुई हिला, टिप को तोड़ने के लिए सुनिश्चित कर रही है ।
  10. सुई सीधे microinjection सुई धारक में डालें और ध्यान से जब तक सुई जगह में रहता है कस । कोण के बारे में ४५ ° समायोजित करें ।
  11. एक बार सुई तैयार और संलग्न है, माइक्रोस्कोप और गैस दबाव टैंक पर बारी । वाणिज्यिक सह2 टैंक इस प्रयोजन के लिए आम तौर पर अच्छे हैं । इंजेक्शन की मात्रा पकड़ और बाहर निकालने के दबाव से समायोजित किया गया है: होल्डिंग और बेदखली के लिए 30 साई के लिए लगभग ०.५ साई । जांच करने के लिए सुनिश्चित करें कि समाधान बाहर आता है जब पेडल दबाने ।
  12. खनिज तेल की एक बूंद के साथ एक मंच माइक्रोमीटर का प्रयोग, मात्रा और समाधान के प्रवाह को समायोजित ~ १५० व्यास में µm (के बारे में 2 nL) । सुनिश्चित करें कि वापस दबाव एक छोटी राशि सुई से बाहर ड्रिप दूँगी । यदि पर्याप्त वापस दबाव नहीं है, केशिका कार्रवाई सुई में प्रवेश करने और mRNA को नष्ट करने के लिए तरल कारण होगा ।
  13. एक बार सुई पर तुले है, निषेचित भ्रूण के एकल कोशिका में निर्माण इंजेक्शन शुरू करते हैं ।
    नोट: यह अभ्यास, धैर्य की एक बड़ी राशि लेता है, और चालाकी, कोशिका झिल्ली पियर्स करने के लिए मुश्किल होने के कारण । यह कोशिका में समाधान इंजेक्षन करने के लिए महत्वपूर्ण है, नहीं जर्दी, ट्रांसजेनिक zebrafish पैदा करने के लिए. यह morpholino इंजेक्शन से अलग है । यह बात नहीं है जो पक्ष सुई सेल में प्रवेश करती है के रूप में लंबे समय के रूप में निर्माण कक्ष में चला जाता है । transgenesis सेल के बजाय जर्दी में इंजेक्ट किया जाए तो सफलता की दर बहुत कम होगी । सिंगल सेल स्टेज इंजेक्शन भी महत्वपूर्ण है, या दैहिक कल्पना मछली बनाया जाएगा । यह transgene की संभावना को कम करने के लिए रोगाणु कोशिकाओं में जा रहा होगा ।
  14. जेल पायदान के किनारे का उपयोग करने के लिए एक समर्थन है कि जगह में भ्रूण रहता है और सुई भ्रूण चलती बिना दबाव लागू करने के लिए अनुमति देता है प्रदान करते हैं । एक बार सुई की नोक एक सेल में है, प्रेस पेडल समाधान की वांछित राशि जारी करने के लिए । भ्रूण के सभी के लिए इस प्रक्रिया को दोहराएँ ।
  15. जब पूरा हो गया, एक लेबल पकवान में उंहें मछली प्रणाली के पानी और एक डिस्पोजेबल ३.४ एमएल हस्तांतरण पिपेट के साथ agarose पायदान से बाहर कुल्ला द्वारा इंजेक्शन भ्रूण स्थानांतरण । एक २८.५ डिग्री सेल्सियस मशीन में भ्रूण की दुकान करने के लिए उंहें विकसित करते हैं । दिन भर में वापस जांच मृत मछली भ्रूण को हटाने और मछली के पानी में ०.१% methylene नीले रंग के साथ पानी की जगह ।
  16. इंजेक्शन के बाद लगभग 6-8 घंटे, 10 व्यक्ति इंजेक्शन मछली भ्रूण ले और उन से जीनोमिक डीएनए तैयार हॉटशॉट विधि18का उपयोग कर ।
  17. निंनलिखित सुबह, एक प्रतिदीप्ति प्रकाश स्रोत के साथ एक विच्छेदन माइक्रोस्कोप का उपयोग करने के लिए बाहर गैर-जर्दी ऊतकों में GFP दिखा भ्रूण तरह । इन मछली भ्रूण के इंजेक्शन का निर्माण शामिल करना चाहिए ।
  18. पहले19के रूप में वर्णित transposon गतिविधि की जांच करने के लिए Tol2 आबकारी परख करें । अगर एक्साइज प्लाज्मिड का पता लगाया जा सकता है तो इंजेक्टेड फिश भ्रूण को रखें और उन्हें बढ़ाएं । यदि कोई उत्पादत्मक प्लाज्मिड का पता लगाया जा सकता है, Tol2 आबकारी परख के सकारात्मक परिणाम प्राप्त करने तक Tol2 mRNA संश्लेषण और microinjection प्रक्रिया को दोहराएँ ।

4. त्यामध्ये ट्रांसजेनिक ASAP1 फिश, टीजी (यूबीआई: ASAP1)

  1. इंजेक्शन मछली बढ़ाएं (एफ0 जनरेशन) वयस्कता के रूप में zebrafish पुस्तक20में पहले वर्णित है । यह आमतौर पर लगभग 4 महीने लगते हैं ।
  2. एक एकल वयस्क एफ0 मछली ले लो और एक विपरीत लिंग wildtype मछली के साथ इसे पार । बाद में दिन में प्रजनन के बाद मछली भ्रूण ले लीजिए । ०.१% methylene नीले रंग के साथ मछली के पानी में २८.५ डिग्री सेल्सियस मशीन में एकत्र मछली भ्रूण रखें ।
  3. तीसरे दिन, एक GFP फिल्टर के साथ एक फ्लोरोसेंट विच्छेदन माइक्रोस्कोप के नीचे मछली भ्रूण की जांच करें । हरी मछली भ्रूण को क्रमबद्ध करें, यदि कोई हो, और उंहें1 पीढ़ी ट्रांसजेनिक मछली, टीजी (यूबीआई: ASAP1) एफ के रूप में वयस्कता को बढ़ा ।
    नोट: Mendelian अनुपात की उंमीद नहीं है के बाद से पैतृक एफ0 मछली के अधिकांश है रोगाणु लाइन आनुवंशिक chimeras ।
  4. wildtype मछली के साथ एक एफ1 वयस्क मछली क्रॉस और मछली भ्रूण इकट्ठा । हरी मछली भ्रूण को क्रमबद्ध करें और उंहें एफ के रूप में वयस्कता बढ़ाने के लिए2 जनरेशन मछली ।
    नोट: हरे और गैर हरी मछली भ्रूण 1:1 के करीब होना चाहिए अगर वहां एक भी transgene है ।
  5. घातक परिधीय तंत्रिका म्यान ट्यूमर (MPNST) की तरह ट्यूमर में बिजली के संभावित परिवर्तन को देखने के लिए, rpl35hi258/wt मछली के साथ एफ2 जनरेशन टीजी (यूबीआई: ASAP1) मछली पार । यह ज्ञात है कि दिखाई ट्यूमर के लिए 6-8 महीने पुराने वयस्कों में पाया जाना शुरू21,22

5. इमेजिंग

  1. zebrafish भ्रूण छवि के लिए, एकाधिक च2 पीढ़ी के संस्थापक मछली ले और उंहें व्यक्तिगत जोड़े में wildtype मछली के साथ पार । zebrafish मचान गाइड के अनुसार विभिन्न वांछित विकासात्मक चरणों में मछली भ्रूण ले लीजिए23.
  2. मछली भ्रूण के प्रारंभिक दौर के लिए, छील और ध्यान से भ्रूण की चोरियों को दूर एक 10 में एक विच्छेदन क्षेत्र के तहत संदंश की एक जोड़ी का उपयोग कर-सेमी व्यास पेट्री डिश मछली प्रणाली के पानी के साथ ।
  3. एक ३.४ मिलीलीटर डिस्पोजेबल हस्तांतरण पिपेट का उपयोग कर 3% methylcellulose के साथ एक गढ़ा ग्लास स्लाइड पर कुछ मछली भ्रूण हस्तांतरण । एक फ्लोरोसेंट विच्छेदन गुंजाइश के नीचे एक सुई का उपयोग सेलुलर GFP गतिविधि को देखने के लिए वांछित पदों के लिए भ्रूण समायोजित करें ।
  4. मछली भ्रूण (12 somite चरण से पुराने) के चलते चरणों के लिए, ०.०५% tricaine mesylate का उपयोग करने के लिए उंहें स्लाइड स्थानांतरित करने से पहले मछली भ्रूण anesthetize । संक्षेप में, मछली भ्रूण मछली के पानी में ०.०५% tricaine mesylate में उभरा जब तक वे तैराकी और हानि शरीर के संतुलन बंद कर दिया गया । साथ ही, स्लाइड पर methylcellulose के साथ ०.०५% tricaine mesylate की एक ड्रॉप जोड़ें ।
  5. से कम 12 somite मंच मछली भ्रूण के लिए, एक संगत कैमरा और इमेजिंग के लिए सॉफ्टवेयर के साथ एक महामारी प्रतिदीप्ति यौगिक माइक्रोस्कोप का उपयोग करें । पुराने से 12 somite स्टेज मछली भ्रूण के लिए, एक प्रतिदीप्ति विच्छेदन माइक्रोस्कोप का उपयोग करें ।
  6. छवि ट्यूमर सेल वोल्टेज के लिए, पहले MPNST ट्यूमर के साथ मछली की पहचान । फिर, ०.०५% tricaine mesylate के साथ मछली anesthetize । पूरे माउंट इमेजिंग के लिए, एक 10 सेमी व्यास पेट्री डिश में मछली डाल दिया । ट्यूमर सेल विद्युत गतिविधि को देखने के लिए, मछली ट्यूमर पूरे माउंट इमेजिंग के बाद बाहर विच्छेदित किया जा सकता है ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

एक सफल इंजेक्शन में, अधिक से अधिक ५०% मछली भ्रूण दैहिक कोशिकाओं में हरी प्रतिदीप्ति के कुछ डिग्री प्रदर्शित करेगा इंजेक्शन, और उनमें से ज्यादातर Tol2 transposon उत्पाद शुल्क परख (चित्रा 2) द्वारा सकारात्मक हो जाएगा । बाहर के 2-4 पीढ़ियों के बाद wildtype मछली के साथ पार (फ्लोरोसेंट मछली तक पहुंच ५०%, अपेक्षित Mendelian अनुपात), ट्रांसजेनिक मछली इमेजिंग प्रयोग के लिए इस्तेमाल किया गया था भ्रूण के विकास के दौरान कोशिका झिल्ली क्षमता ट्रैक । सबसे पहले, झिल्ली संभावित परिवर्तन zebrafish जल्दी भ्रूण विकास चरणों के दौरान सेल चक्र भर में जांच की गई । यह देखा गया कि कोशिकाओं दरार कुंड गठन से पहले hyperpolarized (चित्र 3-3सी, और अनुपूरक वीडियो 1) । इसके अलावा, विभिंन ऊतकों 1-3 दिन पुराने मछली भ्रूण में झिल्ली क्षमता की एक किस्म दिखाई । (चित्रा 3d3 जी) । उदाहरण के लिए, somites और notochord आम तौर पर hyperpolarized हैं, आसन्न ऊतकों की तुलना में/ एक बार zebrafish भ्रूण ले जाने में सक्षम थे, हम भी neuromuscular विद्युत गतिविधियों का पता लगाने में सक्षम थे (चित्रा 4, अनुपूरक वीडियो 2) । कैंसर की कोशिकाओं के रूप में बिजली के गुणों को बदला जा सकता है, हम इस ASAP1 रिपोर्टर मछली का लाभ लिया, और यह एक rpL35 जीन उत्परिवर्ती, जो सहज घातक परिधीय तंत्रिका म्यान ट्यूमर के लिए प्रवण है के साथ पार कर21,24 ,25. हालांकि केवल कुछ मछली ट्यूमर की जांच की, मछली ट्यूमर उत्परिवर्ती के लिए लंबे समय तक क्षमता वृद्धि की अवधि के कारण थे, यह ध्यान देने योग्य है कि वहां वोल्टेज ट्यूमर और आसपास के ऊतकों में रहते ट्यूमर असर zebrafish (चित्रा 5) के बीच मतभेद थे । इस प्रकार, इन प्रतिनिधि परिणाम एक सेलुलर इलेक्ट्रिक रिपोर्टर मछली लाइन की सफल पीढ़ी का प्रदर्शन किया, और उसके विकास और सेलुलर जीव विज्ञान के लिए संभावित आवेदन ।

Figure 1
चित्र 1: Tol2 transposon-आधारित प्लाज्मिड निर्माण का चित्रण ।
(क) बीपी पुनर्संयोजन pDONR221 मध्य प्रवेश वेक्टर में ASAP1 उप क्लोनिंग के लिए इस्तेमाल किया गया था । ASAP1 के लिए प्राइमरियों के 5-अंत में attB जुगाड़ जोड़े गए । (ख) Tol2 transposon के लिए आरेख-एलआर पुनर्संयोजन के आधार पर निर्माण कोडांतरण के आधार पर । बैंगनी अंडाकार आकार दिखाता है Tol2 उल्टे दोहराता है । डैश्ड रेखाएं मुताबिक़ पुनर्संयोजन का संकेत देती हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: epifluorescence और Tol2-आबकारी परख द्वारा इंजेक्शन भ्रूण के विशिष्ट परिणाम ।
(क) गैर-धनात्मक 1dpf मछली का भ्रूण. (ख) सफलतापूर्वक 1dpf मछली भ्रूण इंजेक्शन । ट्रंक में GFP धब्बे स्पष्ट हैं । (ग) गैर पॉजिटिव 2dpf मछली भ्रूण । (घ) सफलतापूर्वक 2dpf मछली भ्रूण इंजेक्शन । ट्रंक में GFP धब्बे स्पष्ट हैं । (ङ) Tol2 आबकारी परख का एक प्रतिनिधि परिणाम. लेन 1-7 पीसीआर 7 बेतरतीब ढंग से चयनित मछली भ्रूण 8 घंटे के इंजेक्शन के बाद से परिलक्षित किया गया । पिछले एक नकारात्मक नियंत्रण (नेकां) किसी भी जीनोमिक डीएनए के बिना है । स्केल बार = २५० माइक्रोन । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3: zebrafish भ्रूण विकास के दौरान गतिशील वोल्टेज में परिवर्तन ।
(A-C) मछली भ्रूण में बँटवारा के दौरान अंतर सेलुलर वोल्टेज ध्रुवीयता. (A) 2-सेल स्टेज zebrafish भ्रूण। (ख) 4 सेल स्टेज भ्रूण । (ग) 8 सेल स्टेज भ्रूण । लाल तीर सिर पैनलों (सी) में दरार furrows की स्थिति से संकेत मिलता है । परिवर्तन इसी फिल्म (अनुपूरक वीडियो 1) में भी स्पष्ट कर रहे हैं । दरार कुंड के आसपास क्षेत्र और अधिक ध्रुवीकरण है सेल के बाकी की तुलना में । (D-G) zebrafish भ्रूण के विभिन्न प्रारंभिक चरणों में गतिशील बिजली वोल्टेज में परिवर्तन. (घ) 12-somite अवस्था । (ङ) २२-somite अवस्था. (च) ४८ घंटे के बाद निषेचन । (छ) ७२ घण्टे पश्चात निषेचन । , आंख; एचटी, दिल; nt, notochord; सेशन, ऑप्टिक पुटिका; ov, भड़काऊ और पुटिका; कत, कवच फिन; तो, somite; यूसुफ, जर्दी । स्केल बार = २५० माइक्रोन । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्रा 4: मछली भ्रूण आंदोलन के दौरान मछली शरीर के विद्युत वोल्टेज में परिवर्तन ।
2 दिन पुराने मछली भ्रूण आंदोलन के दौरान न्यूरो पेशी इलेक्ट्रिक गतिविधियों दिखा । (क)-(च) अनुक्रमिक एक ही मछली भ्रूण की इमेजिंग । रंग घनत्व परिवर्तन बिजली संकेत transduction के लिए इसी कर रहे हैं । दो क्रमिक छवियों के बीच अंतराल समय के बारे में १२.४ मिलीसेकंड है । लाल तीर स्थिति है कि वोल्टेज इमेजिंग अवधि के दौरान बदल संकेत मिलता है । परिवर्तन इसी फिल्म (अनुपूरक वीडियो 2) में भी स्पष्ट कर रहे हैं । सभी पैनल एक ही स्केल में हैं । स्केल बार = २५० माइक्रोन । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 5
चित्रा 5: ट्यूमर कोशिकाओं को और अधिक ध्रुवीकरण हो जाते हैं ।
एक 10 महीने पुरानी मछली (rpL35hi258/wt; टीजी (यूबीआई: ASAP1) पेट में एक घातक परिधीय तंत्रिका म्यान ट्यूमर विकसित किया । (क) और (ग) उज्ज्वल क्षेत्र छवि । (ख) और (घ) GFP चैनल के साथ छवि । (क) और (ख) मछली बरकरार. (ग) और (घ) पेट ट्यूमर बाहर विदारक था. ट्यूमर कोशिकाओं को और अधिक (चमकीले हरे) आसपास के ऊतकों की तुलना में (गहरे हरे रंग) ध्रुवीकरण कर रहे हैं । तीर सिर ट्यूमर दिखा । सभी पैनल एक ही स्केल में हैं । स्केल बार = 25 मिमी. इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

अनुपूरक वीडियो 1 . टीजी (यूबीआई: ASAP1) मछली भ्रूण में क्लीवेज चरणों के दौरान विद्युत संकेतन की Epifluorescent इमेजिंग । यह फिल्म एनिमल पोल के देखने से रिकॉर्ड की गई. ASAP1 प्रतिदीप्ति सेल दरार कुंड, सेल विभाजन के दौरान एक अस्थाई संरचना के गठन के साथ जुड़ा हुआ है । इस फ़ाइल को डाउनलोड करने के लिए कृपया यहां क्लिक करें.

अनुपूरक वीडियो 2 . 2-दिन ओल्ड टीजी (यूबीआई: ASAP1) मछली भ्रूण आंदोलन के दौरान विद्युत संकेतन की Epifluorescent इमेजिंग । यह कदम anesthetization के बाद 2 दिन पुराने मछली भ्रूण के पार्श्व दृश्य से दर्ज किया गया था । ASAP1 प्रतिदीप्ति परिवर्तन चलती प्रक्रिया के दौरान neuromuscular ऊतक में स्पष्ट कर रहे हैं । इस फ़ाइल को डाउनलोड करने के लिए कृपया यहां क्लिक करें.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

यद्यपि भ्रूण विकास और मानव रोग के दौरान सेलुलर और ऊतक स्तर की विद्युत गतिविधियों के एक लंबे समय से पहले खोज रहे थे, vivo में गतिशील विद्युत परिवर्तन और उनकी जैविक भूमिकाओं अभी भी मोटे तौर पर अज्ञात रहते हैं । प्रमुख चुनौतियों में से एक को कल्पना और बिजली के परिवर्तनों को बढ़ाता है । पैच दबाना प्रौद्योगिकी एक ब्रेक के माध्यम से एकल कोशिकाओं पर नज़र रखने के लिए है, लेकिन हड्डीवाला भ्रूण के लिए अपने आवेदन सीमित है क्योंकि वे कई कोशिकाओं से बना रहे हैं । वर्तमान रासायनिक वोल्टेज रंजक भी उनके संवेदनशीलता, विशिष्टताओं, और विषाक्तता के कारण आदर्श नहीं हैं । GEVIs के आविष्कार पर हाल ही में प्रयास हमें एक नया रास्ता vivo में सेलुलर इलेक्ट्रिक गतिविधियों कल्पना और वास्तविक समय में प्रदान करते हैं । यहां, हम एक zebrafish इलेक्ट्रिक रिपोर्टर लाइन, टीजी (यूबीआई:ASAP1) बनाने की प्रक्रिया को दिखाया ।

इस रिपोर्टर मछली लाइन का प्रयोग, हम सेलुलर बिजली की गतिविधियों है कि zebrafish भ्रूण में नजर रखी जा सकता है दिखाते हैं । बिजली वोल्टेज परिवर्तन अत्यधिक जल्दी भ्रूण विकास के दौरान सेल चक्र से संबंधित है । हमने देखा है कि hyperpolarization दरार कुंड/सेल डिवीजन के गठन से पहले होता है (चित्रा 3) । यह वर्तमान ज्ञान के विपरीत है कि ध्रुवीकरण सेल डिवीजन26से पहले होता है । इस प्रकार, अंय पशु और मानव कोशिकाओं के सेल चक्र के दौरान कोशिका झिल्ली वोल्टेज परिवर्तन के अधिक विवरण, और क्या यह ऊतक संदर्भ से संबंधित है, आगे के अध्ययन की आवश्यकता है । संबंधित अध्ययन वर्तमान में हमारी प्रयोगशाला में चल रहे हैं । इसके अलावा, हम सत्यापित किया है कि ASAP1 तंत्रिका मांसपेशियों प्रणाली में शारीरिक वोल्टेज परिवर्तन को ट्रैक करने में सक्षम है (चित्रा 4), जिसमें परिवर्तन अपेक्षाकृत तेजी से सेल चक्र के दौरान बदलाव की तुलना में है ।

यह भी दर्शाया गया कि इस रिपोर्टर में zebrafish ट्यूमर (फिगर 5) की कल्पना भी की जा सकती है. यह ट्यूमर कोशिकाओं को खोजने के लिए दिलचस्प था आम तौर पर अधिक आसपास के सामांय ऊतकों की तुलना में ध्रुवीकरण किया गया । हालांकि, क्या यह सभी घातक ऊतकों के लिए एक सामान्य घटना है आगे की जांच की आवश्यकता है, इस अध्ययन में ट्यूमर के नमूनों और मछली ट्यूमर प्रकार की सीमा के कारण. कोशिका झिल्ली ध्रुवीकरण और वोल्टेज ठहराव पर भविष्य जांच ट्यूमर और मानव कैंसर कोशिकाओं के अंय प्रकार पर बेहतर tumorigenesis के दौरान अपनी भूमिकाओं को समझने के लिए जानकारीपूर्ण जाएगा ।

इस प्रोटोकॉल में, हम एक सर्वव्यापी प्रमोटर को ASAP1 अभिव्यक्ति ड्राइव को चुना मछली भ्रूण में सभी कोशिकाओं को ट्रैक । ऊतक या अंग विशिष्ट प्रवर्तकों एक और विकल्प हो सकता है अगर केवल एक निश्चित कोशिका/ ASAP1 वोल्टेज संवेदक एक अपेक्षाकृत अच्छी तरह से विशेषता है, और यह एक वोल्टेज संवेदनशील डोमेन से बना है समुद्र धार वोल्टेज के प्रति संवेदनशील फॉस्फेट (S3-S4 लूप) और GFP के एक परिपत्र परिवर्तन (डिफ़ॉल्ट कम प्रतिदीप्ति है). यह मानव ंयूरॉन कोशिकाओं और माउस मस्तिष्क स्लाइसें4,27,28में बाहर सेलुलर झिल्ली पर व्यक्त होने की सूचना दी गई । सेंसर की चमक प्रमुख रूप से S3-S4 पाश और GFP के गठन के पदों से निर्धारित है. तेजी से हरे प्रतिदीप्ति परिवर्तन की संभावना नहीं थी प्रोटीन एकाग्रता की वजह से, चमक परिवर्तन और प्रोटीन संश्लेषण की गति के कारण । हालांकि, transgene, ASAP1, ट्यूमर कोशिकाओं में अभिव्यक्ति बदल सकता है, जीनोमिक अस्थिरता की प्रकृति के कारण । ASAP1 के अलावा, अन्य GEVIs, जैसे archaerhodopsin आधारित वोल्टेज संकेतक (QuasAr1 और QuasAr2), भी एक अच्छा पूरक विकल्प हो सकता है, क्योंकि वे एक पूरी तरह से अलग तंत्र का उपयोग करें और वे भी एक उच्च संवेदनशीलता और गति 29. इसके अलावा, उनके उत्सर्जन लाल रंग रेंज में है । यह उंहें विशेष रूप से हरे ASAP1 के लिए मानार्थ बनाता है, अगर वहां पहले से ही एक ही सेल में एक और फ्लोरोसेंट प्रोटीन है । उदाहरण के लिए, ASAP1 और कैसर सेल चक्र और बिजली की क्षमता में परिवर्तन के बीच संबंध का अध्ययन करने के लिए Fucci zebrafish30 के साथ जोड़ा जा सकता है ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

इस प्रकाशन में बताया गया है कि इस शोध कार्य के अंतर्गत राष्ट्रीय स्वास्थ्य संस्थान के नेशनल इंस्टीट्यूट ऑफ जनरल मेडिकल साइंसेज के पुरस्कार संख्या R35GM124913, इन्होने विश्वविद्यालय PI4D प्रोत्साहन कार्यक्रम, और PVM आंतरिक प्रतियोगी के द्वारा समर्थित बुनियादी अनुसंधान कोष कार्यक्रम । सामग्री पूरी तरह से लेखकों की जिंमेदारी है और जरूरी नहीं कि धन एजेंटों के सरकारी विचारों का प्रतिनिधित्व करते हैं । हम Tol2 के लिए कोइची Kawakami का निर्माण, ASAP1 के निर्माण के लिए माइकल लिन, और लियोनार्ड Zon के माध्यम से यूबीआई प्रवर्तक Addgene के निर्माण के लिए धंयवाद ।

Materials

Name Company Catalog Number Comments
14mL cell culture tubes VWR 60818-725 E.Coli culture
Agarose electrophoresis tank Thermo Scientific Owl B2 DNA eletrophoresis
Agarose RA Amresco N605-500G For making the injection gels
Attb1-ASAP1-F primer IDT DNA GGGGACAAGTTTGTACAAAAAA
GCAGGCTTCACCATGGAGACGA
CTGTGAGGTATGAACA
ASAP1 coding region amplification for subcloning
Attb2-ASAP1-R primer IDT DNA GGGGACCACTTTGTACAAGAAA
GCTGGGTCTTAGGTTACCACTTC
AAGTTGTTTCTTCTGTGAAGCCA
ASAP1 coding region amplification for subcloning
Bright field dissection scope Nikon SMZ 745 Dechorionation, microinjection, mounting
Color camera Zeiss AxioCam MRc Fish embryo image recording
Concave slide VWR 48336-001 For holding fish embryos during imaging process
Disposable transfer pipette 3.4 ml Thermo Scientific 13-711-9AM Fish embryos and water transfer
Endonuclease enzyme, Not I NEB R0189L For linearizing plasmid DNA
Epifuorescent compound scope Zeiss Axio Imager.A2 Fish embryo imaging
Epifuorescent stereo dissection scope Zeiss Stereo Discovery.V12 Fish embryo imaging
Fluorescent light source Lumen dynamics X-cite seris 120 Light source for fluorescence microscopes
Forceps #5 WPI 500342 Dechorionation and needle breaking
Gateway BP Clonase II Enzyme mix Thermo Scientific 11789020 Gateway BP recombination cloning
Gateway LR Clonase II Plus enzyme Thermo Scientific 12538120 Gateway LR recombination cloning
Gel DNA Recovery Kit Zymo Research D4002 DNA gel purification
Loading tip Eppendorf 930001007 For loading injection solution into capilary needles
Methylcellulose (1600cPs) Alfa Aesar 43146 Fish embryo mounting
Methylene blue Sigma-Aldrich M9140 Suppresses fungal outbreaks in Petri dishes
Microinjection mold Adaptive Science Tools TU-1 To prepare agaorse mold tray for holding fish embryos during injection
Microinjector WPI Pneumatic Picopump PV820 Microinjection injector
Micro-manipulator WPI Microinjector MM3301R Microinjection operation
Micropipette puller Sutter instrument P-1000 For preparing capillary needle
Mineral oil Amresco J217-500ml For calibrating injection volume
mMESSAGE mMACHINE SP6 Transcription Kit Thermo Scientific AM1340 mRNA in vitro transcription
Monocolor camera Zeiss AxioCam MRm Fish embryo image recording
Plasmid Miniprep Kit Zymo Research D4020 Prepare small amount of plasmid DNA
Plastic Petri dishes VWR 25384-088 For holding fish or fish embryos during imaging process
RNA Clean & Concentrator-5 Zymo Research R1015 mRNA cleaning after in vitro transcription
Spectrophotometer Thermo Scientific NanoDrop 2000 For measuring DNA and RNA concentrations
Stage Micrometer Am Scope MR100 Microinjection volume calibration
Thermocycler Bio-Rad T100 DNA amplification for gene cloning
Thin wall glass capillaries WPI TW100F-4 Raw glass for making cappilary needle
Tol2-exL1 primer IDT DNA GCACAACACCAGAAATGCCCTC Tol2 excise assay
Tol2-exR primer IDT DNA ACCCTCACTAAAGGGAACAAAAG Tol2 excise assay
TOP10 Chemically Competent E. coli Thermo Scientific C404006 Used for transformation during gene cloning
Tricaine mesylate Sigma-Aldrich A5040 For anesthetizing fish or fish embryos
UV trans-illuminator 302nm UVP M-20V DNA visualization
Water bath Thermo Scientific 2853 For transformation process of gene cloning

DOWNLOAD MATERIALS LIST

References

  1. Levin, M. Molecular bioelectricity: how endogenous voltage potentials control cell behavior and instruct pattern regulation in vivo. Molecular Biology of the Cell. 25, (24), 3835-3850 (2014).
  2. Storace, D., et al. Toward Better Genetically Encoded Sensors of Membrane Potential. Trends in Neuroscience. 39, (5), 277-289 (2016).
  3. Inagaki, S., Nagai, T. Current progress in genetically encoded voltage indicators for neural activity recording. Current Opinion in Chemical Biology. 33, 95-100 (2016).
  4. St-Pierre, F., et al. High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor. Nature Neuroscience. 17, (6), 884-889 (2014).
  5. Lieschke, G. J., Currie, P. D. Animal models of human disease: zebrafish swim into view. Nature Reviews Genetics. 8, (5), 353-367 (2007).
  6. Santoriello, C., Zon, L. I. Hooked! Modeling human disease in zebrafish. Journal of Clinical Investigation. 122, (7), 2337-2343 (2012).
  7. Howe, K., et al. The zebrafish reference genome sequence and its relationship to the human genome. Nature. (2013).
  8. Kawakami, K., Shima, A., Kawakami, N. Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage. Proceedings of the National Academy of Science USA. 97, (21), 11403-11408 (2000).
  9. Urasaki, A., Asakawa, K., Kawakami, K. Efficient transposition of the Tol2 transposable element from a single-copy donor in zebrafish. Proceedings of the National Academy of Science USA. 105, (50), 19827-19832 (2008).
  10. Kwan, K. M., et al. The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Developmental Dynamics. 236, (11), 3088-3099 (2007).
  11. Mosimann, C., et al. Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish. Development. 138, (1), 169-177 (2011).
  12. Lorenz, T. C. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies. Journal of Visualized Experiments. (63), e3998 (2012).
  13. Ordovas, J. M. Separation of small-size DNA fragments using agarose gel electrophoresis. Methods in Molecular Biology. 110, 35-42 (1998).
  14. Downey, N. Extraction of DNA from agarose gels. Methods Mol Biol. 235, 137-139 (2003).
  15. Desjardins, P., Conklin, D. NanoDrop microvolume quantitation of nucleic acids. Journal of Visualized Experiments. 45, (45), (2010).
  16. Green, M. R., Sambrook, J. Molecular cloning : a laboratory manual. Cold Spring Harbor Laboratory Press. (2012).
  17. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  18. Meeker, N. D., Hutchinson, S. A., Ho, L., Trede, N. S. Method for isolation of PCR-ready genomic DNA from zebrafish tissues. Biotechniques. 43, (5), 610, 612, 614 (2007).
  19. Kawakami, K., Koga, A., Hori, H., Shima, A. Excision of the tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Danio rerio. Gene. 225, (1-2), 17-22 (1998).
  20. Westerfield, M. The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). 4th edn, Univ. of Oregon Press. (2000).
  21. Amsterdam, A., et al. Many ribosomal protein genes are cancer genes in zebrafish. PLoS Biology. 2, (5), E139 (2004).
  22. Lai, K., et al. Many ribosomal protein mutations are associated with growth impairment and tumor predisposition in zebrafish. Developmental Dynamics. 238, (1), 76-85 (2009).
  23. Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. Stages of embryonic development of the zebrafish. Developmental Dynamics. 203, (3), 253-310 (1995).
  24. Zhang, G., et al. Comparative oncogenomic analysis of copy number alterations in human and zebrafish tumors enables cancer driver discovery. PLoS Genetics. 9, (8), e1003734 (2013).
  25. Zhang, G., et al. Highly aneuploid zebrafish malignant peripheral nerve sheath tumors have genetic alterations similar to human cancers. Proceedings of the National Academy of Science USA. 107, (39), 16940-16945 (2010).
  26. Urrego, D., Tomczak, A. P., Zahed, F., Stuhmer, W., Pardo, L. A. Potassium channels in cell cycle and cell proliferation. Philosophical Transactions of the Royal Society of London Series B. 369, (1638), 20130094 (2014).
  27. Yang, H. H., et al. Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo. Cell. 166, (1), 245-257 (2016).
  28. Chamberland, S., et al. Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators. Elife. 6, (2017).
  29. Hochbaum, D. R., et al. All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins. Nature Methods. 11, (8), 825-833 (2014).
  30. Sugiyama, M., et al. Illuminating cell-cycle progression in the developing zebrafish embryo. Proceedings of the National Academy of Science USA. 106, (49), 20812-20817 (2009).
Zebrafish जल्दी भ्रूण और ट्यूमर में सेलुलर विद्युत गतिविधि के दृश्य
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Silic, M. R., Zhang, G. Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors. J. Vis. Exp. (134), e57330, doi:10.3791/57330 (2018).More

Silic, M. R., Zhang, G. Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors. J. Vis. Exp. (134), e57330, doi:10.3791/57330 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter