Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

הכנת לפתח רקמות היקפיים חוש הריח עבור מולקולרית וניתוח Immunohistochemical ב דרוזופילה

doi: 10.3791/57716 Published: June 13, 2018

Summary

כאן, אנו מציגים פרוטוקול שלב ומנתחים לפתח חוש הריח רקמות ממינים דרוזופילה . הרקמה ביתור מאוחר יותר ניתן להשתמש עבור ניתוחים מולקולריים, כגון כמותיים RT-PCR (הפוך תמלול-תגובת שרשרת פולימראזית) או RNA רצף (RNAseq), כמו גם ניתוחים ויוו כגון אימונוהיסטוכימיה או בחיי עיר הכלאה.

Abstract

מערכת הריח של דרוזופילה הוא בשימוש נרחב מערכת הנוירו-ביולוגיה התפתחותית, מערכות neuroscience, כמו גם נוירופיזיולוגיה, התנהגות ו אבולוציה התנהגותית. רקמות חוש הריח דרוזופילה בית הנוירונים קולטני ריח (ORNs) לזהות סימנים כימיים נדיפים בנוסף הידרו - ו התרמו-החישה הניריונים. ב פרוטוקול זה, אנו מתארים את הקרע לפתח רקמות היקפיים חוש הריח של המין דרוזופילה למבוגרים. ראשית נתאר כיצד שלב גיל דרוזופילה הזחלים, ואחריה את הקרע של הדיסק antennal הגולמי בשלבים המוקדמים, ואחריה ניתוח מחושיהם שלבים אמצע-הגולמי ומבוגרים. אנו גם מראים שיטות שבו ההכנות יכול להיות מנוצל טכניקות מולקולריות, כגון החילוץ RNA לרביעיית-PCR, RNAseq או אימונוהיסטוכימיה. שיטות אלה ניתן להחיל גם למינים אחרים דרוזופילה לאחר פיתוח הגולמי תלויי מין פעמים נקבעים, בשלבים המתאימים מחושבים להזדקנות המתאים.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

מערכת הריח של דרוזופילה הוא מערכת הנפוצה הנוירו-ביולוגיה התפתחותית, מערכות neuroscience, כמו גם נוירופיזיולוגיה, לימודי התנהגות ו אבולוציה התנהגותית1,2,3, 4. רקמות חוש הריח דרוזופילה בית הנוירונים קולטני ריח (ORNs) לזהות סימנים כימיים נדיפים בנוסף הידרו - ו התרמו-החישה הניריונים1,5,6. המטרה הכוללת של כתב יד זה הוא כדי להדגים כיצד שלב ומנתחים לפתח רקמות חוש הריח הגולמי ומבוגרים במינים דרוזופילה . הרציונל של טכניקה זו היא כדי ליצור דוגמאות מתוך שלבים שונים הגולמי עבור ניתוחים התפתחותית המולקולריים של מערכת הריח היקפיים, כגון RNAseq ו- RT-PCR כמותי, בנוסף ויוו רקמת תיוג טכניקות . טכניקה זו יכולה להיות שימושית במיוחד לזהות את הדינמיקה של פרופילים תעתיק במערכת בפיתוח חוש הריח למבוגרים מן הלא -melanogaster דרוזופילה מינים, אשר אין כל ריאגנטים הטרנסגניים עבור סוג התא הספציפי תיוג וניתוחים. כתב יד זה, נדגים כיצד לנתח דיסקים antennal ומחושים ממינים דרוזופילה הגולמי ומבוגרים. ראשית, אנו מראים כיצד לזהות דרוזופילה הו היווצרות puparium (APF, גלמים לבנים או prepupae) עבור הזמני התפתחותית והזדקנות ספציפית. בשלב הבא, אנו מציגים כיצד לנתח דיסקים antennal ו- antennal המגזר השלישי; באופן ספציפי, כיצד לבטל אותם מן העין דיסק קטע antennal שני טוהר רקמת RNAseq או RT-מותני. שלבי ד melanogaster שמתואר פרוטוקול זה בערך שיתאימו הדיסק antennal בדוגמת מראש (prepupae), הבחירה של סימנים מקדימים של antennal דיסק (8 שעות APF), ההתחלה של בידול מסוף עבור ORNs (40 h APF), ו אנטנה למבוגרים. בסופו של דבר, אנחנו נותנים דוגמאות עבור RT-PCR כמותי של אנטנות למבוגרים מבודדים בשיטת, ובשביל ויוו אימונוהיסטוכימיה. ניתן להשתמש בשיטה זו כדי ליצור דוגמאות עבור ניתוח RNA/DNA, אימונוהיסטוכימיה על פיתוח רקמות היקפיים חוש הריח של מינים שונים דרוזופילה .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

פרוטוקול הבאים הוא תואם ההנחיות האתיקה שנקבעו על-ידי ועדת האתיקה של המחקר באוניברסיטת דיוק.

1. רקמות והכנה הזמני התפתחותית של גולם דרוזופילה melanogaster

  1. ראשית, עליך לזהות כמה זבובים יהיה צורך הקרע. RT-PCR, RNAseq, לאסוף 100-200 דיסקים antennal אנטנות מאנשים אשר נחוצים בשלבים prepupal, 8 שעות APF, 40 h APF, ולמבוגרים. עבור אימונוהיסטוכימיה, לנתח אדם 10-20.
  2. לנקות את כל החומרים, כולל רפידות לנתיחה, מלקחיים, באמצעות מגבונים לחים עם 70% EtOH. אם החומר והטרף הוא לשמש RNA עקירות, לנקות את הכל עם RNase neutralizers ולעשות כל הפתרונות משתמש ללא נוקלאז או מים מטופלים diethyl pyrocarbonate (DEPC).
    הערה: פרוטוקול זה משתמש רפידות ניתוח סיליקון במקום זכוכית עבור ניתוח. רפידות סיליקון ידידותי מלקחיים ultra-בסדר, לקדם והניתוחים באיכות גבוהה ומהירה.
  3. לאסוף גולם לעבר 0 הבמה APF/prepupal.
    1. כדי להבטיח שהצג הזמני, המדויקת ביותר את הזחלים ב 30 דקות ל- 1 h מרווחי.
      הערה: נודד הזחלים לחלל השלישי בבקבוק צפוף למדי סביר להניח pupate תוך מספר שעות.
    2. לאחר הזחלים להיות משותק, מוקפים קל מאוד (כמעט לבן) מקרה הגולמי צבעוניים, להעביר אותם לתוך קטנים 2 - בתוך צלחת פטרי עם נייר סינון לח.
    3. נמשכות h 1-2, מעת לעת ניטור, זיהוי, ולהעביר prepupae.
      הערה: לחלופין, לנקות בקבוק של הגלמים כל ולאפשר את הזחלים לפתח כבר שעתיים. כל הגלמים נאספים אחרי 2 h יהיה בטווח של APF 0 - 2 h.
  4. מיד לעבור שלב 3.1 שאנתח את הדיסק antennal prepupal לבמה APF 0 h. אם prepupa צריך ליישן, לאסוף אותם לתוך תבשיל, מכסים את הכלי במקום סרט פרפין בקצוות כדי לעכב יובש, במקום הפטרי בגיל 25 º C.
    הערה: הגלמים יכול עכשיו להיות בני כדי וגיחתו.
  5. על הגלמים נאספים בטווח 2 h, גיל את prepupae כבר שעתיים פחות הגיל הרצויה על מנת להבטיח כי הגלמים אין עודף.
  6. השתמש בסדר אולטרה מלקחיים (דומונט 55) הרקמה הוא מאוד קטן, שברירי.

2. רקמת והכנה הזמני התפתחותית של גולם ממינים אחרים דרוזופילה

  1. כדי לקבוע את משך הפיתוח הגולמי במינים אחרים דרוזופילה , למקם את הדגימות בטמפרטורה אופטימלית את תאריכי מתי prepupae הם נצפו, למיין אותם לתוך בקבוקון טריים, לרשום את מספר הימים prepupa ועד לבגרות.
  2. להקליט את היחס בין זמן לפיתוח הגולמי עבור מינים שאינהmelanogaster ועבור melanogaster. הכפל את היחס בין הזמן התפתחותית לפי מספר שעות המשמש להפקת melanogaster כדי לקבל את מספר שעות גיל המין הלא -melanogaster .

3. ניתוח דיסק Antennal הגולמי melanogaster ד

הערה: כל הזדקנות פעמים ואת הפרוטוקולים לנתיחה מתוארים עבור melanogaster דרוזופילה. עבור כל המינים האחרים, שינוי של פרוטוקול ההזדקנות המבוססת על נקודות זמן התפתחותית תלויי מין יידרש, כמתואר לעיל.

  1. עבור דיסק antennal הגולמי והניתוחים, לאסוף 50-100 0 - 2 h או 6-8 h הגלמים הישן באמצעות מרית ולמקם אותם על משטח חיתוך.
  2. פיפטה µL 150 של RNA בידוד פתרון לתוך RNase microfuge 1.5-mL חינם צינור באמצעות פיפטה של 200-µL ומניחים את הצינורית על קרח.
  3. לנתח את הגלמים ב- 150-200 µL ל- 1 x PBS (buffered פוספט תמיסת מלח, ללא נוקלאז). במקום מספר טיפות של PBS (150-200 µL לכל droplet) על משטח חיתוך.
  4. על משטח חיתוך, מקום של 0 - 2 h או 6-8 h בגילאי גלמי (גולם אחד לכל טיפה) ניסויים באחד ה 1 x טיפות PBS. להשתמש מלקחיים ביד אחת כדי לייצב את הגוף.
  5. עבור 0 - 2 h בני הגלמים, באמצעות מלקחיים ביד אחרים, להחזיק לחלק הקדמי ביותר (ווים הפה) prepupa, תוציא את זה החוצה כדי לחשוף את המוח ואת דמותי הדיסקים המחוברים לתיק הגולמי הקדמי.
  6. עבור 8 שעות APF הגלמים, תחילה בעדינות לקלף את המקרה הגולמי מהעיר הקדמי ביותר של הגולם, לחשוף את הראש בתוך השק קרום העוטף את הגוף.
    הערה: הגוף, בשלב זה, נראה כמו זחל המתנוונת.
  7. הסר את הראש צוואר המשותפת.
    הערה: פעולה זו מבטיחה כי הדיסקים antennal לא יאבדו, אשר בשלב זה קשורים בעיקר האונות הראייה של המוח.
  8. להעביר את רקמת המוח, הדיסקים דמותי עוד 1 x droplet PBS באמצעות מלקחיים או על פיפטה 20-µL.
  9. לזהות את הדיסק עין-antennal מחובר אל המוח-האונות אופטיים. באמצעות מלקחיים, נתק את הדיסק עין-antennal את המוח ואת המקרה הגולמי. . להעביר אותו אחד x droplet PBS באמצעות מלקחיים או פיפטה 20-µL
    הערה: הדיסק עין-antennal prepupal הוא רקמה שטוח. עם זאת, על-ידי הגלמים 8 שעות, הדיסקים העין מסובבות cupping הדיסקים antennal, אשר יושב והשתרשה עמוק בלבה המוח המרכזי.
  10. באמצעות מלקחיים, חותכים את הרקמה באתר של הקשר בין העין לבין הדיסק antennal. להשתמש על פיפטה 20-µL להעביר הרקמה ביתור בעדינות לתוך RNA בידוד פתרון הכימית. למזער את כמות הנוזל שהועברו על-ידי pipetting סכום קטן ככל האפשר.
  11. חזור עד הגלמים כל יש כבר גזור.

4. ניתוח melanogaster ד אמצע-הגולמי ומחושים למבוגרים

הערה: מאת 40 h APF, הרוב המכריע של הגלגול השלם, המבנים למבוגרים הופכים לכאורה, אבל הם עדיין לבנים, ייחוד. בשלב זה הזמן התפתחותית, האנטנה למבוגרים לקח את צורתה הסופית אך עדיין הוא שקוף, הרוב המכריע של קולטני הריח, מלבד כמה, לא התחלת הביטוי.

  1. עבור ניתוח antennal הגולמי, לאסוף 50-100 prepupae כפי שמתואר בשלב 1, גיל אותם עבור h 40-25 º C.
  2. Pipet 150 µL של RNA פתרון הבידוד לתוך microcentrifuge 1.5-mL חינם RNase צינור באמצעות pipet 200-µL ומניחים את הצינורית על קרח.
  3. על משטח חיתוך, במקום הגולם ניסויים לאחד 1 x טיפות PBS. להשתמש מלקחיים ביד אחת כדי לייצב את הגוף. באמצעות מלקחיים וביד השנייה, לקלף בעדינות. את המקרה הגולמי מהעיר הקדמי ביותר של הגולם, לחשוף את הראש בתוך השק קרום העוטף את הגוף
  4. באמצעות מלקחיים, בזהירות לחתוך את הראש משאר חלקי הגוף הגולמי על ידי החזקת הגוף בעזרת ערכה אחת של מלקחיים לשדוד את הראש על הצוואר משותפת עם עוד זוג מלקחיים. בעדינות להעביר את הראש לתוך עוד 1 x droplet PBS באמצעות מלקחיים. פיפטה למעלה ולמטה כדי לנקות את התוכן של הראש (המוח, וכדומה) כדי לקבל קרום צלול זה המשמש להקפת ראשו דרוזופילה המתפתח.
    הערה: ב- 40-50 h APF, מחושיהם מחוברים אל המקטע הקדמי ביותר של הקרום. הם יהפכו לעין עבור ניתוח כאשר התוכן של הראש נמחקים עם pipetting.
  5. באמצעות מלקחיים, נתק מחושיהם הגולמי של הקרום. נתק על קטע 2nd של האנטנה 3rd באמצעות מלקחיים פרוסה המשותפת סגמנטלי, כפי רק על קטע 3rd יהיה בית הנוירונים קולטני ריח.
  6. להשתמש על פיפטה 20-µL להעביר הרקמה ביתור בעדינות לתוך RNA בידוד פתרון הכימית. למזער את כמות הנוזל שהועברו על-ידי pipetting סכום קטן ככל האפשר. חזור עד הגלמים כל יש כבר גזור.
  7. ניתוח antennal למבוגרים, לאסוף כ 50 מבוגרים, גיל אותם עבור וגיחתו פוסט שבוע.
    הערה: הביטוי של גנים קולטני ריח וגם אחרות הגנים שיא שבוע אחרי וגיחתו. המבוגרים הם בגילאי במשך שבוע להבטיח גנים ביולוגית רלוונטית תעתיקי שפע נמוך להתעלות מעל לסף גילוי.
  8. עבור ה-RNA עקירות, לנתח זבובים כאשר הם עדיין חיים על משטח2 CO. פנקו את הפנקס2 CO עם מעכבי RNase. עבור הדמיה קונאפוקלית, לנתח את הזבובים על משטח חיתוך 1 x PBS או PBS + 0.2% טריטון.
  9. ראשית, שים המבוגרים לישון על משטח התחנה2 CO מתחת למיקרוסקופ לנתיחה. על משטח התחנה של2 CO באמצעות מלקחיים ביד אחת כדי לייצב את הגוף, להשתמש מלקחיים וביד השנייה כדי בעדינות משיכה/קמצוץ החוצה קטע שלישי antennal מן השני.
  10. העברת מחושיהם לתוך פתרון בידוד ה-RNA, באמצעות מלקחיים כדי למקם את האנטנה ישירות לתוך הנוזל. חזור עד מבוגרים יש כבר גזור.
    הערה: ודא כי מחושיהם טובע בפתרון בידוד ה-RNA. מחושיהם ייתכן נתקעות בצד של הצינור. זה יגרום של השפלה מוגברת של RNA, הפחתת כמות ואיכות של RNA.
  11. ישירות להמשיך החילוץ RNA או מקם את הצינור ב-80 מעלות צלזיוס לאחסון לטווח ארוך.

5. RNA בידוד רקמות גזור

  1. להסיר את כל הדגימות מהמחסן-80 ° C, להפשיר אותם על קרח.
  2. בקצרה ספין (5-6 s, g x ~ 6,000) כל דגימה כדי לאסוף את החומר בתחתית הצינורית.
  3. לטחון כל דגימה באמצעות שהעקב פלסטיק של בלוק מנוע חשמלי עבור 10 s על קרח.
  4. חזור על שלבים 5.2 ו- 5.3 4.
  5. לבצע את החילוץ RNA באמצעות ערכות זמינים מסחרית ובעקבות הפרוטוקולים של היצרן עבור תשואה האופטימלית.
  6. לבצע לרביעיית-PCR תוך שימוש זמינים מסחרית ריאגנטים ספציפיים primers נגד גנים עניין ובעקבות הפרוטוקולים של היצרן.
    1. לבצע את כל תגובות PCR תוך שימוש בתנאים הבאים: דנטורציה 95 מעלות צלזיוס למשך 10 דקות ואחריו 40 מחזורי 95 ° C 15 s, 55 ° C ל 30 s, ו- 60 ° C ל 30 s.
      הערה: פריימר זוגות עבור גנים DIP ו dpr המפורטים בטבלה1, צבעי יסוד גנים קולטני ריח מפורטים Hueston CE. et al. 8.

6. קיבוע של דיסקים Antennal הגולמי, אנטנה עבור אימונוהיסטוכימיה

הערה: לתקן את הרקמות בקבוצות של 10-20 אנשים כדי להבטיח שהרקמות קבועות עבור אותה כמות זמן. למזער את כמות הזמן שהדגימות להישאר PBT (PBS עם חומר ניקוי) לפני אכלוסם לשבועיים כדי למקסם את התקינות של הרקמות.

  1. לאסוף הדיסקים antennal גזור או אנטנה הגולמי צינור PCR 200-µL המכיל 200 µL של 0.2% PBT על קרח כדי לשמור על שלמות רקמות, וכדי למנוע את הדגימה של דבק הקיר של ה-PCR 200-µL צינורות שיוביל קיבעון לא שלם.
    הערה: אנטנות הגולמי ודיסקים antennal יכול להיות קשה לראות כפי שהם שקופים למדי. רצוי להשתמש טווח ניתוח עבור כל שלבי הכביסה כדי למנוע אובדן של רקמת. לחלופין, צלחות Terasaki 96-ובכן עשוי להיות משמש הקיבעון מכתימים לעקוב בצורה הטובה ביותר את הרקמה.
  2. לתקן את דיסק antennal גזור ודוגמאות antennal מן הגלמים כ-200 µL של 4% מחברים (Paraformaldehyde) במשך 30 דקות בטמפרטורת החדר. בשביל זה ובעקבות צעדים, לשמור את הצינורות עם הדגימות על nutator כראוי לערבב את הדגימות בפתרון. ההתקדמות לשלב 6.7.
  3. עבור האנטנה למבוגרים, לנתח את הראש כולו קודם ולתקן את זה כ-200 µL של 4% מחברים (paraformaldehyde) לשעה בטמפרטורת החדר.
  4. לשטוף 3 x עם 200 µL של 0.2% PBT למשך 10 דקות. שומרים את הדגימות-nutator בזמן הדגירה.
  5. לחזור למיקרוסקופ לנתיחה על הקרע עדינה יותר של המקטע השני antennal מראשן קבוע. באמצעות מלקחיים כדי לייצב את הראש, בעדינות משיכה/קמצוץ החוצה קטע שלישי antennal מן השני.
  6. להעביר את מקטעי antennal השלישי גזור כ-200 µL של 4% מחברים (paraformaldehyde) ולתקן אותם למשך 30 דקות בטמפרטורת החדר.
  7. לשטוף 3 x עם 200 µL של 0.2% PBT למשך 10 דקות. שומרים את הדגימות-nutator בזמן הדגירה.
  8. לאחסן את הדגימות ב 4 ° C או להמשיך ישירות עם אימונוהיסטוכימיה הר שלמה.
    הערה: היעילות של צביעת עשויים להשתנות כאשר הנוגדן נמצא בשימוש. שיטה זו צריכה להיות נוגדנים המתאימים פחות חלבון בשפע תגיות או חלש יותר. עם זאת, לעיתים, זה עשוי לדרוש לאופטימיזציה של הפרוטוקול (זהות או כמות מקבע או את הזמן של קיבוע).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

הרקמה ביתור חוש הריח המתפתח יכול לשמש לחילוץ RNA ואחריו RT-PCR כדי להעריך ביטוי גנים או יכול להיתפס באמצעות פרוטוקולים אימונוהיסטוכימיה כדי לקבוע את דפוס הביטוי שלו, לוקליזציה תת הסלולר של הגנים של ריבית. בחלק זה, אנו מציגים תוצאות נציג או פרוטוקול. איור 1 הוא נציג כמותיים RT-PCR מציג שעתוק של קולטן פני שטח התא, גנים קולטני ריח בפראי-סוג האנטנה למבוגרים. איור 2 מציג את h 6-8 ו- 12 שעות APF דיסק antennal stainings על Rn-EGFP הטרנסגניים זבובים באמצעות אנטי-GFP (1:1000), נוגדנים anti-מיטל (מטריים) (איור 2א ו- 2B). Rn-EGFP תוויות אזורים מסוימים בתוך הדיסק antennal בשלבים המוקדמים הגולמי. אנו גם מראים 40 h APF הגולמי antennal anti-GFP נוגדן מכתים של הזבובים הטרנסגניים UAS Or67d-GAL4-CD8GFP , למבוגרים antennal anti-elav (1: 100) נוגדן כתמים ORNs (איור 2). דוגמאות נוספות ניתן למצוא גם ספרות7,8,9,10.

Figure 1
איור 1 . כמותיים RT-PCR מדגימות פראי-סוג למבוגרים antennal RNA עבור גנים שונים. הלוחות הללו להראות תוצאות RT-PCR כמותי (א) מח שאלפא, מח ש- eta, dpr5, dpr8, kug, beatIIIb (עבור פריימר זוגות ראה טבלה 1), (B) חוש הריח, קולטן ionotropic (או / Ir) הגנים למבוגרים דוגמאות antennal RNA. קווי השגיאה להציג שגיאה סטנדרטית של ממוצע (SEM). או / Ir גנים הם נמוכים שפע RNAs זה עדיין ניתן לזהות על ידי לרביעיית-PCR. הביטוי של גנים כל נותחו דולר. Ct ערכים שימשו לחישוב מקדמי דילול כל הגן מבוססת על תקן עקומות שנוצרו עבור כל הגן. הגורמים לדילול היו אז מנורמל עבור כל הגן הביטוי הממוצע של כל הגנים נמדד כמתואר לפני8. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2 . אימונוהיסטוכימיה באמצעות נוגדנים שונים על פיתוח חוש הריח רקמות. אלה מראות אנטי-GFP (ירוק), אנטי-עדנה לדאני ורד (אדום) נוגדן stainings (א) 6-אייץ ' APF הגולמי דיסקים antennal, (B) דיסקים antennal הגולמי APF 12 שעות. (ג) לוח זה מראה ה 40 APF האנטנה מ transgenics Or67d GAL4 UAS-CD8GFP צבעונית עם הארנב נוגדנים anti-GFP (ירוק). (ד) לוח זה מציג אנטנות למבוגרים מוכתם נוגדנים anti-CD2, איזה לייבל Or47b-CD2 חיובי ORNs (מגנטה). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

פריימר לפנים פריימר הפוכה אורך
CGGAGAGGAGGTTATGAGCA GGAAGTGCACAACTAGCGTT 143
CGCGAATCGTTGTGTCAGTA TGTCGATAGCGTGAACCTGA 129
AGGAGTGGACGTTGAGTTACA CAATCATGTCCTCGTGACCG 146
TAGAGTCCGAGCAGCAGATG GTCAGAATTCGAGTTGTCCGC 104
GGCGCTAAGTAGCAGGACG GGCCAAGTCTGTTTGTGAGG 215
TAAGACCCTAGCGCCCTCTT AGGGAGATGCGCTTTGAGAC 129

טבלה 1. רשימת ה-PCR תחל בשימוש לרביעיית-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

פרוטוקול זה הוא משאב שימושי עבור מעבדות מעוניין לזהות את גנטי תעתיק ותוכניות הפעלה בפיתוח דרוזופילה רקמות חוש הריח, כמו גם ניתוח השוואתי של תוכניות אלה על פני דרוזופילה מינים. זה שימושי במיוחד אם מערכות ברמת פרופילים תעתיק של שלבים התפתחותיים שונים נדרשים בתור פריימר עבור מחקרים עתידיים. הפרוטוקול המתואר כאן מדגים כיצד שלב ולבודד לפתח חוש הריח ברקמה מן דרוזופילה להשיג דגימות של ארבעה שלבי פיתוח מערכת חוש הריח של המתבנת מראש כדי התמיינות סופנית, כדי לשמש מפתח החיסון-היסטולוגית המולקולריים מחקרים. גזור דרוזופילה antennal דיסקים ומחושים בשלבים שונים הגולמי יכול לשמש כדי לזהות ביטוי גנים פרופילים במהלך פיתוח מערכת הריח ברמת מערכות על ידי RNA-seq, או ברמה של גנים בודדים RT-PCR כמותי. דגימות יכול גם לשמש עבור הכלאה אימונוהיסטוכימיה, בחיי עיר כדי לזהות תבניות ויוו רקמות ספציפיות גנים. יתרון נוסף של פרוטוקול זה היא כי יכול לקדם דגימות ביתור הפומבית תוך שימוש בשיטות הרגילות, וממוינות FAC-כדי להשיג אוכלוסיה הסלולר מטוהרים (או תאים בודדים) עבור ניתוחים מולקולריים ייחודיים לסוג התא, כגון כמותיים RT-PCR או RNAseq.

אף-על-פי הפרוטוקול מדגים והניתוחים דיסקים antennal ואת אנטנות מ הגולמי (ב 0 h/prepupa, 8 שעות ו- 40 ח APF) שלבים למבוגרים, אותה ניתן להתאים לנקודות זמן הגולמי אחרים. זה גם ראוי לציין כי למידה והניתוחים האלה לוקח זמן. מומחה צריך להיות מסוגל לנתח 50 דגימות לשעה. זה חשוב לא עודפות הגלמים. לכן, שעה לפני תחילת חיתוך, ודא כי אין הגלמים הם מגיל הרצוי. ניתוח יכול לקחת זמן ללמוד, כך נדרשת תקופת אימון עבור כל שלב לפני הפעלת ניסויים. והניתוחים הופכים קשה יותר מ 9-12 h APF עקב שינויים מורפולוגיים. ניתן למיין את הגלמים לפי גיל בעת איסוף prepupae (על-ידי צבע הגוף, עם צבעים כהים יותר להיות מבוגר יותר). בתחילה מיון prepupae מאפשר חיתוך לפי גיל כדי למנוע overaging.

הפרוטוקול המתואר לעיל ניתן להחיל למינים אחרים דרוזופילה . התזמון של והניתוחים הגולמי של מינים אחרים יכולה להתבסס הן על היחס של ההתפתחות הגולמי של זן נתון 25 ° c melanogaster ד והן על תצפיות השוואתית של מורפולוגיה דיסק אנטנה/antennal במהלך ניתוח, עם עדיפות לשיקולים מורפולוגיים כמו זהה ככל האפשר. עבור דרוזופילה melanogaster, השלב הגולמי לוקח כ 4 ימים. Sechellia ד ו ד זקופה הזמני התפתחותית הגולמי דומה melanogaster ד; עם זאת, התפתחות הגולמי virilis ד הוא 1.3 x11,עוד12. כאשר מינים אחרים מוכנים לנתיחה, הזמני צריך להיות מבוסס על שני התזמון של התקופה הגולמי ותצפיות השוואתית של מורפולוגיה דיסק ספציפי הבמה אנטנה/antennal, עם הדמיון מורפולוגי להיות העדיפות הגבוהה ביותר. ראשית, עליך לזהות אופטימום טיפול טמפרטורה עבור המין שאתם מעוניינים. מינים רבים לגדול טוב ב 25 ° C, אך ניתן לקבל מידע מפורט על תנאי אחזקה מן המרכז מניות של מינים בסן דיאגו דרוזופילה .

השלבים הקריטיים ביותר בפרוטוקול הן היערכות נכונה ניתוח ראוי של הרקמה עניין בנאותה מספרים של מינים שונים. ברגע אלה נמצאים במקום, הפרוטוקול מספק שיטה יעילה של רקמות אוסף עבור ניתוחים כאלה, ניתן להתאים כמעט כל רקמות הדיסק דמותי מתפתחות בשלבים הגולמי של כל מין דרוזופילה .

מגבלה אחת של פרוטוקול זה היא כי אינה מספקת דוגמאות ייחודיים לסוג התא. הבנה מפורטת יותר של תפקוד התאים מורפולוגיה דורש תא פרופיל של שעתוק ברמה מערכות, בנוסף נהלי מולקולרי כגון RT-PCR כמותי או אימונוהיסטוכימיה ייחודיים לסוג. פרופיל ייחודיים לסוג תא היה קשה, במיוחד לאור חוסר תאים ייחודיים לסוג כתב transgenics במינים הלא -melanogaster עם ההתקדמות הנוכחית פרופיל הסלולר, transgenics, CRISPR-Cas9 מתווכת הגנום עריכה במינים הלא -melanogaster , עכשיו זה אפשרי לשים תווית ולמיין את תאים בודדים עניין לעשות פרופיל שעתוק13.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgments

מחקר זה נתמך על ידי מענק של הקרן הלאומית למדע כדי Pelin ג וולקן (דב-1457690).

Materials

Name Company Catalog Number Comments
10X Phosphate-buffered Saline Gibco 70011-044 Dilute to 1X in RNase free water
CO2 tank Air Gas CD R200
Two sharp forceps (Dumont #55) Fine Science Tools 11255-20
Trizol Invitrogen 15596-026 RNA isolation solutions
Dissecting Microscope
Small bucket with ice
P20 and P200 micropipettes and tips
1.7 mL Microfuge tubes Purchase nuclease free for best results
0.2 mL PCR tubes
Paraformaldehyde powder Polysciences 380
10% Triton X-100 Teknova T1105 Dilute to 0.2% v/v in 1X PBS
2" petri dishes
55mm filter paper Whatman 1001-055 Wet with water and place in a petri dish to keep pupae moist
25 C incubator
deionized H2O Purchase nuclease free or treat with DEPC
Sylgard 184 Silicone Elastomer Kit Dow Corning to be used for making dissection pads from Terizaki plate covers.
MicroWell Mini Trays with lids Nunc 438733 Lids can be used to make silicone dissection pads
Rabbit anti-GFP antibody MBL international corpor PM005 primary antibody
Mouse anti RAT CD2 AbD seroTec MCA154RHDL primary antibody
ADL195 (anti lamin, mouse) Dev studies hydoma ban ADL195-s primary antibody
Alexa Fluor® 488 goat anti-rabbit IgG (H+L) invitrogen A11008 Secondary antibody
Cy3 Goat Anti-Mouse IgG Jackson ImmunoResearch 115-166-003 Secondary antibody
Triton X-100, Protein Grade Detergent, 10% Solution, Sterile-Filtered CALBIOCHEM 648463 detergent
Lab Rotator Thermo scientific Rotator
Nuclease Free Water Growcells.com NUPW-0125 Water
Light-Duty Tissue Wipers VWR 82003-822 For cleaning dissection supplies
Superscript II invitrogen 18064014 Reverse Transcriptase 
QIAshredder (50) RNA extraction QIAGEN 79654
Oligo(dT)12-18 Primer RT life technologies 18418012
RNeasy MinElute Cleanup Kit (50) RNA extraction QIAGEN 74204
FASTSTART UNIV SG MASTER (5 ML)(500 RXN) qPCR Roche 04913850001
FASTSTART ESSENTIAL GREEN DNA MASTER  qPCR Roche 06402712001
LIGHTCYCLER 480 - MULTIWELL PLATE 96 qPCR Roche 04729692001
NEBNext High-Fidelity 2X PCR Master Mix qPCR NEB M0541S

DOWNLOAD MATERIALS LIST

References

  1. Barish, S., Volkan, P. C. Mechanisms of olfactory receptor neuron specification in Drosophila. Wiley Interdisciplinary Reviews. Developmental Biology. 4, (6), 609-621 (2015).
  2. Pan, J. W., Volkan, P. C. Mechanisms of development and evolution of the insect olfactory system. Cell and Developmental Biology. 2, 130 (2013).
  3. Ramdya, P., Benton, R. Evolving olfactory systems on the fly. Trends in Genetics. 26, (7), 307-316 (2010).
  4. Bellen, H. J., Tong, C., Tsuda, H. 100 years of Drosophila research and its impact on vertebrate neuroscience: a history lesson for the future. Nature Reviews Neuroscience. 11, (7), 514-522 (2010).
  5. Knecht, Z. A., et al. Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila. eLife. 5, 44-60 (2016).
  6. Enjin, A., et al. Humidity sensing in Drosophila. Current Biology. 26, (10), 1352-1358 (2016).
  7. Li, Q., Barish, S., Okuwa, S., Volkan, P. C. Examination of endogenous rotund expression and function in developing Drosophila. olfactory system using CRISPR-Cas9-mediated protein tagging. G3: Genes|Genomes|Genetics. 5, (12), 2809-2816 (2015).
  8. Hueston, C. E., et al. Chromatin modulatory proteins and olfactory receptor signaling in the refinement and maintenance of fruitless expression in olfactory receptor neurons. PLoS Biology. 14, (4), 1002443 (2016).
  9. Li, Q., et al. Combinatorial rules of precursor specification underlying olfactory neuron diversity. Current Biology. 23, (24), 2481-2490 (2013).
  10. Li, Q., et al. A functionally conserved gene regulatory network module governing olfactory neuron diversity. PLoS Genetics. 12, (1), 1005780 (2016).
  11. Pan, J. W., et al. Patterns of transcriptional parallelism and variation in the developing olfactory system of Drosophila species. Scientific Reports. 7, (1), 8804 (2017).
  12. Pan, J. W., et al. Comparative analysis of behavioral and transcriptional variation underlying CO2 sensory neuron function and development in Drosophila. Fly. 11, (4), 239-252 (2017).
  13. Stern, D. L., et al. Genetic and transgenic reagents for Drosophila simulans, D. mauritiana, D. yakuba, D. santomea, and D. virilis. G3: Genes|Genomes|Genetics. 7, (4), 1339-1347 (2017).
הכנת לפתח רקמות היקפיים חוש הריח עבור מולקולרית וניתוח Immunohistochemical ב <em>דרוזופילה</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).More

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter