Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Förbereda utveckla perifera Olfactory vävnad för molekylär och immunhistokemisk analys i Drosophila

doi: 10.3791/57716 Published: June 13, 2018

Summary

Här presenterar vi ett protokoll för att mellanlagra och dissekera utveckla olfactory vävnad från Drosophila arter. Dissekerade vävnaden kan senare användas för molekylära analyser, såsom kvantitativ RT-PCR (omvänd Transkription-Polymerase Chain Reaction) eller RNA sekvensering (RNAseq), samt i vivo analyser såsom immunohistokemi eller i situ hybridisering.

Abstract

Luktsinnet i Drosophila är ett allmänt använt system i utvecklingsmässiga neurobiologi, system neurovetenskap, samt neurofysiologi, beteende och beteendemässiga utveckling. Drosophila olfactory vävnader hus luktreceptor nervceller (ORNs) som upptäcka flyktiga kemiska signaler förutom hydro - och thermo-sensoriska nervceller. I detta protokoll beskriver vi dissektion av utveckla perifera olfactory vävnad av de vuxna Drosophila -arterna. Först beskrivs hur man arrangerar och ålder Drosophila larver, följt av dissektion av antennal skivan från tidiga Pupp, följt av dissektion av antenner från mitten av-Pupp stadier och vuxna. Vi visar också metoder där preparat kan utnyttjas i molekylära tekniker, såsom den RNA-extraktionen för qRT-PCR, RNAseq eller immunohistokemi. Dessa metoder kan också tillämpas på andra Drosophila arter efter artspecifika Pupp utvecklingstider bestäms, och respektive etapper beräknas för lämpliga åldrande.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Den lukt Drosophila är en allmänt använd system i utvecklingsmässiga neurobiologi, system neurovetenskap, samt neurofysiologi, beteende studier och beteendemässiga evolution1,2,3, 4. Drosophila olfactory vävnader hus luktreceptor nervceller (ORNs) som upptäcka flyktiga kemiska signaler förutom hydro - och thermo-sensoriska nervceller1,5,6. Det övergripande målet för detta manuskript är att demonstrera hur mellanlagra och dissekera utveckla Pupp och vuxen lukt vävnad i Drosophila arter. Grunden för denna teknik är att generera prover från olika Pupp stadier för molekylär- och utvecklingstoxicitet analyser av perifera luktsinnet, såsom RNAseq och kvantitativ RT-PCR, i tillägg till i vivo vävnad märkning tekniker . Denna teknik kan vara särskilt användbara för att identifiera dynamiken i transkriptionell profiler i utvecklingsländer vuxen luktsinnet från icke -Drosophila melanogaster arter, som inte har alla de transgena reagenserna för celltyp specifika märkning och analyser. I detta manuskript visar vi hur du dissekera antennal skivor och antenner från Pupp och vuxen Drosophila arter. Först, vi visar hur man identifierar Drosophila 0 h puparium bildas (APF, vit puppor eller prepupae) för utvecklingstoxicitet Förproduktion och artspecifika åldrande. Nästa, vi visar hur du dissekera antennal skivor och tredje antennal segmentet; specifikt, hur att skilja dem från ögat skiva och andra antennal segmentet för vävnad renhet krävs för RNAseq eller RT-primärvården. Faserna i D. melanogaster beskrivs i detta protokoll ungefär motsvarar pre mönstrade antennal skivan (prepupae), val av prekursorer från den antennal skiva (8 h APF), början på den terminal differentieringen för ORNs (40 h APF), och Adult antenn. Slutligen, vi ge exempel för en kvantitativ RT-PCR från vuxna antenner isolerade metoden, och för in-vivo immunohistokemi. Denna metod kan användas för att generera prover för en RNA/DNA-analys och immunohistokemi på att utveckla perifera olfactory vävnader från olika Drosophila arter.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Följande protokoll är förenligt med etiska riktlinjer fastställda av den Duke University forskningsetisk kommitté.

1. vävnad förberedelse och utvecklingsmässiga iscensättning av Drosophila melanogaster puppa

  1. För det första identifiera hur många flugor kommer att behövas för dissektion. För RT-PCR och RNAseq, samla 100-200 antennal skivor och antenner från individer som är nödvändiga i prepupal, 8 h APF, 40 h APF, och vuxen skeden. För immunohistokemi, dissekera 10-20 individ.
  2. Rengör alla material, inklusive dissektion kuddar och pincett, med våtservetter med 70% EtOH. Om dissekerade materialet skall användas för RNA extraktioner, rengöra allt med RNase neutraliseringsmedel och kontrollera alla lösningar använder antingen nuclease-fri eller dietyleter pyrocarbonate (DEPC) behandlat vatten.
    Obs: Detta protokoll använder silikon dissektion kuddar istället för glas för dissektionerna. Silikon pads är vänliga att ultrafina pincett och främja snabb och högkvalitativ dissektioner.
  3. Samla pupa i 0 h APF/prepupal scenen.
    1. För att säkerställa den mest exakta iscensättningen, övervaka larverna på 30 min till 1 h intervall.
      Obs: Vandrande tredje instar larver i en måttligt trångt flaska kommer sannolikt förpuppas inom några timmar.
    2. När larverna blivit orörlig och omges av en mycket ljus (nästan vit) färgade Pupp fall, överföra dem till en liten 2 - i petriskål med en fuktig filterpapper.
    3. Fortsätt i 1-2 h, ibland övervakning, att identifiera och överföra prepupae.
      Obs: Alternativt rensa en flaska alla puppor och tillåta larverna utveckla för 2 h. Alla puppor samlas in efter 2 h kommer att inom ett 0 - 2 h APF.
  4. Omedelbart flytta till steg 3.1 att dissekera prepupal antennal skivan för 0 h APF scenen. Om prepupa måste vara åldern, samla dem i en skål, täck skålen och placera en paraffin film runt kanterna för att förhindra torrhet och placera petriskål vid 25 ° C.
    Obs: Puppor kan nu vara år till eclosion.
  5. För puppor samlas i ett 2 h-utbud, åldern på prepupae för 2 h mindre än önskad ålder för att säkerställa att puppor inte överanvändning.
  6. Använd ultrafina pincett (Dumont 55) eftersom vävnaden är mycket liten och skör.

2. vävnad förberedelse och utvecklingsmässiga iscensättning av puppa från andra Drosophila arter

  1. Att bestämma längden på Pupp utvecklingen i andra Drosophila arter, placera proverna vid optimal temperatur, registrera datum när prepupae observeras, sortera dem i en färsk injektionsflaska och registrera antalet dagar från prepupa till vuxen ålder.
  2. Spela in förhållandet mellan tid för Pupp utveckling för icke -melanogaster arter och för melanogaster. Multiplicera kvoten av utvecklande tiden av antalet timmar för mellanlagring melanogaster brukade få antal timmar att åldras de icke -melanogaster arterna.

3. dissektion av D. melanogaster Pupp Antennal skiva

Obs: Alla åldrande gånger och dissektion protokoll finns beskrivna för Drosophila melanogaster. För alla andra arter, kommer en ändring av protokollet åldrande baserat på artspecifika utvecklingsmässiga tidpunkter att krävas, som beskrivs ovan.

  1. För Pupp antennal skiva dissektioner, samla 50-100 0 - 2 h eller 6-8 h gamla puppor med hjälp av en spatel och placera dem på en dissektion pad.
  2. Pipettera över 150 µL RNA isolering lösning till ett RNase gratis 1,5 mL microfuge röret med 200-µL pipett och placera röret på is.
  3. Dissekera puppor i 150-200 µL 1 x PBS (fosfatbuffrad saltlösning, nuclease-fri). Placera flera droppar av PBS (150-200 µL per droppe) på dissektion pad.
  4. På dissektion pad, placera 0 - 2 h eller 6-8 h åldern puppor (en puppa per droppe) för att vara dissekeras i en av 1 x PBS droppar. Använd tång i ena handen för att stabilisera kroppen.
  5. För 0 - 2 h åldern puppor, med tången i andra handen, håll på att den mest främre delen (de mun krokarna) av prepupa och dra ut för att exponera hjärnor och imaginal skivorna bifogas främre Pupp fallet.
  6. För de 8 h APF puppor, först försiktigt lossna från den främre kvartal Pupp om puppa, utsätta chefen inom membran säcken som omger kroppen.
    Obs: Kroppen, i det här skedet ser ut som en degenererande larv.
  7. Ta bort huvudet vid hals gemensamt.
    Obs: Detta säkerställer att de antennal skivorna inte kommer att försvinna, som i detta skede är anslutna primärt till optic loberna av hjärnan.
  8. Överföra vävnaden med hjärnor och imaginal skivorna till en annan 1 x PBS droplet med pincett eller en 20-µL pipett.
  9. Identifiera skivan eye-antennal ansluten till hjärnan på optic loberna. Med pincett, koppla eye-antennal skivan från hjärnan och Pupp fallet. Överföra den till en ny 1 x PBS droplet med pincett eller en 20-µL pipett.
    Obs: Prepupal eye-antennal skivan är en platt vävnad. Dock av de 8 h puppor roterar ögat skivorna koppning antennal skivorna, som sitter anterior centrala hjärnan.
  10. Använda pincett, skära vävnaden på platsen för anslutning mellan ögat och antennal skivan. Använd en 20-µL pipetten försiktigt överföra dissekerade vävnaden i RNA isolering lösning reagensen. Minimera mängden av vätska som överförs av pipettering ett belopp som är så liten som möjligt.
  11. Upprepa tills alla puppor har varit dissekerade.

4. dissekering av D. melanogaster Mid-Pupp och vuxen antenner

Obs: Av 40 h APF, majoriteten av metamorfosen är komplett och strukturerna som vuxen blir tydligare, men är fortfarande vit och intetsägande. Detta utvecklingsmässiga tidpunkt, vuxen antennen har tagit sin slutgiltiga form ännu fortfarande är transparent och majoriteten av luktreceptorer, utom några, har inte börjat uttryck.

  1. För Pupp antennal dissektioner, samla 50-100 prepupae som beskrivs i steg 1 och ålder dem för 40 h vid 25 ° C.
  2. Pipettera 150 µL RNA isolering lösning till ett RNase gratis 1,5 mL mikrocentrifug rör med en 200-µL Pipettera och placera röret på is.
  3. På dissektion pad, placera puppan till vara dissekeras in i ett av 1 x PBS droppar. Använd tång i ena handen för att stabilisera kroppen. Med tången i andra handen, försiktigt lossna från den främre kvartal Pupp om puppa, utsätta chefen inom membran säcken som omger kroppen.
  4. Använda pincett, försiktigt skära bort huvudet från resten av Pupp kroppen genom att hålla kroppen med en uppsättning pincett och slita huvudet av i nacken gemensamt med en annan uppsättning pincett. Försiktigt över huvudet till en annan 1 x PBS droplet med pincett. Pipettera upp och ner för att rensa ut innehållet i huvudet (hjärnan, etc.) att få en tydlig membran som brukade omge utveckla Drosophila huvudet.
    Obs: På 40-50 h APF, antennerna ansluts till den främre-mest delen av membranet. De kommer att bli uppenbara för dissektion när innehållet i huvudet rensas med pipettering.
  5. Med pincett, koppla Pupp antenner från membranet. Koppla från segmentet 2nd av antennen från 3rd med pincett till segment vid segmentell gemensamt, som endast 3rd segmentet kommer huset luktreceptor nervceller.
  6. Använd en 20-µL pipetten försiktigt överföra dissekerade vävnaden i RNA isolering lösning reagensen. Minimera mängden av vätska som överförs av pipettering ett belopp som är så liten som möjligt. Upprepa tills alla puppor har varit dissekerade.
  7. För vuxen antennal dissektioner, samla cirka 50 vuxna och ålder dem för en vecka efter eclosion.
    Anmärkning: Uttrycket av luktreceptor gener och andra gener topp en vecka efter eclosion. Vuxna är år för en vecka för att säkerställa biologiskt relevanta gener med låg överflöd avskrifter att stiga över den påvisbara gränsen.
  8. För RNA extraktioner, dissekera flugor medan de fortfarande lever på en CO2 pad. Behandla CO2 pad med RNase-hämmare. För confocal imaging, dissekera flugorna på en dissektion pad 1 x PBS eller PBS + 0,2% Triton.
  9. Först ut de vuxna att sova på CO2 station pad under dissektion tillämpningsområdet. På CO2 station pad, med hjälp av tången i ena handen för att stabilisera kroppen, Använd pincett i andra hand att försiktigt dra/nypa sig tredje antennal segmentet från andra.
  10. Överföra antenner i en RNA isolering lösning, med pincett för att placera antennen direkt i vätskan. Upprepa tills alla vuxna har varit dissekerade.
    Observera: Kontrollera att antennerna är nersänkta i RNA isolering lösning. Antennerna kan fastna på sidan av röret. Detta kommer att orsaka en ökad nedbrytning av RNA, minska RNA kvalitet och kvantitet.
  11. Direkt vidare till den RNA-extraktionen eller placera röret vid-80 ° C för långsiktig lagring.

5. RNA isolering från dissekerade vävnader

  1. Ta bort alla prover från-80 ° C lagring och Tina dem på isen.
  2. Kort snurra (5-6 s, ~ 6 000 x g) varje prov för att samla in materialet på botten av röret.
  3. Slipa varje prov med en Ånghärdad plast mortel och en elmotor för 10 s på is.
  4. Upprepa steg 5.2 och 5.3 4.
  5. Utföra den RNA-extraktion med kommersiellt tillgängliga kit och följa tillverkarens protokollen för en optimal avkastning.
  6. Utföra qRT-PCR med hjälp av kommersiellt tillgängliga reagenser och specifika primers mot gener av intresse och följa tillverkarens protokollen.
    1. Utföra alla PCR reaktioner med följande villkor: 95 ° C denaturering för 10 min följt av 40 cykler av 95 ° C under 15 s, 55 ° C för 30 s och 60 ° C under 30 s.
      Obs: Primer par för dopp och dpr gener är listade i tabell 1och primers för luktreceptor gener listas i Hueston CE o.a. 8.

6. fixering av Pupp Antennal skivor och antenner för immunohistokemi

Obs: Fixa vävnader i omgångar från 10-20 personer att säkerställa vävnader är fasta för samma belopp av tid. Minimera mängden tid proverna bo i PBT (PBS med rengöringsmedel) före överföra dem till ett fixativ för att maximera integriteten i vävnaderna.

  1. Samla den dissekerade antennal skivor eller Pupp antenner i ett 200-µL PCR-rör som innehåller 200 µL 0,2% PBT på is att upprätthålla vävnad integritet och för att undvika provet fastnar på väggen av 200-µL PCR rör som leder till en ofullständig fixering.
    Obs: Pupp antenner och antennal skivor kan vara svårt att se eftersom de är ganska genomskinlig. Det är tillrådligt att använda en dissektion omfattning för alla tvätt steg för att förhindra förlust av vävnad. Alternativt kan 96 brunnar Terasaki plattor att användas för fixering och färgning bästa spåra vävnaden.
  2. Fixa dissekeras antennal skiva och antennal prover från puppor i cirka 200 µL 4% PFA (PARAFORMALDEHYD) under 30 minuter vid rumstemperatur. För detta och efterföljande hålla steg, rören med prover på en nutator till korrekt Blanda proverna i lösningen. Gå vidare till steg 6,7.
  3. För vuxna antennen, dissekera hela huvudet först och fixa det i cirka 200 µL 4% PFA (PARAFORMALDEHYD) för 1 h i rumstemperatur.
  4. Tvätta 3 x med 200 µL 0,2% PBT för 10 min varje. Hålla proverna på nutator under ruvningen.
  5. Gå tillbaka till mikroskopet dissektion för en finare dissektion av det andra antennal segmentet från fasta huvuden. Med pincett för att stabilisera huvudet, försiktigt dra/nypa sig tredje antennal segmentet från andra.
  6. Överför segmenten för dissekerade tredje antennal till ungefärligt 200 µL av 4% PFA (PARAFORMALDEHYD) och fixera dem i 30 min i rumstemperatur.
  7. Tvätta 3 x med 200 µL 0,2% PBT för 10 min varje. Hålla proverna på nutator under ruvningen.
  8. Lagra proverna vid 4 ° C eller fortsätta direkt med hela mount immunohistokemi.
    Obs: Effektiviteten av färgning kan ändras när antikroppen som används. Denna metod bör vara lämpligt för mindre förekommande proteinet taggar eller svagare antikroppar. Dock ibland, kan det krävas en optimering av protokollet (antingen identitet eller mängden fixeringsvätskan eller tidpunkten för fixering).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dissekerade utveckla olfactory vävnaden kan användas för RNA-extraktion följt av RT-PCR för att bedöma genuttryck eller kan tas genom immunohistokemi protokoll att avgöra dess uttryck mönster och sub cellulär lokalisering av gener av intresse. I det här avsnittet presenterar vi representativa resultat från antingen protokollet. Figur 1 är den representant kvantitativ RT-PCR visar transkriptionen av cell surface receptor och luktreceptor gener i vildtyp vuxen antenner. Figur 2 visar den 6-8 h och 12 h APF antennal skiva färgningar på Rn-andra transgena flyger med anti-GFP (1: 1000) och anti-lamin antikroppar (1: 100) (figur 2A och 2B). RN-andra etiketter vissa regioner inom antennal skivan ett tidigt skede Pupp. Vi visar också 40 h APF Pupp antennal anti-GFP antikropp färgning av Or67d-GAL4 UAS-CD8GFP transgena flugor och vuxen antennal anti-elav (1: 100) antikropp färgning av ORNs (figur 2). Andra exempel kan också hittas i litteratur7,8,9,10.

Figure 1
Figur 1 . Kvantitativ RT-PCR från vildtyp vuxen antennal RNA-prover för olika gener. Dessa paneler Visa kvantitativ RT-PCR-resultat för (A) DIP-alfa, dpr5, beatIIIb, dpr8, DIP-eta, kug (för primer par se tabell 1), och (B) lukt och jonkanalkopplad receptor (eller / Ir) gener från vuxen antennal RNA-prover. Felstaplar visar ett standardfel av medelvärde (SEM). Eller / Ir gener är låg överflöd RNAs som fortfarande kan identifieras av qRT-PCR. Uttrycket av varje gen analyserades i tre exemplar. CT-värden användes för att beräkna utspädningsfaktorer för varje gen bygger på standard kurvor skapas för varje gen. Utspädningsfaktorer var sedan normaliseras för varje gen för alla gener mätt enligt beskrivningen innan8genomsnittliga uttryck. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 . Immunhistokemi med olika antikroppar på utveckla olfactory vävnader. Dessa paneler visar anti-GFP (grön) och anti-lamin (röd) antikropp färgningar på (A), 6 h APF Pupp antennal skivor och ()B) 12 h APF Pupp antennal skivor. (C), denna panel visar en 40 h APF antenn från Or67d GAL4 UAS-CD8GFP transgenics färgas med kanin anti-GFP (grön)-antikroppar. (D) i denna panel visas vuxen antenner färgas med anti-CD2 antikroppar, som etiketten Or47b-CD2 positiva ORNs (magenta). Klicka här för att se en större version av denna siffra.

Forward primer Reverse primer Längd
CGGAGAGGAGGTTATGAGCA GGAAGTGCACAACTAGCGTT 143
CGCGAATCGTTGTGTCAGTA TGTCGATAGCGTGAACCTGA 129
AGGAGTGGACGTTGAGTTACA CAATCATGTCCTCGTGACCG 146
TAGAGTCCGAGCAGCAGATG GTCAGAATTCGAGTTGTCCGC 104
GGCGCTAAGTAGCAGGACG GGCCAAGTCTGTTTGTGAGG 215
TAAGACCCTAGCGCCCTCTT AGGGAGATGCGCTTTGAGAC 129

Tabell 1. Lista av PCR primers används i qRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Detta protokoll är en användbar resurs för labs som är intresserad av att identifiera de genetiska och transkriptionell program i utveckla Drosophila olfactory vävnad, samt en jämförande analys av dessa program över Drosophila arter. Det är särskilt användbart om system-nivå transkriptionell profiler från olika utvecklingsstadier behövs som en primer för framtida studier. Protokollet beskrivs här visar hur mellanlagra och isolera utveckla olfactory vävnad från Drosophila att erhålla prover från fyra viktiga utvecklingsstadier luktsinnet från före mönstring till terminal differentiering, som ska användas i molekylära och immun-histologiska studier. Dissekerade Drosophila antennal skivor och antenner i olika Pupp skeden kan användas för att identifiera genen uttrycket profiler under luktsystem utvecklingen på system av RNA-seq, eller på nivån för enskilda gener av kvantitativ RT-PCR. Prover kan också användas för immunhistokemi och i situ hybridisering för att identifiera i vivo mönster av vävnadsspecifika genuttryck. Ytterligare en fördel med detta protokoll är att dissekeras prover kan vara ytterligare dissocierade med standardmetoder, och FAC-sorterade skaffa en renad cellulära befolkningen (eller enstaka celler) för cell typspecifika molekylära analyser, såsom kvantitativa RT-PCR eller RNAseq.

Även om protokollet visar dissektioner av antennal skivor och antenner från Pupp (vid 0 h/prepupa, 8 h och 40 h APF) och vuxna stadier, kan det anpassas till andra Pupp tidpunkter. Det är också värt att nämna att lära dessa dissektioner tar tid och praxis. En expert bör kunna dissekera 50 prov en timme. Det är viktigt att inte överåriga puppor. En timme innan du börjar dissektion, se därför till att inga puppor är äldre än önskad ålder. Dissektioner kan ta tid att lära sig, så det krävs en period av praxis för varje etapp före start experiment. Dissektioner blir svårare från 9-12 h APF på grund av morfologiska förändringar. Det är möjligt att sortera puppor efter ålder när du samlar in prepupae (av kroppen färg, med mörkare färger som äldre). Initialt sortering prepupae möjliggör dissektion i ĺldersordning att förhindra overaging.

Det protokoll som beskrivs ovan kan tillämpas på andra Drosophila -arter. Tidpunkten för de Pupp dissektionerna av andra arter kan baseras både på förhållandet mellan Pupp utvecklingen av en viss art vid 25 ° C till den D. melanogaster och på jämförande observationer av antenner/antennal skiva morfologi under dissektioner, med en prioriteringen av morfologiska överväganden så identiska som möjligt. För Drosophila melanogastertar Pupp scenen cirka 4 dagar. D. sechellia och D. erecta Pupp utvecklingsmässiga iscensättning är lik D. melanogaster; D. bars Pupp utveckling är dock 1.3 x längre11,12. När andra arter är förberedda för dissektion bör iscensättningen baseras på både tidpunkten för perioden Pupp och jämförande observationer av scenen-specifika antenner/antennal skiva morfologi, med morfologiska likheten att vara högsta prioritet. Först, identifiera den optimala hanteringstemperaturen för de arter som du är intresserad. Många arter växer väl vid 25 ° C, men detaljerad information om underhållsvillkor kan erhållas från UC San Diego Drosophila arter lager center.

De viktigaste stegen i protokollet är rätt iscensättning och ordentlig dissektion av vävnad av intresse i lämpliga nummer från olika arter. När dessa är på plats, protokollet ger en effektiv metod av vävnad samling för sådana analyser och kan praktiskt taget anpassas till någon utveckla imaginal skiva vävnad under Pupp stadier i någon Drosophila art.

En begränsning i detta protokoll är att den inte ger typspecifika cellprover. En mer detaljerad förståelse av cellulär funktion och morfologi kräver cell typspecifika profilering av transkription på systemnivå, förutom molekylär standardprocedurer såsom kvantitativ RT-PCR eller immunohistokemi. Cell typspecifika profilering har varit svårt, särskilt med tanke på bristen på cell typspecifika reporter transgenics i icke -melanogaster arter. Med de aktuella framsteg inom cellulär profilering, transgenics och CRISPR-Cas9 medierad gen editering i icke -melanogaster arter, det är nu möjligt att märka och sortera ut enstaka celler av intresse att profilera transkription13.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Denna studie stöddes av ett stipendium från National Science Foundation till Pelin C. Volkan (DEB-1457690).

Materials

Name Company Catalog Number Comments
10X Phosphate-buffered Saline Gibco 70011-044 Dilute to 1X in RNase free water
CO2 tank Air Gas CD R200
Two sharp forceps (Dumont #55) Fine Science Tools 11255-20
Trizol Invitrogen 15596-026 RNA isolation solutions
Dissecting Microscope
Small bucket with ice
P20 and P200 micropipettes and tips
1.7 mL Microfuge tubes Purchase nuclease free for best results
0.2 mL PCR tubes
Paraformaldehyde powder Polysciences 380
10% Triton X-100 Teknova T1105 Dilute to 0.2% v/v in 1X PBS
2" petri dishes
55mm filter paper Whatman 1001-055 Wet with water and place in a petri dish to keep pupae moist
25 C incubator
deionized H2O Purchase nuclease free or treat with DEPC
Sylgard 184 Silicone Elastomer Kit Dow Corning to be used for making dissection pads from Terizaki plate covers.
MicroWell Mini Trays with lids Nunc 438733 Lids can be used to make silicone dissection pads
Rabbit anti-GFP antibody MBL international corpor PM005 primary antibody
Mouse anti RAT CD2 AbD seroTec MCA154RHDL primary antibody
ADL195 (anti lamin, mouse) Dev studies hydoma ban ADL195-s primary antibody
Alexa Fluor® 488 goat anti-rabbit IgG (H+L) invitrogen A11008 Secondary antibody
Cy3 Goat Anti-Mouse IgG Jackson ImmunoResearch 115-166-003 Secondary antibody
Triton X-100, Protein Grade Detergent, 10% Solution, Sterile-Filtered CALBIOCHEM 648463 detergent
Lab Rotator Thermo scientific Rotator
Nuclease Free Water Growcells.com NUPW-0125 Water
Light-Duty Tissue Wipers VWR 82003-822 For cleaning dissection supplies
Superscript II invitrogen 18064014 Reverse Transcriptase 
QIAshredder (50) RNA extraction QIAGEN 79654
Oligo(dT)12-18 Primer RT life technologies 18418012
RNeasy MinElute Cleanup Kit (50) RNA extraction QIAGEN 74204
FASTSTART UNIV SG MASTER (5 ML)(500 RXN) qPCR Roche 04913850001
FASTSTART ESSENTIAL GREEN DNA MASTER  qPCR Roche 06402712001
LIGHTCYCLER 480 - MULTIWELL PLATE 96 qPCR Roche 04729692001
NEBNext High-Fidelity 2X PCR Master Mix qPCR NEB M0541S

DOWNLOAD MATERIALS LIST

References

  1. Barish, S., Volkan, P. C. Mechanisms of olfactory receptor neuron specification in Drosophila. Wiley Interdisciplinary Reviews. Developmental Biology. 4, (6), 609-621 (2015).
  2. Pan, J. W., Volkan, P. C. Mechanisms of development and evolution of the insect olfactory system. Cell and Developmental Biology. 2, 130 (2013).
  3. Ramdya, P., Benton, R. Evolving olfactory systems on the fly. Trends in Genetics. 26, (7), 307-316 (2010).
  4. Bellen, H. J., Tong, C., Tsuda, H. 100 years of Drosophila research and its impact on vertebrate neuroscience: a history lesson for the future. Nature Reviews Neuroscience. 11, (7), 514-522 (2010).
  5. Knecht, Z. A., et al. Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila. eLife. 5, 44-60 (2016).
  6. Enjin, A., et al. Humidity sensing in Drosophila. Current Biology. 26, (10), 1352-1358 (2016).
  7. Li, Q., Barish, S., Okuwa, S., Volkan, P. C. Examination of endogenous rotund expression and function in developing Drosophila. olfactory system using CRISPR-Cas9-mediated protein tagging. G3: Genes|Genomes|Genetics. 5, (12), 2809-2816 (2015).
  8. Hueston, C. E., et al. Chromatin modulatory proteins and olfactory receptor signaling in the refinement and maintenance of fruitless expression in olfactory receptor neurons. PLoS Biology. 14, (4), 1002443 (2016).
  9. Li, Q., et al. Combinatorial rules of precursor specification underlying olfactory neuron diversity. Current Biology. 23, (24), 2481-2490 (2013).
  10. Li, Q., et al. A functionally conserved gene regulatory network module governing olfactory neuron diversity. PLoS Genetics. 12, (1), 1005780 (2016).
  11. Pan, J. W., et al. Patterns of transcriptional parallelism and variation in the developing olfactory system of Drosophila species. Scientific Reports. 7, (1), 8804 (2017).
  12. Pan, J. W., et al. Comparative analysis of behavioral and transcriptional variation underlying CO2 sensory neuron function and development in Drosophila. Fly. 11, (4), 239-252 (2017).
  13. Stern, D. L., et al. Genetic and transgenic reagents for Drosophila simulans, D. mauritiana, D. yakuba, D. santomea, and D. virilis. G3: Genes|Genomes|Genetics. 7, (4), 1339-1347 (2017).
Förbereda utveckla perifera Olfactory vävnad för molekylär och immunhistokemisk analys i <em>Drosophila</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).More

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter