Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Préparer le développement de tissu olfactif périphérique pour moléculaire et analyse Immunohistochemical chez la drosophile

doi: 10.3791/57716 Published: June 13, 2018

Summary

Nous présentons ici un protocole pour organiser et disséquer à développer le tissu olfactif des espèces de drosophile . Le tissu découpé peut ensuite être utilisé pour des analyses moléculaires, comme quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) ou l’ARN séquençage (RNAseq), ainsi que des analyses in vivo , comme immunohistochemistry ou in situ hybridation.

Abstract

Le système olfactif de la drosophile est un système largement utilisé dans la neurobiologie développementale, neurosciences des systèmes, ainsi que neurophysiologie, comportement et évolution comportementale. Des tissus de drosophile olfactifs maison les neurones récepteurs olfactifs (ORN) détectant les signaux chimiques volatils en plus des neurones hydro - et thermo-sensorielle. Dans ce protocole, nous décrivons la dissection de mettre au point des tissus périphériques olfactif de l’espèce de drosophile adulte. Tout d’abord, nous décrivons comment organiser et l’âge des larves de drosophile , suivies par la dissection du disque antennaire de premiers stades nymphales, suivies par la dissection des antennes des adultes et de milieu-pupal étapes. Nous montrons également les méthodes où les préparations doivent être utilisées dans les techniques moléculaires, tels que l’extraction de l’ARN pour qRT-PCR, RNAseq ou immunohistochimie. Ces méthodes peuvent également être appliquées à d’autres espèces de drosophile après temps de développement nymphal spécifique à l’espèce sont déterminés et stades respectifs sont calculés pour le vieillissement approprié.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Le système olfactif de la drosophile est un système largement utilisé dans la neurobiologie développementale, neurosciences des systèmes, ainsi que neurophysiologie, études de comportement et évolution comportementale1,2,3, 4. Des tissus de drosophile olfactifs abritent les neurones récepteurs olfactifs (ORN) détectant les signaux chimiques volatils en plus de l’hydro - et thermo-sensorielle neurones1,5,6. L’objectif global de ce manuscrit est de démontrer comment organiser et disséquer développant des pupe et adult tissu olfactif chez les espèces de drosophile . La justification de cette technique consiste à produire des échantillons de différents stades nymphales analyses moléculaires et du développement du système olfactif périphérique, tels que RNAseq et RT-PCR quantitative, en outre à in vivo des tissus techniques de marquage . Cette technique peut être particulièrement utile pour identifier la dynamique des profils de transcriptionnelles dans le développement du système olfactif adult des espèces non -melanogaster de drosophile , qui n’ont pas tous les réactifs transgéniques pour le type de cellule spécifique labels et analyses. Dans ce manuscrit, nous démontrons comment disséquer les disques antennaires et antennes d’espèce Drosophila pupe et adulte. Tout d’abord, nous montrons comment identifier Drosophila 0 h de formation puparium (APF, nymphes blanches ou prénymphes) mise en scène du développement et du vieillissement spécifique à l’espèce. Ensuite, nous montrons comment disséquer les disques antennaires et le troisième segment antennaire ; plus précisément, comment les désolidariser le disque oculaire et l’antennaire deuxième pour la pureté de tissu nécessaire pour RNAseq ou RT-PCR. Les étapes chez d. melanogaster décrit dans le présent protocole, à peu près correspondent à des motif disque antennaire (prénymphes), la sélection des précurseurs de l’antennaire disc (8 h CSA), le début de la différenciation terminale pour Orn (40 h CSA), et antenne adulte. Enfin, nous donner des exemples pour une RT-PCR quantitative d’antennes adultes isolés à l’aide de la méthode et pour en vivo immunohistochemistry. Cette méthode peut être utilisée pour générer des échantillons pour l’analyse de l’ARN/ADN et immunohistochimie sur le développement des tissus périphériques olfactives provenant de différentes espèces de drosophile .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Le protocole suivant est compatible avec les orientations de l’éthique mis en place par le Duke University Research Ethics Committee.

1. tissu préparation et développement mise en scène de Drosophila melanogaster Pupa

  1. Tout d’abord, identifiez les mouches combien sera nécessaires pour la dissection. Pour la RT-PCR et RNAseq, collecter 100-200 disques antennaires et antennes émanant de particuliers qui sont nécessaires aux stades prénymphal, de 8 h CSA, 40 h CSA et adulte. Pour immunohistochemistry, disséquer individu de 10-20.
  2. Nettoyer tous les matériaux, y compris les plaquettes de dissection et forceps, à l’aide de lingettes avec 70 % EtOH. Si la substance découpée pour être utilisé pour les extractions de RNA, de nettoyer le tout avec des agents neutralisants RNase et de faire toutes les solutions en utilisant soit exempte de nucléase ou diéthyl pyrocarbonate (DEPC) l’eau traitée.
    Remarque : Ce protocole utilise des tampons de dissection de silicone au lieu de verre pour les dissections. Coussinets silicone sont sympathiques à pince ultra-fine et promouvoir les dissections de rapides et de qualité.
  3. Recueillir la nymphe à la 0 h stade prénymphal/CSA.
    1. Afin d’assurer la mise en scène plus précise, surveiller les larves à 30 min à 1 h d’intervalle.
      NOTE : Errant troisième stade larvaire dans une bouteille modérément bondée va probablement se transforment en pupes en quelques heures.
    2. Une fois que les larves deviennent immobiles et sont entourés de très clair (presque blanc) couleur pupe, transférez-les dans un petit 2 - en boîte de Pétri avec papier filtre humide.
    3. Continuer pendant 1-2 h, suivi de temps en temps, identifier et le transfert prénymphes.
      NOTE : Sinon, effacer une bouteille de toutes les pupes et permettre les larves à développer pendant 2 h. Toutes les nymphes, recueillies après que 2 h sera dans une fourchette de CSA 0 - 2 h.
  4. Immédiatement, passez à l’étape 3.1 à disséquer le disque antennaire prénymphal pour la scène de CSA 0 h. Si la prépupale doit être vieillies, les recueillir dans un plat, couvrir le plat et placer un film de paraffine sur les bords pour empêcher le dessèchement et placez la boîte de Pétri à 25 ° C.
    Remarque : Les pupes peuvent maintenant être âgés à éclosion.
  5. Pour les nymphes recueillies dans un intervalle de 2 h, ans les prénymphes pendant 2 h de moins que l’âge désiré afin de s’assurer que les nymphes ne sont pas dépassement.
  6. Utilisation ultra fines pinces (Dumont 55) comme le tissu est très petit et fragile.

2. tissu préparation et mise en scène du développement de nymphe des autres espèces de drosophile

  1. Pour déterminer la longueur du développement pupe chez d’autres espèces de drosophile , placer les échantillons à une température optimale, enregistrer les dates quand on observe les prénymphes, triez-les dans un nouveau flacon et noter le nombre de jours de prépupale à l’âge adulte.
  2. Enregistrer le rapport des temps pour le perfectionnement nymphe pour les espèces non -melanogaster et melanogaster. Multipliez le rapport entre la durée du développement par le nombre d’heures utilisé pour la stadification melanogaster pour obtenir le nombre d’heures jusqu'à l’âge de l’espèce non -melanogaster .

3. dissection du disque antennaire pupes de d. melanogaster

Remarque : Tous les temps de vieillissement et tous les protocoles de dissection sont décrites pour Drosophila melanogaster. Pour toutes les autres espèces, une modification du protocole vieillissement issu des points dans le temps de développement propres à chaque espèce sera requise, tel que décrit ci-dessus.

  1. Pour les dissections de pupes disque antennaire, recueillir 50-100 0 - 2 h ou pupes vieux de 6 à 8 heures à l’aide d’une spatule et placez-les sur un socle de dissection.
  2. Pipetter 150 µL de solution d’isolation du RNA dans une RNase free microtubes de 1,5 mL de tube à l’aide d’une pipette de 200 µL et placer le tube sur la glace.
  3. Disséquer les pupes dans les 150-200 µL de PBS 1 x (solution saline tamponnée au phosphate, exempte de nucléase). Placez plusieurs gouttes de PBS (150-200 µL par goutte) sur la tablette de dissection.
  4. Sur le pavé de la dissection, placer le 0 - 2 h ou pupes h 6-8 ans (une nymphe par goutte) pour être disséqués dans l’un des 1 x gouttelettes de PBS. Utilisez des pinces dans une main pour stabiliser le corps.
  5. Pour les 0 - 2 h âgés de nymphes, avec une pincette dans l’autre main, maintenez sur la partie plus antérieure (les crochets de la bouche) de la prépupale et retirez-la pour exposer les cerveaux et les disques imaginaux attachés à la pupe antérieur.
  6. Pour les nymphes de CSA 8 h, d’abord doucement décoller la pupe par rapport au trimestre antérieur de plus de la pupe, exposer la tête dans le sac de la membrane qui entoure le corps.
    Remarque : Le corps, à ce stade, ressemble à une larve de dégénérescence.
  7. Sortez la tête au niveau du joint de cou.
    NOTE : Ceci fait en sorte que les disques antennaires ne seront pas perdus, qui à ce stade sont liées principalement aux lobes optiques du cerveau.
  8. Transférer le tissu avec le cerveau et les disques imaginaux un autre 1 x gouttelette de PBS à l’aide de pinces ou une pipette 20 µL.
  9. Identifier le disque oeil-antennaire connecté au cerveau dans les lobes optiques. À l’aide de pinces, débranchez le disque oeil-antennaire du cerveau et de la pupe. Transférer vers un nouveau 1 x gouttelette de PBS à l’aide de pinces ou une pipette 20 µL.
    Remarque : Le disque prénymphal eye-antennaire est un tissu plat. Cependant, par les nymphes de 8 h, les disques de le œil sont tournées ventouses les disques antennaires, qui se trouve devant le cerveau central.
  10. À l’aide de pinces, coupez le tissu à l’endroit de connexion entre le œil et le disque antennaire. Utiliser une pipette de 20 µL de transférer doucement le tissu découpé dans le réactif de solution d’isolement ARN. Réduire la quantité de liquide transféré en pipettant également, un montant aussi faible que possible.
  11. Répétez jusqu'à ce que toutes les nymphes ont été disséqués.

4. dissection de d. melanogaster Mid-pupes et adultes antennes

Remarque : 40 h CSA, la majorité de la métamorphose est complète, et les structures adultes deviennent apparentes, mais sont encore blanches et indéfinissable. À ce moment du développement, l’antenne adulte a pris sa forme définitive mais est toujours transparente et la majorité des récepteurs olfactifs, à l’exception de quelques uns, n’ont pas commencé expression.

  1. Pour les dissections antennaires pupes, recueillir 50-100 prénymphes, tel que décrit à l’étape 1 et leur âge pendant 40 h à 25 ° C.
  2. Ajouter 150 µL de solution d’isolation du RNA dans un microtubes de 1,5 mL gratuit RNase tube à l’aide d’une pipette de 200 µL et placer le tube sur la glace.
  3. Sur le pavé de la dissection, placez la pupe à être disséqué dans l’une des 1 x gouttelettes de PBS. Utilisez des pinces dans une main pour stabiliser le corps. Avec une pincette en revanche, décollez délicatement la pupe par rapport au trimestre antérieur de plus de la pupe, exposer la tête dans le sac de la membrane qui entoure le corps.
  4. À l’aide de pinces, découpez soigneusement la tête du reste du corps de nymphe en tenant le corps avec un jeu de pinces et en arrachant la tête au cou en collaboration avec un autre ensemble de pinces. Transférer délicatement la tête dans un autre 1 x gouttelette de PBS avec une pincette. Pipetter en haut et en bas pour nettoyer le contenu de la tête (le cerveau, etc.), afin d’obtenir une membrane claire utilisé pour entourer la tête en développement de la drosophile .
    Remarque : À 40-50 h CSA, les antennes sont connectés à la section la plus antérieure de la membrane. Ils deviendront apparents pour la dissection lorsque le contenu de la tête est effacé avec la pipette.
  5. Avec une pincette, débrancher les antennes pupes de la membrane. Débranchez le segment 2nd de l’antenne de la 3rd avec une pincette à trancher au niveau du joint segmentaire, car seul le segment 3rd abritera les neurones récepteurs olfactifs.
  6. Utiliser une pipette de 20 µL de transférer doucement le tissu découpé dans le réactif de solution d’isolement ARN. Réduire la quantité de liquide transféré en pipettant également, un montant aussi faible que possible. Répétez jusqu'à ce que toutes les nymphes ont été disséqués.
  7. Pour les dissections antennaires adultes, recueillir environ 50 adultes et leur âge pour une éclosion après semaine.
    Remarque : L’expression des gènes des récepteurs olfactifs et autres gènes pic une semaine après l’éclosion. Les adultes sont vieillis pendant une semaine assurer biologiquement pertinentes gènes transcrits de faible abondance s’élever au-dessus du seuil de détection.
  8. Pour les extractions de RNA, disséquer les mouches alors qu’ils sont encore en vie sur une garniture de CO2 . Traiter le CO2 pad avec des inhibiteurs de la RNase. Pour l’imagerie confocale, disséquer les mouches sur une plateforme de dissection dans 1 x PBS ou PBS + 0,2 % Triton.
  9. Tout d’abord, mettre les adultes dormir sur le pad de station CO2 dans le cadre de la dissection. Sur le pavé de la station2 CO, à l’aide de forceps dans une main pour stabiliser le corps, utiliser forceps en revanche pour doucement tirer/manchon sur le troisième segment antennaire dès la seconde.
  10. Transférer les antennes dans une solution d’isolation du RNA, avec une pincette pour placer les antennes directement dans le liquide. Répétez jusqu'à ce que tous les adultes ont été disséqués.
    Remarque : Vérifiez que les antennes soient immergés dans la solution d’isolation du RNA. Les antennes se bloquent sur les bords du tube. Cela entraînera une augmentation de la dégradation de l’ARN, réduire la quantité et la qualité de la RNA.
  11. Directement, procédez à l’extraction de l’ARN ou placer le tube à-80 ° C pour le stockage à long terme.

5. isolement de tissus disséqués

  1. Retirez tous les échantillons de l’entreposage de-80 ° C et les décongeler sur la glace.
  2. Brièvement, spin (5-6 s, ~ 6 000 x g) chaque échantillon pour recueillir le matériel au fond du tube.
  3. Moudre de chaque échantillon à l’aide d’un pilon en plastique autoclavable et un moteur électrique pour 10 s sur la glace.
  4. Répétez les étapes 5.2 et 5,3 4.
  5. Effectuer l’extraction de l’ARN à l’aide de kits disponibles dans le commerce et à la suite de protocoles par le fabricant pour un rendement optimal.
  6. Effectuer qRT-PCR en utilisant des réactifs disponibles dans le commerce et les amorces spécifiques contre les gènes d’intérêt et à la suite des protocoles par le fabricant.
    1. Effectuer toutes les réactions de PCR utilisant les conditions suivantes : dénaturation de 95 ° C pendant 10 min suivi de 40 cycles de 95 ° C pendant 15 s, 55 ° C pendant 30 s et 60 ° C pendant 30 s.
      Remarque : Des paires d’amorces pour gènes DIP et RMR sont répertoriés dans le tableau 1et amorces pour des gènes de récepteurs olfactifs sont répertoriés dans CE Hueston et al. 8.

6. fixation des disques antennaires pupes et antennes pour Immunohistochemistry

NOTE : Fixer les tissus par lots de 10 à 20 personnes pour s’assurer que les tissus sont fixés pour le même laps de temps. Réduire la quantité de temps que les échantillons restent en PBT (PBS avec un détergent) avant de les transférer sur un fixatif pour maximiser l’intégrité des tissus.

  1. Recueillir les disques antennaires disséqués ou antennes pupes dans un tube PCR de 200 µL contenant 200 µL de 0,2 % PBT sur glace pour maintenir l’intégrité des tissus et d’éviter l’échantillon de coller à la paroi de 200 µL PCR tubes qui conduira à une fixation incomplète.
    Remarque : Les antennes pupes et disques antennaires peuvent être difficiles à voir car ils sont tout à fait translucides. Il est conseillé d’utiliser une portée de dissection pour toutes les étapes de lavage pour éviter toute perte de tissu. Alternativement, plaques à 96 puits Terasaki peuvent être utilisé pour la fixation et coloration pour mieux suivre le tissu.
  2. Difficulté le disque antennaire disséqué et les échantillons antennaires de pupe dans environ 200 µL de 4 % PFA (paraformaldéhyde) pendant 30 min à température ambiante. Pour cela et les suivantes étapes, garder les lampes avec les échantillons sur un nutator pour bien mélanger les échantillons dans la solution. Progrès réalisés à l’étape de 6,7.
  3. Pour l’antenne adulte, disséquer la tête entière tout d’abord et le fixer à environ 200 µL de 4 % PFA (paraformaldéhyde) pendant 1 h à température ambiante.
  4. Laver 3 x avec 200 µL de 0,2 % PBT pour 10 min chacun. Conserver les échantillons sur le nutator au cours de l’incubation.
  5. Revenir au microscope à dissection pour une dissection plus fine du second segment antennaire des têtes fixes. À l’aide de pinces pour stabiliser la tête, doucement tirer/manchon sur le troisième segment antennaire dès la seconde.
  6. Transférer les troisième antennaires disséqués dans environ 200 µL de 4 % PFA (paraformaldéhyde) et fixez-les pendant 30 min à température ambiante.
  7. Laver 3 x avec 200 µL de 0,2 % PBT pour 10 min chacun. Conserver les échantillons sur le nutator au cours de l’incubation.
  8. Stocker les échantillons à 4 ° C ou continuer directement avec l’ensemble Mont immunohistochimie.
    Remarque : L’efficacité de la coloration peut changer lorsque l’anticorps est utilisé. Cette méthode doit être apte à moins de balises de protéine abondante ou faibles des anticorps. Cependant, parfois, il peut nécessiter une optimisation du protocole (soit l’identité ou quantité du fixateur ou le temps de fixation).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Le tissu olfactif en développement disséqué peut être utilisé pour l’extraction de l’ARN suivie par RT-PCR pour évaluer l’expression des gènes ou peut être pris par le biais de protocoles d’immunohistochemistry pour déterminer son modèle d’expression et la localisation subcellulaire des gènes de intérêt. Dans cette section, nous présentons des résultats représentatifs de chaque protocole. La figure 1 est le représentant RT-PCR quantitative montrant la transcription des gènes de récepteurs olfactifs et de récepteur de surface cellulaire en antennes adultes sauvage. La figure 2 montre les 6-8 h et 12 h CSA disque antennaire salissures sur la Rn-EGFP transgénique vole en utilisant anti-GFP (1 : 1000) et des anticorps anti-lamin (1/100) (Figure 2A et 2 b). RN-EGFP étiquettes des régions particulières au sein du disque antennaire durant les premiers stades nymphales. Nous montrons également 40 h CSA pupal antennaire anti-GFP souillure d’anticorps Or67d-GAL4 SAMU-CD8GFP mouches transgéniques et adulte antennaire anti-elav (1/100) souillure d’anticorps d’Orn (Figure 2). On trouvera aussi d’autres exemples dans la littérature7,8,9,10.

Figure 1
Figure 1 . RT-PCR quantitative des adultes antennaires échantillons d’ARN sauvage, pour différents gènes. Ces panneaux montrent des résultats de RT-PCR quantitatives pour (A) alpha-DIP, DIP-eta, dpr5, dpr8, kug, beatIIIb (pour apprêt paires voir tableau 1) et (B) olfactif et récepteurs ionotropiques (ou / Ir) gènes d’adulte échantillons d’ARN antennaires. Les barres d’erreur montrent un écart-type de la moyenne (SEM). Ou / Ir gènes sont peu abondantes ARN qui peuvent toujours être détectés par qRT-PCR. L’expression de chaque gène a été analysée en trois exemplaires. Les valeurs de CT ont été utilisées pour calculer les facteurs de dilution pour chaque gène basée sur des courbes standard créés pour chaque gène. Ensuite, les facteurs de dilution ont été normalisées pour chaque gène pour le moyen d’expression de tous les gènes mesurée comme décrit avant8. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 . Immunohistochemistry utilisant des anticorps différents sur le développement de tissus olfactifs. Ces panneaux montrent anti-GFP (green) et anti-lamin (rouge) anticorps salissures sur (A), 6 h CSA pupal antennaires disques et (B) disques antennaires pupes de la CSA-12 h. (C), ce panneau affiche un 40 h APF antenne de transgénèse Or67d GAL4 SAMU-CD8GFP colorées au lapin des anticorps anti-GFP (en vert). (D) ce panneau montre adultes antennes colorées avec les anticorps anti-CD2, quelle étiquette Orn positive Or47b-CD2 (magenta). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Primer avant Inverser l’apprêt Longueur
CGGAGAGGAGGTTATGAGCA GGAAGTGCACAACTAGCGTT 143
CGCGAATCGTTGTGTCAGTA TGTCGATAGCGTGAACCTGA 129
AGGAGTGGACGTTGAGTTACA CAATCATGTCCTCGTGACCG 146
TAGAGTCCGAGCAGCAGATG GTCAGAATTCGAGTTGTCCGC 104
GGCGCTAAGTAGCAGGACG GGCCAAGTCTGTTTGTGAGG 215
TAAGACCCTAGCGCCCTCTT AGGGAGATGCGCTTTGAGAC 129

Le tableau 1. Liste des amorces PCR utilisées par qRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ce protocole est une ressource utile pour les laboratoires intéressés d’identifier les programmes génétiques et transcriptionnelles opérant dans le développement de la drosophile tissu olfactif, en plus d’une analyse comparative de ces programmes à travers de la drosophile espèces. Il est particulièrement utile si les systèmes au niveau transcriptionnels profils de différentes étapes du développement sont nécessaires comme une amorce pour de futures études. Le protocole décrit ici illustre la scène et isoler à développer le tissu olfactif de drosophile pour prélever des échantillons de quatre étapes clés du développement du système olfactif de structuration préalable de différenciation terminale, qui serviront au études moléculaires et immunitaire-histologiques. Disséqué Drosophila disques antennaires et des antennes à différents stades nymphales permet d’identifier des profils d’expression génique au cours du développement du système olfactif au niveau des systèmes de RNA-seq, ou au niveau des gènes individuels par RT-PCR quantitative. Échantillons peuvent également servir pour l’immunohistochimie et in situ hybridation pour définir les modèles in vivo de l’expression génique spécifique aux tissus. Un autre avantage de ce protocole est que les échantillons disséqués peut être plus dissocié à l’aide de méthodes normalisées et FAC-triés afin d’obtenir une population cellulaire purifiée (ou cellules individuelles) pour les analyses moléculaires de cellule spécifique au type, tels que quantitative RT-PCR ou RNAseq.

Même si le protocole montre les dissections de disques antennaires et les antennes de pupes (à 0 h/prépupale, 8 h et 40 h CSA) et les stades adultes, il peut être adapté à d’autres points de pupes de temps. Il est également important de mentionner que ces dissections d’apprentissage prend du temps et pratique. Un expert devrait pouvoir disséquer 50 échantillons prélevés à l’heure. Il ne faut pas excédent les pupes. Donc, une heure avant le début de la dissection, veiller à ce qu’aucun nymphes ne sont plus âgés que l’âge désiré. Les dissections peuvent prendre le temps d’apprendre, donc une période de pratique pour chaque étape est nécessaire avant de commencer les expériences. Les dissections devient plus difficiles de 9-12 h CSA en raison de changements morphologiques. Il est possible de trier les nymphes par âge lors de la collecte prénymphes (par la couleur de la carrosserie, avec des couleurs plus foncées et plus ancien). Au départ tri prénymphes permet pour la dissection de l’âge afin de prévenir le vieillissement.

Le protocole décrit ci-dessus peut être appliqué à d’autres espèces de drosophile . Le moment choisi pour les dissections de pupes d’autres espèces peut être basé sur le ratio du développement d’une espèce donnée à 25 ° C et le d. melanogaster pupe et sur des observations comparatives des antennes/antennaire morphologie de disque au cours de dissections, avec un priorité accordée aux considérations morphologiques sont aussi identiques que possible. Pour Drosophila melanogaster, la chrysalide prend environ 4 jours. D. sechellia et d. erecta pupal développement mise en scène est semblable à d. melanogaster ; Cependant, les pupe développement d. virilis est 1,3 x plus11,12. Lorsque d’autres espèces sont préparés pour la dissection, la mise en scène devrait reposer sur les deux le moment de la période nymphale et observations comparatives de la morphologie spécifique au stade antennes/antennaire de disque, avec la similarité morphologique étant la priorité la plus élevée. Tout d’abord, identifiez l’optimum gestion de température pour l’espèce qui que vous intéresse. Beaucoup d’espèces poussent bien à 25 ° C, mais on trouvera des informations détaillées sur les conditions de maintenance depuis le centre de stock UC San Diego Drosophila espèces.

Les étapes plus critiques dans le protocole sont de la bonne mise en scène et bonne dissection du tissu d’intérêt dans un nombre suffisant de différentes espèces. Une fois que ceux-ci sont en place, le protocole fournit une méthode efficace de prélèvement tissulaire pour ces analyses et s’adapte pratiquement à n’importe quel tissu du disque imaginal en développement durant les stades nymphales dans n’importe quelle espèce de drosophile .

Une des limites du présent protocole est qu’il ne fournit pas les échantillons de cellules spécifiques au type. Une compréhension plus approfondie de la fonction cellulaire et de morphologie exige cellule spécifique au type de profilage de la transcription au niveau des systèmes, en plus des procédures moléculaires standard telles que la RT-PCR quantitative ou immunohistochimie. Cellule spécifique au type de profilage a été difficile, surtout compte tenu de l’absence des cellules spécifiques au type journaliste transgéniques chez les espèces non -melanogaster . Avec les progrès actuels de profilage cellulaire, transgénèse et CRISPR-Cas9 médiée par génome édition chez les espèces non -melanogaster , il est maintenant possible d’étiqueter et de trier les cellules individuelles d’intérêt au profil de13de la transcription.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Cette étude a été financée par une bourse de la National Science Foundation au Pelin C. Volkan (DEB-1457690).

Materials

Name Company Catalog Number Comments
10X Phosphate-buffered Saline Gibco 70011-044 Dilute to 1X in RNase free water
CO2 tank Air Gas CD R200
Two sharp forceps (Dumont #55) Fine Science Tools 11255-20
Trizol Invitrogen 15596-026 RNA isolation solutions
Dissecting Microscope
Small bucket with ice
P20 and P200 micropipettes and tips
1.7 mL Microfuge tubes Purchase nuclease free for best results
0.2 mL PCR tubes
Paraformaldehyde powder Polysciences 380
10% Triton X-100 Teknova T1105 Dilute to 0.2% v/v in 1X PBS
2" petri dishes
55mm filter paper Whatman 1001-055 Wet with water and place in a petri dish to keep pupae moist
25 C incubator
deionized H2O Purchase nuclease free or treat with DEPC
Sylgard 184 Silicone Elastomer Kit Dow Corning to be used for making dissection pads from Terizaki plate covers.
MicroWell Mini Trays with lids Nunc 438733 Lids can be used to make silicone dissection pads
Rabbit anti-GFP antibody MBL international corpor PM005 primary antibody
Mouse anti RAT CD2 AbD seroTec MCA154RHDL primary antibody
ADL195 (anti lamin, mouse) Dev studies hydoma ban ADL195-s primary antibody
Alexa Fluor® 488 goat anti-rabbit IgG (H+L) invitrogen A11008 Secondary antibody
Cy3 Goat Anti-Mouse IgG Jackson ImmunoResearch 115-166-003 Secondary antibody
Triton X-100, Protein Grade Detergent, 10% Solution, Sterile-Filtered CALBIOCHEM 648463 detergent
Lab Rotator Thermo scientific Rotator
Nuclease Free Water Growcells.com NUPW-0125 Water
Light-Duty Tissue Wipers VWR 82003-822 For cleaning dissection supplies
Superscript II invitrogen 18064014 Reverse Transcriptase 
QIAshredder (50) RNA extraction QIAGEN 79654
Oligo(dT)12-18 Primer RT life technologies 18418012
RNeasy MinElute Cleanup Kit (50) RNA extraction QIAGEN 74204
FASTSTART UNIV SG MASTER (5 ML)(500 RXN) qPCR Roche 04913850001
FASTSTART ESSENTIAL GREEN DNA MASTER  qPCR Roche 06402712001
LIGHTCYCLER 480 - MULTIWELL PLATE 96 qPCR Roche 04729692001
NEBNext High-Fidelity 2X PCR Master Mix qPCR NEB M0541S

DOWNLOAD MATERIALS LIST

References

  1. Barish, S., Volkan, P. C. Mechanisms of olfactory receptor neuron specification in Drosophila. Wiley Interdisciplinary Reviews. Developmental Biology. 4, (6), 609-621 (2015).
  2. Pan, J. W., Volkan, P. C. Mechanisms of development and evolution of the insect olfactory system. Cell and Developmental Biology. 2, 130 (2013).
  3. Ramdya, P., Benton, R. Evolving olfactory systems on the fly. Trends in Genetics. 26, (7), 307-316 (2010).
  4. Bellen, H. J., Tong, C., Tsuda, H. 100 years of Drosophila research and its impact on vertebrate neuroscience: a history lesson for the future. Nature Reviews Neuroscience. 11, (7), 514-522 (2010).
  5. Knecht, Z. A., et al. Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila. eLife. 5, 44-60 (2016).
  6. Enjin, A., et al. Humidity sensing in Drosophila. Current Biology. 26, (10), 1352-1358 (2016).
  7. Li, Q., Barish, S., Okuwa, S., Volkan, P. C. Examination of endogenous rotund expression and function in developing Drosophila. olfactory system using CRISPR-Cas9-mediated protein tagging. G3: Genes|Genomes|Genetics. 5, (12), 2809-2816 (2015).
  8. Hueston, C. E., et al. Chromatin modulatory proteins and olfactory receptor signaling in the refinement and maintenance of fruitless expression in olfactory receptor neurons. PLoS Biology. 14, (4), 1002443 (2016).
  9. Li, Q., et al. Combinatorial rules of precursor specification underlying olfactory neuron diversity. Current Biology. 23, (24), 2481-2490 (2013).
  10. Li, Q., et al. A functionally conserved gene regulatory network module governing olfactory neuron diversity. PLoS Genetics. 12, (1), 1005780 (2016).
  11. Pan, J. W., et al. Patterns of transcriptional parallelism and variation in the developing olfactory system of Drosophila species. Scientific Reports. 7, (1), 8804 (2017).
  12. Pan, J. W., et al. Comparative analysis of behavioral and transcriptional variation underlying CO2 sensory neuron function and development in Drosophila. Fly. 11, (4), 239-252 (2017).
  13. Stern, D. L., et al. Genetic and transgenic reagents for Drosophila simulans, D. mauritiana, D. yakuba, D. santomea, and D. virilis. G3: Genes|Genomes|Genetics. 7, (4), 1339-1347 (2017).
Préparer le développement de tissu olfactif périphérique pour moléculaire et analyse Immunohistochemical chez la <em>drosophile</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).More

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter