Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Drosophila में आणविक और Immunohistochemical विश्लेषण के लिए परिधीय घ्राण ऊतक विकसित करने की तैयारी

doi: 10.3791/57716 Published: June 13, 2018

Summary

यहां, हम मंच और Drosophila प्रजातियों में से घ्राण ऊतक विकासशील काटना के लिए एक प्रोटोकॉल प्रस्तुत करते हैं । विच्छेदित ऊतक बाद में आणविक विश्लेषण के लिए इस्तेमाल किया जा सकता है, जैसे मात्रात्मक आरटी-पीसीआर (रिवर्स प्रतिलेखन-पोलीमरेज़ श्रृंखला प्रतिक्रिया) या आरएनए अनुक्रमण (RNAseq), साथ ही vivo विश्लेषणों में जैसे immunohistochemistry या सीटू में संकरण.

Abstract

Drosophila के घ्राण प्रणाली विकासात्मक तंत्रिका जीव विज्ञान, सिस्टम तंत्रिका विज्ञान, साथ ही साथ neurophysiology, व्यवहार, और व्यवहार विकास में एक व्यापक रूप से इस्तेमाल किया प्रणाली है । Drosophila घ्राण ऊतकों घ्राण रिसेप्टर न्यूरॉन्स (ORNs) है कि पन और थर्मामीटरों-संवेदी न्यूरॉन्स के अलावा अस्थिर रासायनिक संकेतों का पता लगाने के घर. इस प्रोटोकॉल में, हम वयस्क Drosophila प्रजातियों के परिधीय घ्राण ऊतक के विकास के विच्छेदन का वर्णन । हम पहले का वर्णन कैसे चरण और उंर Drosophila लार्वा, जल्दी pupal चरणों से antennal डिस्क के विच्छेदन के बाद, मध्य pupal चरणों और वयस्कों से एंटीना के विच्छेदन के बाद । हम यह भी दिखाने के तरीके जहां तैयारी आणविक तकनीक में उपयोग किया जा सकता है, qRT के लिए आरएनए निष्कर्षण के रूप में-पीसीआर, RNAseq, या immunohistochemistry । इन तरीकों को भी अंय Drosophila प्रजातियों के लिए लागू किया जा सकता है प्रजातियों के बाद विशिष्ट pupal विकास समय निर्धारित कर रहे हैं, और संबंधित चरणों उचित उंर बढ़ने के लिए गणना कर रहे हैं ।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Drosophila के घ्राण प्रणाली विकासात्मक तंत्रिका जीव विज्ञान में एक व्यापक रूप से इस्तेमाल प्रणाली है, सिस्टम तंत्रिका विज्ञान, साथ ही साथ neurophysiology, व्यवहार अध्ययन, और व्यवहार विकास1,2,3, 4. Drosophila घ्राण ऊतकों घ्राण रिसेप्टर न्यूरॉन्स (ORNs) कि पन के अलावा अस्थिर रासायनिक संकेतों का पता लगाने के घर और थर्मामीटरों-संवेदी न्यूरॉन्स1,5,6. इस पांडुलिपि के समग्र लक्ष्य को प्रदर्शित करने के लिए कैसे मंच और Drosophila प्रजातियों में pupal और वयस्क घ्राण ऊतक विकासशील काटना है । इस तकनीक के लिए तर्क परिधीय घ्राण प्रणाली के आणविक और विकासात्मक विश्लेषण के लिए विभिन्न pupal चरणों से नमूने उत्पन्न करने के लिए है, जैसे RNAseq और मात्रात्मक आरटी-पीसीआर, vivo ऊतक लेबलिंग तकनीक के अलावा . यह तकनीक विशेष रूप से गैर-melanogaster Drosophila प्रजातियों में से विकासशील वयस्क घ्राण प्रणाली में transcriptional प्रोफाइल की गतिशीलता की पहचान करने के लिए उपयोगी हो सकता है, जो सेल प्रकार विशिष्ट के लिए सभी ट्रांसजेनिक रिएजेंट नहीं है लेबलिंग और विश्लेषण । इस पांडुलिपि में, हम प्रदर्शन कैसे antennal डिस्क और pupal और वयस्क Drosophila प्रजातियों से एंटीना काटना करने के लिए । सबसे पहले, हम विकास मचान और प्रजातियों के विशेष उंर बढ़ने के लिए puparium गठन (APF, सफेद प्यूपा या prepupae) के Drosophila 0 एच की पहचान करने के लिए कैसे दिखाते हैं । अगला, हम antennal डिस्क्स और तीसरे antennal सेगमेंट को काटना करने का तरीका दिखाते हैं; विशेष रूप से, RNAseq या आरटी-पीसीआर के लिए आवश्यक ऊतक शुद्धता के लिए उन्हें नेत्र डिस्क और दूसरा antennal खंड से कैसे अलग कर देना. इस प्रोटोकॉल में वर्णित चरणों में मोटे तौर पर पूर्व पैटर्न antennal डिस्क (prepupae), antennal डिस्क (8 एच APF), ORNs (४० एच APF) के लिए टर्मिनल भेदभाव के शुरू से पुरोगामी का चयन करने के लिए अनुरूप है , और वयस्क ऐंटेना । अंत में, हम वयस्क विधि का उपयोग अलग एंटेना से एक मात्रात्मक आरटी-पीसीआर के लिए उदाहरण देते हैं, और के लिए vivo immunohistochemistry में । इस विधि के लिए एक आरएनए/डीएनए विश्लेषण के लिए नमूने उत्पंन करने के लिए और विभिंन Drosophila प्रजातियों से परिधीय घ्राण ऊतकों के विकास पर immunohistochemistry के लिए इस्तेमाल किया जा सकता है ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

निंनलिखित प्रोटोकॉल ड्यूक विश्वविद्यालय अनुसंधान नैतिकता समिति द्वारा स्थापित नैतिकता के दिशा निर्देशों के अनुरूप है ।

1. ऊतक तैयार करने और Drosophila melanogaster Pupa के विकासात्मक मचान

  1. पहले, पहचानें कि विच्छेदन के लिए कितने मक्खियों की आवश्यकता होगी । RT-पीसीआर और RNAseq के लिए, १००-२०० antennal डिस्क इकट्ठा करें और उन व्यक्तियों से एंटेना जो prepupal, 8 एच APF, ४० एच APF, और वयस्क चरणों में आवश्यक हैं । त्यात immunohistochemistry, काटना 10-20 तास.
  2. विच्छेदन पैड और संदंश सहित सभी सामग्री, साफ ७०% ेतोः के साथ पोंछे का उपयोग कर । RNase बेअसर और या तो nuclease मुक्त या diethyl pyrocarbonate (DEPC) उपचारित पानी का उपयोग कर सभी समाधान बनाने के साथ, आरएनए निकालने के लिए इस्तेमाल किया जा करने के लिए विच्छेदित सामग्री है ।
    नोट: इस प्रोटोकॉल विच्छेदन के लिए कांच के बजाय सिलिकॉन विच्छेदन पैड का उपयोग करता है । सिलिकॉन पैड अल्ट्रा ठीक संदंश के लिए अनुकूल है और तेजी से और उच्च गुणवत्ता वाले विच्छेदों को बढ़ावा देने के ।
  3. इकट्ठा pupa पर 0 एच APF/prepupal चरण ।
    1. सबसे सटीक मचान सुनिश्चित करने के लिए, 30 मिनट के लिए 1 एच अंतराल पर लार्वा की निगरानी ।
      नोट: एक मामूली भीड़ बोतल में तीसरे instar लार्वा भटक की संभावना कुछ ही घंटों के भीतर pupate जाएगा ।
    2. एक बार लार्वा मोबाइल और एक बहुत ही प्रकाश (लगभग सफेद) रंग pupal मामले से घिरे होते हैं, एक नम फिल्टर कागज के साथ एक छोटे से 2-पेट्री डिश में उन्हें हस्तांतरण ।
    3. 1-2 घंटे के लिए जारी रखें, कभी-कभार निगरानी, पहचान, और prepupae स्थानांतरित कर रहा है ।
      नोट: वैकल्पिक रूप से, सभी प्यूपा की एक बोतल साफ़ करें और 2 एच के लिए लार्वा को विकसित करने की अनुमति दें । 2 ज के बाद एकत्र सभी प्यूपा एक 0-2 एच APF रेंज के भीतर होगा ।
  4. तुरंत कदम ३.१ 0 ज APF चरण के लिए prepupal antennal डिस्क काटना करने के लिए कदम । यदि prepupa वृद्ध होने की जरूरत है, उंहें एक डिश में इकट्ठा, पकवान कवर और किनारों के आसपास एक आयल फिल्म जगह सूखापन को बाधित, और 25 डिग्री सेल्सियस पर पेट्री पकवान जगह है ।
    नोट: प्यूपा अब eclosion से वृद्ध हो सकती है.
  5. एक 2 एच रेंज में एकत्र प्यूपा के लिए, prepupae आयु के लिए 2 ज वांछित उंर से कम क्रम में सुनिश्चित करने के लिए कि प्यूपा नहीं है ।
  6. का प्रयोग करें अल्ट्रा ठीक संदंश (Dumont ५५) के रूप में ऊतक बहुत छोटा है और नाजुक है ।

2. ऊतक तैयार करने और अन्य Drosophila प्रजातियों से Pupa के विकास मचान

  1. अन्य Drosophila प्रजातियों में pupal विकास की लंबाई निर्धारित करने के लिए, इष्टतम तापमान पर नमूनों जगह, prepupae मनाया जाता है जब तारीखों रिकॉर्ड, एक ताजा शीशी में उन्हें सॉर्ट, और prepupa से वयस्कता के लिए दिनों की संख्या रिकॉर्ड.
  2. गैर-melanogaster प्रजातियों के लिए और melanogasterके लिए pupal विकास के लिए समय का अनुपात रिकॉर्ड करें । melanogaster मचान के लिए इस्तेमाल घंटे की संख्या द्वारा विकासात्मक समय के अनुपात गुणा गैरmelanogaster प्रजातियों की आयु के लिए घंटे की संख्या प्राप्त करने के लिए ।

3. D. melanogaster Pupal Antennal डिस् क का विच्छेदन

नोट: सभी एजिंग बार और विच्छेदन प्रोटोकॉल Drosophila melanogaster के लिए वर्णित हैं । अन्य सभी प्रजातियों के लिए, प्रजाति के आधार पर एजिंग प्रोटोकॉल का एक संशोधन-विशिष्ट विकासात्मक समय बिंदुओं की आवश्यकता होगी, जैसा कि ऊपर वर्णित है ।

  1. pupal antennal डिस्क विच्छेदन के लिए, ५०-१०० 0-2 h या 6-8 h पुराने प्यूपा एक रंग का उपयोग कर एकत्रित करें और उन्हें एक विच्छेदन पैड पर रखें ।
  2. पिपेट १५० µ एल आरएनए अलगाव समाधान के एक RNase मुक्त १.५-एमएल microfuge ट्यूब में एक २००-µ l पिपेट का उपयोग कर और बर्फ पर ट्यूब जगह है ।
  3. काटना में प्यूपा १५०-२०० µ एल के 1x पंजाबस (फास्फेट बफर खारा, nuclease-मुक्त) । विच्छेदन पैड पर पंजाब (१५०-२०० µ एल) की एक से अधिक बूंदों प्लेस ।
  4. विच्छेदन पैड पर, 0-2 ज या 6-8 एच आयु वर्ग के प्यूपा (एक pupa प्रति ड्रॉप) 1x पंजाबियों बूंदों में से एक में विच्छेदित करने के लिए जगह है । शरीर को स्थिर करने के लिए एक हाथ में संदंश का प्रयोग करें ।
  5. 0-2 एच आयु वर्ग के लिए प्यूपा, दूसरे हाथ में संदंश का उपयोग कर, सबसे पूर्वकाल भाग पर पकड़ (मुंह हुक) prepupa के और इसे बाहर खींच दिमाग और काल्पनिक पूर्वकाल pupal मामले से जुड़ी डिस्क को बेनकाब करने के लिए ।
  6. 8 एच APF प्यूपा के लिए, पहले धीरे से pupa के सबसे पूर्वकाल तिमाही से pupal मामले छील, झिल्ली बोरी कि शरीर के चारों ओर के भीतर सिर को उजागर ।
    नोट: शरीर, इस स्तर पर, एक चूकने लार्वा की तरह लग रहा है ।
  7. गर्दन पर सिर को संयुक्त निकालें ।
    नोट: यह सुनिश्चित करता है कि antennal डिस्क खो नहीं होगा, जो इस स्तर पर मुख्य रूप से मस्तिष्क के ऑप्टिक पालियों से जुड़े हुए हैं ।
  8. संदंश या एक 20-µ l पिपेट का उपयोग कर एक और 1x पंजाबी छोटी बूंद के लिए दिमाग और काल्पनिक डिस्क के साथ ऊतक स्थानांतरण ।
  9. ऑप्टिक पालियों में मस्तिष्क से जुड़े नेत्र-antennal डिस्क की पहचान करें । संदंश का प्रयोग, आंख-antennal डिस्क को ब्रेन और pupal केस से डिस्कनेक्ट कर दीजिये । संदंश या एक 20-µ l पिपेट का उपयोग कर एक नया 1x पंजाबी छोटी बूंद के लिए यह स्थानांतरण ।
    नोट: prepupal eye-antennal डिस्क एक सपाट ऊतक है । हालांकि, 8 एच प्यूपा द्वारा, नेत्र डिस्क antennal डिस्क cupping घुमाया जाता है, जो केंद्रीय मस्तिष्क को पूर्वकाल बैठता है ।
  10. संदंश का प्रयोग, आंख और antennal डिस्क के बीच कनेक्शन के स्थल पर ऊतक काट । एक 20-µ एल पिपेट का प्रयोग धीरे आरएनए अलगाव समाधान एजेंट में विच्छेदित ऊतक हस्तांतरण करने के लिए । pipetting द्वारा स्थानांतरित तरल की मात्रा के रूप में छोटी से कम संभव के रूप में एक राशि ।
  11. जब तक सभी प्यूपा को विच्छेदित किया गया है दोहराएँ ।

4. D. melanogaster मध्य-pupal और वयस्क एंटीना का विच्छेदन

नोट: द्वारा ४० ज APF, कायापलट के बहुमत पूरा हो गया है, और वयस्क संरचनाओं स्पष्ट होते जा रहे हैं, लेकिन अभी भी सफेद और अनिर्वचनीय । इस विकास के समय बिंदु पर, वयस्क ऐंटेना अपनी अंतिम आकार ले लिया है अभी तक अभी भी पारदर्शी और घ्राण रिसेप्टर्स के बहुमत, कुछ के अलावा, अभिव्यक्ति शुरू नहीं किया है ।

  1. pupal antennal विच्छेदन के लिए, चरण 1 में वर्णित के रूप में ५०-१०० prepupae एकत्रित करें और उंहें 25 डिग्री सेल्सियस पर ४० h के लिए आयु ।
  2. प्लास्टिक १५० µ एल आरएनए अलगाव समाधान के एक RNase मुक्त १.५-एमएल microcentrifuge ट्यूब में एक २००-µ l प्लास्टिक का उपयोग कर और बर्फ पर ट्यूब जगह है ।
  3. विच्छेदन पैड पर, pupa को 1x पंजाब की बूंदों में से एक में विच्छेदित करने के लिए जगह है । शरीर को स्थिर करने के लिए एक हाथ में संदंश का प्रयोग करें । दूसरे हाथ में संदंश का प्रयोग, धीरे pupa के सबसे पूर्वकाल तिमाही से pupal मामले छील, झिल्ली बोरी कि शरीर के चारों ओर के भीतर सिर को उजागर ।
  4. संदंश का प्रयोग, ध्यान से pupal शरीर के बाकी से सिर काट संदंश का एक सेट के साथ शरीर पकड़ और सिर तेजस्वी गर्दन पर संदंश का एक और सेट के साथ संयुक्त । धीरे संदंश का उपयोग कर एक और 1x पंजाबी छोटी बूंद में सिर हस्तांतरण । पिपेट ऊपर और नीचे सिर (मस्तिष्क, आदि) की सामग्री को साफ करने के लिए एक स्पष्ट झिल्ली है कि विकासशील Drosophila सिर घेर इस्तेमाल प्राप्त करने के लिए
    नोट: पर ४०-५० h APF, एंटीना पूर्वकाल-झिल्ली के अधिकांश खंड से जुड़े हुए हैं । वे विच्छेदन के लिए स्पष्ट हो जाएगा जब सिर की सामग्री pipetting के साथ मंजूरी दे दी है ।
  5. संदंश का उपयोग कर, झिल्ली से pupal एंटीना डिस्कनेक्ट । केवल 3rd खंड घ्राण रिसेप्टर न्यूरॉन्स घर होगा के रूप में 3rd खंड से संदंश का उपयोग कर, सेगमेंटिक संयुक्त पर टुकड़ा करने के लिए एंटीना के 2nd खंड डिस्कनेक्ट.
  6. एक 20-µ एल पिपेट का प्रयोग धीरे आरएनए अलगाव समाधान एजेंट में विच्छेदित ऊतक हस्तांतरण करने के लिए । pipetting द्वारा स्थानांतरित तरल की मात्रा के रूप में छोटी से कम संभव के रूप में एक राशि । जब तक सभी प्यूपा को विच्छेदित किया गया है दोहराएँ ।
  7. वयस्क antennal विच्छेदन के लिए, लगभग ५० वयस्कों और उंहें एक सप्ताह के बाद eclosion के लिए उंर इकट्ठा ।
    नोट: घ्राण रिसेप्टर जीन की अभिव्यक्ति और अन्य जीन पीक एक सप्ताह के बाद eclosion. वयस्कों के लिए कम बहुतायत टेप के साथ जैविक रूप से प्रासंगिक जीन सुनिश्चित करने के लिए एक सप्ताह के लिए वृद्ध कर रहे है पता लगाने सीमा से ऊपर उठकर ।
  8. आरएनए निकालने के लिए, काटना मक्खियों जबकि वे अभी भी एक सह2 पैड पर जीवित हैं । RNase अवरोधकों के साथ सह2 पैड समझो । फोकल इमेजिंग के लिए, 1x पंजाब या पंजाब + ०.२% ट्राइटन में एक विच्छेदन पैड पर मक्खियों काटना ।
  9. सबसे पहले, विच्छेदन गुंजाइश के तहत सह2 स्टेशन पैड पर सोने के लिए वयस्कों डाल दिया । सह2 स्टेशन पैड पर, एक हाथ में संदंश का उपयोग करने के लिए शरीर को स्थिर, दूसरे हाथ में संदंश का उपयोग करने के लिए धीरे से खींच/
  10. एंटीना सीधे तरल में जगह करने के लिए संदंश का उपयोग कर, एक आरएनए अलगाव समाधान में ऐन्टेना स्थानांतरण. सभी वयस्कों को विच्छेदित किया गया है जब तक दोहराएँ ।
    नोट: सुनिश्चित करें कि एंटीना आरएनए अलगाव समाधान में डूबे हुए हैं. एंटीना ट्यूब के पक्ष पर अटक हो सकता है. इस आरएनए की एक वृद्धि की गिरावट का कारण होगा, आरएनए गुणवत्ता और मात्रा को कम करने.
  11. सीधे आरएनए निष्कर्षण करने के लिए आगे बढ़ना या लंबी अवधि के भंडारण के लिए-८० डिग्री सेल्सियस पर ट्यूब जगह है ।

5. विच्छेदित ऊतकों से आरएनए अलगाव

  1. -८० ° c भंडारण से सभी नमूनों को हटा दें और उन्हें बर्फ पर गल.
  2. संक्षेप में स्पिन (5-6 एस, ~ ६,००० एक्स जी) प्रत्येक नमूना ट्यूब के तल पर सामग्री इकट्ठा करने के लिए ।
  3. एक autoclaved प्लास्टिक मूसल और एक बिजली के लिए एक मोटर का उपयोग कर नमूना पीस 10 बर्फ पर एस ।
  4. दोहराएँ चरण ५.२ और ५.३ 4.
  5. आरएनए निष्कर्षण व्यावसायिक रूप से उपलब्ध किट का उपयोग कर और एक इष्टतम उपज के लिए निर्माता के प्रोटोकॉल का पालन करते हैं ।
  6. प्रदर्शन qRT-पीसीआर वाणिज्यिक उपलब्ध एजेंट और ब्याज की जीन के खिलाफ विशिष्ट प्राइमरों का उपयोग कर और निर्माता के प्रोटोकॉल का पालन ।
    1. निम्नलिखित स्थितियों का उपयोग करके सभी पीसीआर प्रतिक्रियाओं को पूरा करें: ९५ ° c विकार 10 के लिए ९५ ° c के ४० चक्र के बाद मिनट के लिए 15 एस, ५५ ° c 30 s के लिए, और ६० ° c 30 s के लिए
      नोट: डुबकी और डीपीआर जीन के लिए प्राइमर जोड़े 1 तालिकामें सूचीबद्ध हैं, और घ्राण रिसेप्टर जीन के लिए प्राइमरों Hueston CE एट अल में सूचीबद्ध हैं । 8.

6. Pupal Antennal डिस्क्स का निर्धारण और Immunohistochemistry के लिए एंटीना

नोट: 10-20 व्यक्तियों से बैचों में ऊतकों को ठीक करने के लिए सुनिश्चित करें कि ऊतकों को समय की एक ही राशि के लिए तय कर रहे हैं. समय के नमूनों PBT (डिटर्जेंट के साथ पंजाब) में रहने की मात्रा को कम करने के लिए उंहें एक निर्धारण करने के लिए स्थानांतरित करने के लिए ऊतकों की अखंडता को अधिकतम करने से पहले ।

  1. ऊतक अखंडता बनाए रखने के लिए बर्फ पर ०.२% PBT के २०० µ एल युक्त एक २००-µ एल पीसीआर ट्यूब में विच्छेदित antennal डिस्क या pupal एंटेना ले लीजिए, और २००-µ एल पीसीआर ट्यूब की दीवार के लिए चिपके से नमूने से बचने के लिए जो एक अधूरा निर्धारण करने के लिए नेतृत्व करेंगे ।
    नोट: Pupal एंटीना और antennal डिस्क के रूप में वे काफी पारदर्शी हैं देखने के लिए मुश्किल हो सकता है. ऊतक के किसी भी नुकसान को रोकने के लिए सभी धुलाई चरणों के लिए एक विच्छेदन गुंजाइश का उपयोग करने के लिए सलाह दी जाती है । वैकल्पिक रूप से, ९६-अच्छी तरह से Terasaki प्लेटें निर्धारण और दाग सबसे अच्छा ऊतक ट्रैक करने के लिए इस्तेमाल किया जा सकता है ।
  2. प्यूपा से विच्छेदित antennal डिस्क और antennal नमूनों को लगभग २०० µ एल में 4% पीएफए (Paraformaldehyde) के कमरे के तापमान पर 30 मिनट के लिए ठीक करें । इस और बाद के चरणों के लिए, एक nutator पर नमूनों के साथ ट्यूबों रखने के लिए ठीक से समाधान में नमूने मिश्रण । ६.७ कदम के लिए प्रगति ।
  3. वयस्क एंटीना के लिए, काटना पूरे सिर पहले और यह लगभग २०० µ l में 4% पीएफए (paraformaldehyde) के लिए 1 ज कमरे के तापमान पर ठीक ।
  4. 10 मिनट प्रत्येक के लिए ०.२% PBT के २०० µ एल के साथ 3x धो लें । nutator पर नमूनों को मशीन के दौरान रखें ।
  5. स्थिर प्रमुखों से दूसरे antennal खंड के एक महीन विच्छेदन के लिए विच्छेदन माइक्रोस्कोप पर वापस जाएं । सिर को स्थिर करने के लिए संदंश का उपयोग करना, धीरे दूसरे से तीसरे antennal खंड बाहर खींच/
  6. 4% पीएफए (paraformaldehyde) के लगभग २०० µ l में विच्छेदित तीसरे antennal खंडों को स्थानांतरित करें और उन्हें कमरे के तापमान पर 30 मिनट के लिए ठीक करें ।
  7. 10 मिनट प्रत्येक के लिए ०.२% PBT के २०० µ एल के साथ 3x धो लें । nutator पर नमूनों को मशीन के दौरान रखें ।
  8. 4 डिग्री सेल्सियस पर नमूनों की दुकान या पूरे माउंट immunohistochemistry के साथ सीधे जारी है ।
    नोट: एंटीबॉडी उपयोग किया जा रहा है जब धुंधला की दक्षता बदल सकता है । इस विधि कम प्रचुर मात्रा में प्रोटीन टैग या कमजोर एंटीबॉडी के लिए उपयुक्त होना चाहिए । हालांकि, समय पर, यह प्रोटोकॉल का एक अनुकूलन की आवश्यकता हो सकती है (या तो पहचान या निर्धारण की राशि या निर्धारण के समय) ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

विदारक विकासशील घ्राण ऊतक के लिए इस्तेमाल किया जा सकता है आरएनए निष्कर्षण के बाद आरटी-पीसीआर जीन अभिव्यक्ति का आकलन करने के लिए या immunohistochemistry प्रोटोकॉल के माध्यम से अपनी अभिव्यक्ति पैटर्न निर्धारित करने के लिए लिया जा सकता है, और के जीन के उप सेलुलर स्थानीयकरण ब्याज. इस अनुभाग में, हम या तो प्रोटोकॉल से प्रतिनिधि परिणाम प्रस्तुत करते हैं । चित्रा 1 प्रतिनिधि मात्रात्मक आर सी-सेल सतह रिसेप्टर और जंगली प्रकार के वयस्क एंटीना में घ्राण रिसेप्टर जीन की प्रतिलेखन पीसीआर दिखा रहा है. चित्रा 2 6-8 एच और 12 एच APF antennal डिस्क पर दाग से पता चलता है आरएन-EGFP ट्रांसजेनिक मक्खियों का उपयोग विरोधी GFP (1:1000) और विरोधी लामिन एंटीबॉडी (1:100) (चित्रा 2 और २ बी) । आरएन-EGFP जल्दी pupal चरणों के दौरान antennal डिस्क के भीतर विशेष क्षेत्रों लेबल । हम यह भी दिखाते हैं ४० ज APF pupal antennal विरोधी GFP एंटीबॉडी के दाग Or67d -GAL4 यूएएस-CD8GFP ट्रांसजेनिक मक्खियों, और वयस्क antennal विरोधी elav (1:100) एंटीबॉडी के दाग ORNs (चित्रा 2) । अन्य उदाहरणों में साहित्य,,,१०का भी पाया जा सकता है.

Figure 1
चित्रा 1 . मात्रात्मक आरटी-जंगली से पीसीआर-प्रकार वयस्क antennal आरएनए नमूने अलग जीन के लिए । इन पैनलों मात्रात्मक आरटी के लिए-पीसीआर परिणाम दिखाने के (एक) डुबकी अल्फा, डुबकी-ईटीए, dpr5, dpr8, kug, beatIIIb (प्राइमर जोड़े के लिए 1 टेबलदेखें), और () घ्राण और ionotropic रिसेप्टर (या Ir) वयस्क से जीन antennal आरएनए के नमूने लिए । त्रुटि पट्टियां माध्य (SEM) का एक मानक त्रुटि दिखाएँ । या/Ir जीन कम बहुतायत RNAs है कि अभी भी qRT द्वारा पता लगाया जा सकता है-पीसीआर । प्रत्येक जीन की अभिव्यक्ति का तपसिल में विश्लेषण किया गया. सीटी मूल्यों प्रत्येक जीन के लिए बनाया मानक curves पर आधारित प्रत्येक जीन के लिए कमजोर पड़ने कारकों की गणना करने के लिए इस्तेमाल किया गया । कमजोर पड़ने कारकों तो सभी के रूप में मापा8से पहले वर्णित जीन की औसत अभिव्यक्ति के लिए प्रत्येक जीन के लिए सामान्यीकृत थे । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2 . Immunohistochemistry घ्राण ऊतकों के विकास पर अलग एंटीबॉडी का उपयोग कर । ये पैनलों एंटी-GFP (ग्रीन) और एंटी-लामिन (रेड) एंटीबॉडी पर दाग (A) 6 h APF pupal antennal डिस्क्स और (B) 12 h APF pupal antennal डिस्क्स दिखाते हैं । () इस पैनल से एक ४० एच APF एंटीना से पता चलता है Or67d GAL4 यूएएस-CD8GFP transgenics दाग के साथ खरगोश विरोधी GFP (हरा) एंटीबॉडी. () इस पैनल विरोधी CD2 एंटीबॉडी, जो लेबल Or47b-CD2 सकारात्मक ORNs (रानी) के साथ वयस्क एंटीना दाग से पता चलता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

फॉरवर्ड प्राइमर रिवर्स प्राइमर लंबाई
CGGAGAGGAGGTTATGAGCA GGAAGTGCACAACTAGCGTT १४३
CGCGAATCGTTGTGTCAGTA TGTCGATAGCGTGAACCTGA १२९
AGGAGTGGACGTTGAGTTACA CAATCATGTCCTCGTGACCG १४६
TAGAGTCCGAGCAGCAGATG GTCAGAATTCGAGTTGTCCGC १०४
GGCGCTAAGTAGCAGGACG GGCCAAGTCTGTTTGTGAGG २१५
TAAGACCCTAGCGCCCTCTT AGGGAGATGCGCTTTGAGAC १२९

तालिका 1. qRT-पीसीआर में प्रयुक्त पीसीआर प्राइमरों की सूची ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

इस प्रोटोकॉल Drosophila घ्राण ऊतक के विकास में ऑपरेटिंग आनुवंशिक और transcriptional कार्यक्रमों की पहचान करने में रुचि प्रयोगशालाओं के लिए एक उपयोगी संसाधन है, साथ ही Drosophila भर में इन कार्यक्रमों का एक तुलनात्मक विश्लेषण प्रजातियों. यह विशेष रूप से उपयोगी है, तो सिस्टम स्तर के विभिंन विकास के चरणों से transcriptional प्रोफाइल भविष्य के अध्ययन के लिए एक किताब के रूप में की जरूरत है । प्रोटोकॉल यहां वर्णित कैसे मंच और Drosophila से घ्राण ऊतक विकासशील को अलग करने के लिए पूर्व से घ्राण प्रणाली के विकास के चार प्रमुख चरणों से नमूने प्राप्त करने के लिए टर्मिनल विभेदन पैटर्न, में इस्तेमाल किया जा करने के लिए प्रदर्शित करता है आणविक और प्रतिरक्षा-ऊतकवैज्ञानिक अध्ययनविभिंन pupal चरणों में विच्छेदित Drosophila antennal डिस्क्स और एंटीना को आरएनए-seq द्वारा सिस्टंस स्तर पर घ्राण प्रणाली के विकास के दौरान या मात्रात्मक आरटी-पीसीआर द्वारा व्यक्तिगत जीनों के स्तर पर जीन एक्सप्रेशन प्रोफाइल की पहचान करने के लिए इस्तेमाल किया जा सकता है । नमूने भी immunohistochemistry के लिए इस्तेमाल किया जा सकता है और सीटू संकरण में vivo ऊतक विशिष्ट जीन अभिव्यक्ति के पैटर्न की पहचान । इस प्रोटोकॉल का एक अतिरिक्त लाभ यह है कि विच्छेदित नमूनों आगे असंबद्ध मानक तरीकों का उपयोग कर सकते हैं, और FAC-एक शुद्ध सेलुलर जनसंख्या प्राप्त करने के लिए हल (या एकल कोशिकाओं) कोशिका प्रकार विशिष्ट आणविक विश्लेषण, जैसे मात्रात्मक के लिए आरटी-पीसीआर या RNAseq ।

हालांकि प्रोटोकॉल antennal डिस्क के विच्छेदों को दर्शाता है और pupal से एंटीना (0 एच/prepupa, 8 एच, और ४० एच APF) और वयस्क चरणों में, यह अंय pupal समय अंक के लिए अनुकूलित किया जा सकता है । यह भी उल्लेख योग्य है कि इन विच्छेदों सीखने समय और अभ्यास लेता है । एक विशेषज्ञ को ५० नमूनों को एक घंटे काटना करने में सक्षम होना चाहिए । यह प्यूपा नहीं ओवरआल करने के लिए महत्वपूर्ण है । इसलिए, विच्छेदन शुरू करने से पहले एक घंटा, सुनिश्चित करें कि कोई प्यूपा वांछित उंर से अधिक पुराने हैं । विच्छेदन सीखने में समय लग सकता है, इसलिए प्रयोगों को शुरू करने से पूर्व प्रत्येक चरण के लिए अभ्यास की अवधि आवश्यक है । रूपात्मक परिवर्तन के कारण 9-12 h APF से विच्छेदन अधिक कठिन हो जाता है । यह उंर से प्यूपा तरह जब prepupae संग्रह (शरीर के रंग से, गहरे रंग के साथ पुराने जा रहा है) संभव है । शुरू में छंटाई prepupae उंर के क्रम में विच्छेदन के लिए अनुमति देता है के लिए उंर बढ़ने को रोकने के ।

ऊपर वर्णित प्रोटोकॉल अंय Drosophila प्रजातियों के लिए लागू किया जा सकता है । अंय प्रजातियों के pupal विच्छेदन के लिए समय दोनों पर आधारित किया जा सकता है एक दिया प्रजातियों के pupal विकास के अनुपात में 25 डिग्री सेल्सियस पर D. melanogaster और के तुलनात्मक टिप्पणियों पर एंटीना/antennal डिस्क आकृति विज्ञान के दौरान, एक रूपात्मक विचार करने के लिए दी गई प्राथमिकता यथासंभव समान होना चाहिए । Drosophila melanogasterके लिए, pupal चरण में लगभग 4 दिन लगते हैं । d. sechellia और d. erecta pupal विकासात्मक स्टैगिंग d. melanogaster के समान है; हालांकि, D. virilis pupal विकास 1.3 x अब11,12है । जब अन्य प्रजातियों के विच्छेदन के लिए तैयार कर रहे हैं, मचान pupal अवधि के दोनों समय और चरण विशेष एंटीना के तुलनात्मक प्रेक्षण/antennal डिस्क आकृति विज्ञान, रूपात्मक समानता सर्वोच्च प्राथमिकता जा रहा है के साथ आधारित होना चाहिए । सबसे पहले, आप में रुचि रखते हैं प्रजातियों के लिए इष्टतम हैंडलिंग तापमान की पहचान कई प्रजातियों 25 डिग्री सेल्सियस पर अच्छी तरह से हो जाना, लेकिन रखरखाव की स्थिति पर विस्तृत जानकारी यूसी सैन डिएगो Drosophila प्रजातियों स्टॉक सेंटर से प्राप्त किया जा सकता है ।

प्रोटोकॉल में सबसे महत्वपूर्ण कदम विभिन्न प्रजातियों से पर्याप्त संख्या में ब्याज की ऊतक के सही मचान और उचित विच्छेदन कर रहे हैं । एक बार इन जगह में हैं, प्रोटोकॉल ऐसे विश्लेषण के लिए ऊतक संग्रह के एक कुशल विधि प्रदान करता है और व्यावहारिक रूप से किसी भी Drosophila प्रजातियों में pupal चरणों के दौरान किसी भी विकासशील काल्पनिक डिस्क ऊतक के लिए अनुकूलित किया जा सकता है ।

इस प्रोटोकॉल की एक सीमा है कि यह कक्ष प्रकार-विशिष्ट नमूने प्रदान नहीं करता है । सेलुलर समारोह और आकृति विज्ञान की एक अधिक विस्तृत समझ की आवश्यकता है सेल प्रकार के एक सिस्टम स्तर पर प्रतिलेखन के विशिष्ट रूपरेखा, जैसे मात्रात्मक आरटी-पीसीआर या immunohistochemistry के रूप में मानक आणविक प्रक्रियाओं के अलावा । कक्ष प्रकार-विशिष्ट profiling मुश्किल हो गया है, विशेष रूप से गैर-melanogaster प्रजातियों में सेल प्रकार विशिष्ट रिपोर्टर transgenics की कमी को देखते हुए । सेलुलर रूपरेखा, transgenics में मौजूदा अग्रिमों के साथ, और गैरmelanogaster प्रजातियों में CRISPR-Cas9 मध्यस्थता जीनोम संपादन, यह अब संभव है लेबल और प्रोफ़ाइल प्रतिलेखन13के लिए ब्याज की एकल कोशिकाओं तरह ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

इस अध्ययन के लिए राष्ट्रीय विज्ञान फाउंडेशन से अनुदान द्वारा समर्थित किया गया Pelin C. Volkan (देब-१४५७६९०) ।

Materials

Name Company Catalog Number Comments
10X Phosphate-buffered Saline Gibco 70011-044 Dilute to 1X in RNase free water
CO2 tank Air Gas CD R200
Two sharp forceps (Dumont #55) Fine Science Tools 11255-20
Trizol Invitrogen 15596-026 RNA isolation solutions
Dissecting Microscope
Small bucket with ice
P20 and P200 micropipettes and tips
1.7 mL Microfuge tubes Purchase nuclease free for best results
0.2 mL PCR tubes
Paraformaldehyde powder Polysciences 380
10% Triton X-100 Teknova T1105 Dilute to 0.2% v/v in 1X PBS
2" petri dishes
55mm filter paper Whatman 1001-055 Wet with water and place in a petri dish to keep pupae moist
25 C incubator
deionized H2O Purchase nuclease free or treat with DEPC
Sylgard 184 Silicone Elastomer Kit Dow Corning to be used for making dissection pads from Terizaki plate covers.
MicroWell Mini Trays with lids Nunc 438733 Lids can be used to make silicone dissection pads
Rabbit anti-GFP antibody MBL international corpor PM005 primary antibody
Mouse anti RAT CD2 AbD seroTec MCA154RHDL primary antibody
ADL195 (anti lamin, mouse) Dev studies hydoma ban ADL195-s primary antibody
Alexa Fluor® 488 goat anti-rabbit IgG (H+L) invitrogen A11008 Secondary antibody
Cy3 Goat Anti-Mouse IgG Jackson ImmunoResearch 115-166-003 Secondary antibody
Triton X-100, Protein Grade Detergent, 10% Solution, Sterile-Filtered CALBIOCHEM 648463 detergent
Lab Rotator Thermo scientific Rotator
Nuclease Free Water Growcells.com NUPW-0125 Water
Light-Duty Tissue Wipers VWR 82003-822 For cleaning dissection supplies
Superscript II invitrogen 18064014 Reverse Transcriptase 
QIAshredder (50) RNA extraction QIAGEN 79654
Oligo(dT)12-18 Primer RT life technologies 18418012
RNeasy MinElute Cleanup Kit (50) RNA extraction QIAGEN 74204
FASTSTART UNIV SG MASTER (5 ML)(500 RXN) qPCR Roche 04913850001
FASTSTART ESSENTIAL GREEN DNA MASTER  qPCR Roche 06402712001
LIGHTCYCLER 480 - MULTIWELL PLATE 96 qPCR Roche 04729692001
NEBNext High-Fidelity 2X PCR Master Mix qPCR NEB M0541S

DOWNLOAD MATERIALS LIST

References

  1. Barish, S., Volkan, P. C. Mechanisms of olfactory receptor neuron specification in Drosophila. Wiley Interdisciplinary Reviews. Developmental Biology. 4, (6), 609-621 (2015).
  2. Pan, J. W., Volkan, P. C. Mechanisms of development and evolution of the insect olfactory system. Cell and Developmental Biology. 2, 130 (2013).
  3. Ramdya, P., Benton, R. Evolving olfactory systems on the fly. Trends in Genetics. 26, (7), 307-316 (2010).
  4. Bellen, H. J., Tong, C., Tsuda, H. 100 years of Drosophila research and its impact on vertebrate neuroscience: a history lesson for the future. Nature Reviews Neuroscience. 11, (7), 514-522 (2010).
  5. Knecht, Z. A., et al. Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila. eLife. 5, 44-60 (2016).
  6. Enjin, A., et al. Humidity sensing in Drosophila. Current Biology. 26, (10), 1352-1358 (2016).
  7. Li, Q., Barish, S., Okuwa, S., Volkan, P. C. Examination of endogenous rotund expression and function in developing Drosophila. olfactory system using CRISPR-Cas9-mediated protein tagging. G3: Genes|Genomes|Genetics. 5, (12), 2809-2816 (2015).
  8. Hueston, C. E., et al. Chromatin modulatory proteins and olfactory receptor signaling in the refinement and maintenance of fruitless expression in olfactory receptor neurons. PLoS Biology. 14, (4), 1002443 (2016).
  9. Li, Q., et al. Combinatorial rules of precursor specification underlying olfactory neuron diversity. Current Biology. 23, (24), 2481-2490 (2013).
  10. Li, Q., et al. A functionally conserved gene regulatory network module governing olfactory neuron diversity. PLoS Genetics. 12, (1), 1005780 (2016).
  11. Pan, J. W., et al. Patterns of transcriptional parallelism and variation in the developing olfactory system of Drosophila species. Scientific Reports. 7, (1), 8804 (2017).
  12. Pan, J. W., et al. Comparative analysis of behavioral and transcriptional variation underlying CO2 sensory neuron function and development in Drosophila. Fly. 11, (4), 239-252 (2017).
  13. Stern, D. L., et al. Genetic and transgenic reagents for Drosophila simulans, D. mauritiana, D. yakuba, D. santomea, and D. virilis. G3: Genes|Genomes|Genetics. 7, (4), 1339-1347 (2017).
<em>Drosophila</em> में आणविक और Immunohistochemical विश्लेषण के लिए परिधीय घ्राण ऊतक विकसित करने की तैयारी
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).More

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter