Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Preparación de desarrollar tejido olfatorio periférico para Molecular y el análisis de Immunohistochemical en Drosophila

doi: 10.3791/57716 Published: June 13, 2018

Summary

Aquí, presentamos un protocolo para la etapa y diseccionar desarrollar tejido olfativo de especies de Drosophila . El tejido disecado más adelante puede ser utilizado para análisis moleculares como RT-PCR (reacción en cadena de polimerasa de transcripción inversa) o RNA, secuenciación (RNAseq), así como análisis en vivo como inmunohistoquímica o en situ hibridación.

Abstract

El sistema olfativo de la Drosophila es un sistema ampliamente utilizado en Neurobiología del desarrollo, neurociencia de sistemas, así como Neurofisiología, comportamiento y evolución conductual. Tejidos olfativos de Drosophila casa las neuronas receptoras olfatorias (ORNs) que detectan señales químicas volátiles además de hidro y termo-sensorial neuronas. En este protocolo, se describe la disección de desarrollar tejido olfatorio periférico de la especie Drosophila adulta. En primer lugar describimos cómo la etapa y edad de las larvas de Drosophila , seguidas por la disección del disco antenal de primeras etapas pupas, seguidas de la disección de las antenas de adultos y etapas de pupal mediados. También mostramos los métodos donde se pueden utilizar preparados en técnicas moleculares, como la extracción de RNA para qRT-PCR, RNAseq o inmunohistoquímica. Estos métodos pueden aplicarse también a otras especies de Drosophila después de tiempos de desarrollo pupal específicos se determinan, y etapas respectivas se calculan para el envejecimiento adecuado.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

El sistema olfativo de la Drosophila es un sistema ampliamente utilizado en Neurobiología del desarrollo, neurociencia de sistemas, así como Neurofisiología, estudios de comportamiento y evolución conductual1,2,3, 4. Las neuronas receptoras olfatorias (ORNs) que detectan señales químicas volátiles además de hidro y termo-sensorial neuronas1,5,6la casa tejidos olfativos de Drosophila . El objetivo general de este manuscrito es demostrar cómo la etapa y diseccionar el desarrollo pupal y adulto tejido olfativo en especies de Drosophila . El fundamento de esta técnica es generar muestras de diferentes etapas de pupal para análisis moleculares y del desarrollo del sistema olfativo periférico, tales como RNAseq y RT-PCR cuantitativa, además en vivo tejido etiquetado técnicas . Esta técnica puede ser especialmente útil para identificar la dinámica de perfiles transcripcionales en el sistema olfatorio adulto en desarrollo de no -melanogaster Drosophila especie, que no tiene todos los reactivos transgénicos para tipo celular específico etiquetado y análisis. En este manuscrito, demostramos cómo diseccionar discos antenales y antenas de especies de Drosophila pupas y adulto. En primer lugar, mostramos cómo identificar Drosophila 0 h de formación del pupario (APF y prepupas y pupas blanco) para la puesta en escena del desarrollo y el envejecimiento propios de cada especie. A continuación, te mostramos cómo diseccionar discos antenales y el tercer segmento antenal; en concreto, cómo disociar del disco ojo y segundo segmento antenal para la pureza del tejido necesaria para RNAseq o RT-PCR. Las etapas en D. melanogaster se describe en este protocolo aproximadamente corresponden al disco antenal previamente modelado (prepupas), la selección de precursores de la antenal de disco (8 h APF), el inicio de la diferenciación terminal de ORNs (40 h APF), y antena de adultos. Finalmente, damos ejemplos de una RT-PCR cuantitativa de antenas adulto aislados utilizando el método y para en vivo inmunohistoquímica. Este método puede utilizarse para generar muestras para un análisis de ARN/ADN y de inmunohistoquímica en el desarrollo de tejidos periféricos olfativos de diferentes especies de Drosophila .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

El siguiente protocolo es consistente con los lineamientos de ética establecidos por el Comité de ética de investigación de Universidad de Duke.

1. tejido preparación y puesta en escena del desarrollo de Drosophila melanogaster Pupa

  1. En primer lugar, identificar cuántas moscas será necesarios para la disección. De RT-PCR y RNAseq, recoger 100-200 discos antenales y antenas de individuos que son necesarios en prepupal, 8 h APF, 40 h de la APF y adulto. Para immunohistochemistry, diseccionar a individual de 10-20.
  2. Limpiar todos los materiales, incluyendo pastillas de disección y pinzas, el uso de toallitas con el 70% EtOH. Si el material disecado es utilizado para las extracciones de RNA, limpiar todo con Neutralizadores de RNasa y hacer todas las soluciones utilizando ya sea libre de nucleasas o dietil pirocarbonato (DEPC) agua tratada.
    Nota: Este protocolo usa cojines de disección del silicón en vez del vidrio para las disecciones. Almohadillas de silicona son amigables a ultra finas pinzas y promoción disecciones rápidas y de alta calidad.
  3. Recoger la pupa a la 0 h etapa prepupal/APF.
    1. Para asegurar la puesta en escena más preciso, controlar las larvas en intervalos de 1 h 30min.
      Nota: Es probable que se pupan errante larvas de tercer estadio en una botella medianamente concurrida dentro de unas horas.
    2. Una vez que las larvas se convierten inmóviles y están rodeadas por un muy ligero (casi blanco) color envoltura pupal, transferirlos a un pequeño 2 - placa de Petri con un papel de filtro humedecido.
    3. Continuar durante 1-2 h, ocasionalmente monitoreo, identificación y transferencia de prepupas.
      Nota: Alternativamente, claro una botella de pupas de todos y permitir que las larvas para 2 h. Pupas de todos recogieron después de 2 h en un rango APF 0 - 2 h.
  4. Inmediatamente hacia al paso 3.1 disecar el disco prepupal antenal para la etapa APF 0 h. Si la prepupa tiene que envejecer, reunirlas en un plato, cubrir el plato y una película de parafina en los bordes para inhibir la sequedad y la placa de Petri a 25 ° C.
    Nota: Las pupas pueden ahora ser de años a la eclosión.
  5. Para pupas recolectadas en una gama de 2 h, edad prepupas por 2 h menos de la edad deseada para asegurarse de que las pupas no excedente.
  6. Uso de fórceps ultra fina (Dumont 55) como el tejido es muy pequeño y frágil.

2. tejido preparación y puesta en escena del desarrollo de la Pupa de otras especies de Drosophila

  1. Para determinar la longitud del desarrollo pupal en otras especies de Drosophila , colocar las muestras a la temperatura óptima, registrar las fechas cuando se observan prepupas, ordenarlos en un vial nuevo y anote el número de días de prepupa a la edad adulta.
  2. Registro de la relación de tiempo para el desarrollo pupal para especies no -melanogaster y melanogaster. La relación entre el tiempo de desarrollo por el número de horas utilizado para escenificando melanogaster para obtener el número de horas a la edad de las especies no -melanogaster se multiplican.

3. disección del disco antenal pupas de D. melanogaster

Nota: Todos los tiempos de envejecimiento y protocolos de disección se describen para melanogaster del Drosophila. Para todas las otras especies, una modificación del Protocolo de crianza basado en puntos de tiempo específicos de desarrollo será necesaria, como se describe anteriormente.

  1. Para disecciones de pupa disco antenal recopilar 50-100 0 - h 2 o 6-8 h pupas vieja con una espátula y colocarlas sobre una almohadilla de disección.
  2. Pipetear 150 μL de solución de aislamiento de RNA en una Rnasa gratis microcentrífuga de 1,5 mL con una pipeta de 200 μL del tubo y coloque el tubo en hielo.
  3. Diseccionar las pupas en 150-200 μL de PBS 1 x (tampón fosfato salino, libre de nucleasas). Coloque varias gotas de PBS (150-200 μL por gota) sobre la almohadilla de la disección.
  4. En la plataforma de la disección, coloque 0 - h 2 o 6-8 h de pupas (una pupa por gota) para ser disecado en uno de 1 x gotas de PBS. Use pinzas en una mano para estabilizar el cuerpo.
  5. El 0 - 2 h de pupas, usando pinzas en la otra mano, sostenga a la parte más anterior (los ganchos de la boca) de la prepupa y tire de ella para exponer el cerebro y los discos imaginales Unidos a la anterior envoltura pupal.
  6. Para las pupas APF de 8 h, primero suavemente Retire la envoltura pupal del casco más anterior de la pupa, exponiendo la cabeza dentro del saco de membrana que rodea el cuerpo.
    Nota: El cuerpo, en esta etapa, se ve como una degeneración de la larva.
  7. Retire el cabezal en el empalme del cuello.
    Nota: Esto asegura que los discos antenales no se pierden, que en esta etapa están conectados principalmente a los lóbulos ópticos del cerebro.
  8. Transferir el tejido con el cerebro y los discos imaginales a otra 1 x gota de PBS con pinzas o una pipeta de 20 μl.
  9. Identificar el disco antenal ojo conectado con el cerebro en los lóbulos ópticos. Con unas pinzas, desconecte el disco ojo antenal de cerebro y de la envoltura pupal. Transferirlo a un nuevo 1 x gota de PBS con pinzas o una pipeta de 20 μl.
    Nota: El disco ojo antenal prepupal es un tejido plano. Sin embargo, por las pupas de 8 h, los discos de ojo se rotan ahuecando los discos antenales, que se encuentra anterior del cerebro central.
  10. Con unas pinzas, cortar el tejido en el sitio de conexión entre el ojo y el disco antenal. Utilice una pipeta de 20 μl para transferir suavemente el tejido disecado en el reactivo de solución de aislamiento de RNA. Minimizar la cantidad de líquido transferido transfiriendo una cantidad tan pequeña como sea posible.
  11. Repita hasta que todos los pupas han sido disecados.

4. disección de D. melanogaster mediados-pupa y adulto de antenas

Nota: Por 40 h de la APF, la mayoría de la metamorfosis es completa, y las estructuras adultas se están convirtiendo en aparente, pero son blanco y anodino. En este momento del desarrollo, la antena adultos ha tomado su forma final pero sigue siendo transparente y la mayoría de los receptores olfativos, excepto unos pocos, no ha empezado la expresión.

  1. Para disecciones antenales pupas, recoger prepupas de 50-100 como se describe en el paso 1 y edad por 40 h a 25 ° C.
  2. Pipetear 150 μL de solución de aislamiento de RNA en una microcentrífuga de 1,5 mL libre de Rnasa utilizando una pipeta de 200 μL del tubo y coloque el tubo en hielo.
  3. En la plataforma de la disección, coloque la pupa para ser disecado en uno de 1 x gotas de PBS. Use pinzas en una mano para estabilizar el cuerpo. Con pinzas en la otra mano, suavemente Retire la envoltura pupal del casco más anterior de la pupa, exponiendo la cabeza dentro del saco de membrana que rodea el cuerpo.
  4. Con unas pinzas, con cuidado corte la cabeza del resto del cuerpo pupa sosteniendo el cuerpo con un sistema de pinzas y estafando a la cabeza en el cuello con otro conjunto de pinzas. Transferir suavemente la cabeza en la otra 1 x gota de PBS con unas pinzas. Pipetee hacia arriba y hacia abajo para limpiar el contenido de la cabeza (el cerebro, etc.) para obtener una membrana transparente que rodea la cabeza de Drosophila en vías de desarrollo.
    Nota: En el 40-50 h APF, las antenas están conectadas a la parte más anterior de la membrana. Acontecerán aparentes para la disección cuando se borra el contenido de la cabeza con el pipeteo.
  5. Con unas pinzas, desconecte las antenas pupas de la membrana. Desconecte el segmento 2nd de la antena de 3rd con unas pinzas cortar por la articulación segmentaria, como sólo el segmento de 3rd albergará las neuronas receptoras olfatorias.
  6. Utilice una pipeta de 20 μl para transferir suavemente el tejido disecado en el reactivo de solución de aislamiento de RNA. Minimizar la cantidad de líquido transferido transfiriendo una cantidad tan pequeña como sea posible. Repita hasta que todos los pupas han sido disecados.
  7. Para adultos disecciones antenales, recoger a aproximadamente 50 adultos y edad para una eclosión después de la semana.
    Nota: La expresión de genes olfativos del receptor y otros genes máximo una semana después de la eclosión. Los adultos son mayores durante una semana para genes biológicamente relevantes con las transcripciones de baja abundancia a elevarse por encima del umbral de detección.
  8. Para las extracciones de RNA, diseccionar moscas mientras que todavía están vivos en un cojín de CO2 . Tratar la CO2 almohadilla con inhibidores de la Rnasa. Para la proyección de imagen confocal, diseccionar las moscas en un pad de disección 1 x PBS o PBS + 0,2% Tritón.
  9. En primer lugar, poner los adultos a dormir en el cojín de la estación CO2 en el ámbito de la disección. En la plataforma de estación de CO2 , con unas pinzas en una mano para estabilizar el cuerpo, usar pinzas en la otra mano para suavemente tire/pellizcar hacia fuera el tercer segmento antenal de la segunda.
  10. Transferencia de las antenas en una solución de aislamiento de RNA, con unas pinzas para colocar las antenas directamente en el líquido. Repita hasta que todos los adultos han sido disecados.
    Nota: Asegúrese de que las antenas estén sumergidas en la solución de aislamiento de RNA. Las antenas pueden atascarse en el lado del tubo. Esto causará una mayor degradación del RNA, reducción de la cantidad y calidad de RNA.
  11. Directamente procede a la extracción de RNA o coloque el tubo a-80 ° C para almacenamiento a largo plazo.

5. RNA aislado de los tejidos disecados

  1. Retire todas las muestras desde el almacenaje de-80 ° C y descongelar el hielo.
  2. Girar brevemente (5-6 s, ~ 6.000 x g) cada muestra para recoger el material en la parte inferior del tubo.
  3. Moler cada muestra usando un mortero plástico esterilizado y un motor eléctrico de 10 s en el hielo.
  4. Repita los pasos del 5,2 y 5,3 4.
  5. Realizar la extracción de RNA utilizando kits disponibles en el mercado y siguiendo los protocolos del fabricante para un rendimiento óptimo.
  6. Realizar qRT-PCR utilizando reactivos comercialmente disponibles y cartillas específicas contra los genes de interés y siguiendo los protocolos del fabricante.
    1. Llevar a cabo todas las reacciones de polimerización en cadena usando las siguientes condiciones: desnaturalización de 95 ° C durante 10 min seguida por 40 ciclos de 95 ° C por 15 s, 55 ° C por 30 s y 60 ° C para 30 s.
      Nota: Pares de cartilla para inmersión y dpr los genes aparecen en la tabla 1, y cebadores para los genes de receptores olfativos figuran en CE de Hueston et al. 8.

6. fijación de la pupas discos antenales y antenas para inmunohistoquímica

Nota: Fije los tejidos en lotes de 10-20 personas para garantizar que los tejidos se fijan para la misma cantidad de tiempo. Minimizar la cantidad de tiempo que las muestras permanecen en PBT (PBS con detergente) antes de transferir a un fijador para maximizar la integridad de los tejidos.

  1. Recoge la disecada discos antenales antenas pupas en un tubo PCR de 200 μL que contiene 200 μL de 0.2% PBT en el hielo para mantener la integridad del tejido y para evitar que la muestra se adhiera a la pared de 200 μL PCR tubos o que dará lugar a una fijación incompleta.
    Nota: Discos antenales y antenas pupas pueden ser difíciles de ver ya que son muy translúcidos. Es recomendable usar un alcance de disección de todos los pasos de lavado para evitar cualquier pérdida de tejido. Alternativamente, placas de Terasaki de 96 pocillos pueden ser utilizado para la fijación y tinción para rastrear mejor el tejido.
  2. Fijar el disco antenal disecada y muestras antenales de pupas en aproximadamente 200 μL de 4% PFA (paraformaldehído) durante 30 min a temperatura ambiente. Para este y posteriores pasos, mantenga los tubos con las muestras en un nutator mezclar correctamente las muestras en la solución. Progreso paso 6.7.
  3. Para la antena adultos, disecar la cabeza primero y fijar en aproximadamente 200 μL de 4% PFA (paraformaldehído) por 1 h a temperatura ambiente.
  4. Lavar 3 x con 200 μL de 0.2% PBT durante 10 minutos. Mantener las muestras en el nutator durante la incubación.
  5. Volver al microscopio de disección para una disección más fina del segundo segmento antenal de las cabezas fijas. Usar pinzas para estabilizar la cabeza, suavemente tire/pellizcar hacia fuera el tercer segmento antenal de la segunda.
  6. Transferencia de los segmentos antenales tercer disecados en aproximadamente 200 μL de 4% PFA (paraformaldehído) y fijarlos durante 30 min a temperatura ambiente.
  7. Lavar 3 x con 200 μL de 0.2% PBT durante 10 minutos. Mantener las muestras en el nutator durante la incubación.
  8. Almacenar las muestras a 4 ° C o continuar directamente con todo Monte immunohistochemistry.
    Nota: La eficacia de la coloración puede cambiar cuando se utiliza el anticuerpo. Este método debe ser apropiados para menos etiquetas de proteína abundante o más anticuerpos. Sin embargo, a veces, podría requerir una optimización del Protocolo (la identidad o cantidad del fijador o el tiempo de fijación).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

El desarrollo diseca el tejido olfatorio puede utilizarse para la extracción de RNA seguida por RT-PCR para evaluar expresión génica o puede tomarse a través de protocolos de inmunohistoquímica para determinar su patrón de expresión y la localización subcelular de los genes de interés. En esta sección, presentamos resultados representativos de cada protocolo. La figura 1 es el representante RT-PCR cuantitativa que muestra la transcripción de genes olfativos del receptor y de receptor de superficie celular en salvaje-tipo adultos antenas. La figura 2 muestra la 6-8 h y 12 h APF disco antenal stainings en Rn-EGFP transgénico vuela utilizando anti-GFP (1: 1000) y anticuerpos anti-lamin (1: 100) (figura 2A y 2B). RN-EGFP etiquetas determinadas regiones dentro de la disco antenal durante las primeras etapas de pupas. También mostramos 40 h APF pupa antenal anti-GFP de tinción de anticuerpos de Or67d-GAL4 UAS-CD8GFP moscas transgénicas y adultos anti-elav antenal (1: 100) anticuerpos tinción de ORNs (figura 2). También pueden encontrarse otros ejemplos en la literatura8,7,9,10.

Figure 1
Figura 1 . RT-PCR cuantitativa de tipo salvaje adulto antenal RNA las muestras para los diferentes genes. Estos paneles muestran resultados de RT-PCR cuantitativas para (A) DIP-alfa, DIP-eta dpr5, dpr8, kug, beatIIIb (para la cartilla pares ver tabla 1) y (B) olfativo receptores ionotrópicos (o / Ir) genes de adulto muestras de RNA antenales. Las barras de error muestran un error estándar de la media (SEM). O / Ir genes son RNAs que aún puede ser detectada por qRT-PCR de baja abundancia. La expresión de cada gen se analizó por triplicado. Valores de CT se utilizaron para calcular los factores de dilución para cada gen basado en curvas estándar para cada gen. Los factores de dilución fueron luego normalizados para cada gen a la expresión promedio de todos los genes como se describe antes de8. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 . Immunohistochemistry usando los anticuerpos diferentes en el desarrollo de los tejidos olfatorios. Estos paneles muestran anti-GFP (green) y anti-lamin (rojo) los stainings anticuerpo (A) 6 h APF pupa antenal discos y ()B) 12 h APF pupa antenal los discos. (C) este panel muestra un 40 h APF antena de transgénicos Or67d GAL4 UAS-CD8GFP teñidos con conejo anticuerpos anti-GFP (green). (D) este panel muestra adultos antenas teñidas con anticuerpos anti-CD2, que etiqueta Or47b-CD2 positivos ORNs (magenta). Haga clic aquí para ver una versión más grande de esta figura.

Primer avance Primer revés Longitud
CGGAGAGGAGGTTATGAGCA GGAAGTGCACAACTAGCGTT 143
CGCGAATCGTTGTGTCAGTA TGTCGATAGCGTGAACCTGA 129
AGGAGTGGACGTTGAGTTACA CAATCATGTCCTCGTGACCG 146
TAGAGTCCGAGCAGCAGATG GTCAGAATTCGAGTTGTCCGC 104
GGCGCTAAGTAGCAGGACG GGCCAAGTCTGTTTGTGAGG 215
TAAGACCCTAGCGCCCTCTT AGGGAGATGCGCTTTGAGAC 129

Tabla 1. Lista de los primers PCR utilizado en qRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Este protocolo es un recurso útil para los laboratorios interesados en identificar los programas genéticos y transcripcionales de funcionamiento en el desarrollo de tejido olfativo de la Drosophila , así como un análisis comparativo de estos programas a través de Drosophila especies. Es especialmente útil si se necesitan sistemas nivel transcripcionales perfiles de diferentes etapas de desarrollo como una cartilla para futuros estudios. El protocolo descrito aquí muestra cómo la etapa y aislar a desarrollar tejido olfativo de la Drosophila para obtener muestras de cuatro etapas claves de desarrollo del sistema olfativo de los patrones a diferenciación terminal, para ser utilizado en inmune-histológica y moleculares estudios. Disecado de Drosophila discos antenales y antenas en las diferentes etapas de pupas pueden utilizarse para identificar perfiles de expresión génica durante el desarrollo del sistema olfativo en el nivel de los sistemas por RNA-seq, o a nivel de genes individuales por RT-PCR cuantitativa. Muestras pueden utilizarse también para hibridación immunohistochemistry y en situ para identificar patrones en vivo de la expresión génica específica de tejido. Una ventaja adicional de este protocolo es que las muestras disecadas puede más lejos disociado usando métodos estándar y FAC-ordenados para obtener una población celular purificada (o células) para análisis moleculares del tipo específico de célula, como cuantitativa RT-PCR o RNAseq.

Aunque el protocolo demuestra disecciones de discos antenales y antenas de pupa (en 0 h/prepupa, 8 h y 40 h APF) y fases adultas, puede ser adaptado a otros puntos del tiempo pupa. También vale la pena mencionar que estas disecciones de aprendizaje requiere tiempo y práctica. Un experto debe ser capaz de analizar 50 muestras una hora. Es importante no excedente las pupas. Por lo tanto, una hora antes de comenzar la disección, asegúrese de que no hay pupas son más viejos de la edad deseada. Disecciones pueden tomar tiempo para aprender, para que un período de práctica para cada etapa se requiere antes de comenzar los experimentos. Disecciones se convierten en más difíciles de 9-12 h APF debido a cambios morfológicos. Es posible ordenar pupas por edad al recoger prepupas (por el color de la carrocería, con colores más oscuros, siendo mayores). Clasificación inicialmente prepupas permite la disección en orden de edad para prevenir overaging.

El protocolo descrito anteriormente se puede aplicar a otras especies de Drosophila . La sincronización para las disecciones pupas de otras especies se puede basar tanto en la relación entre el desarrollo pupal de una determinada especie a 25 ° C a la D. melanogaster y en observaciones comparativas de antenas/antenal morfología de disco durante las disecciones, con un prioridad a las consideraciones morfológicas tan idénticas como sea posible. Para Drosophila melanogaster, el estadio pupal tarda aproximadamente 4 días. D. sechellia y erecta D. pupa desarrollo puesta en escena es similar a la D. melanogaster; sin embargo, D. virilis desarrollo pupal es 1.3 x11,largo12. Cuando otras especies están preparadas para la disección, la puesta en escena debe basarse en ambos el momento en el período pupal y observaciones comparativas de antenas específicas de la etapa, antenal morfología del disco, con la similitud morfológica, siendo la máxima prioridad. En primer lugar, identificar el óptimo manejo de temperatura para la especie que te interesa. Muchas especies crecen bien a 25 ° C, pero puede obtenerse información detallada sobre las condiciones de mantenimiento desde el centro de stock de especies de Drosophila de la Universidad de California San Diego.

Los pasos más críticos en el protocolo son la correcta estadificación y adecuada disección del tejido de interés en una cantidad adecuada de especies diferentes. Una vez que estas en el lugar, el protocolo proporciona un método eficiente de colección de tejidos para tales análisis y puede adaptarse prácticamente a cualquier tejido de disco imaginal en desarrollo durante las etapas de pupal en cualquier especie de Drosophila .

Una limitación de este protocolo es que no proporciona muestras específicas del tipo de células. Una comprensión más detallada de la morfología y función celular requiere células específicas del tipo de perfiles de transcripción a nivel de sistemas, además de procedimientos estándar moleculares como RT-PCR cuantitativa o inmunohistoquímica. Celular tipo-específicas de perfiles ha sido difícil, especialmente debido a la falta de células específicas del tipo reportero transgénicos en especies no -melanogaster . Con los avances actuales en perfiles celulares, transgénicos y CRISPR Cas9 mediada por la edición del genoma en especies no -melanogaster , ahora es posible etiquetar y clasificar las células de interés para el perfil de transcripción13.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Este estudio fue apoyado por una beca de la National Science Foundation a Pelin C. Volkan (DEB-1457690).

Materials

Name Company Catalog Number Comments
10X Phosphate-buffered Saline Gibco 70011-044 Dilute to 1X in RNase free water
CO2 tank Air Gas CD R200
Two sharp forceps (Dumont #55) Fine Science Tools 11255-20
Trizol Invitrogen 15596-026 RNA isolation solutions
Dissecting Microscope
Small bucket with ice
P20 and P200 micropipettes and tips
1.7 mL Microfuge tubes Purchase nuclease free for best results
0.2 mL PCR tubes
Paraformaldehyde powder Polysciences 380
10% Triton X-100 Teknova T1105 Dilute to 0.2% v/v in 1X PBS
2" petri dishes
55mm filter paper Whatman 1001-055 Wet with water and place in a petri dish to keep pupae moist
25 C incubator
deionized H2O Purchase nuclease free or treat with DEPC
Sylgard 184 Silicone Elastomer Kit Dow Corning to be used for making dissection pads from Terizaki plate covers.
MicroWell Mini Trays with lids Nunc 438733 Lids can be used to make silicone dissection pads
Rabbit anti-GFP antibody MBL international corpor PM005 primary antibody
Mouse anti RAT CD2 AbD seroTec MCA154RHDL primary antibody
ADL195 (anti lamin, mouse) Dev studies hydoma ban ADL195-s primary antibody
Alexa Fluor® 488 goat anti-rabbit IgG (H+L) invitrogen A11008 Secondary antibody
Cy3 Goat Anti-Mouse IgG Jackson ImmunoResearch 115-166-003 Secondary antibody
Triton X-100, Protein Grade Detergent, 10% Solution, Sterile-Filtered CALBIOCHEM 648463 detergent
Lab Rotator Thermo scientific Rotator
Nuclease Free Water Growcells.com NUPW-0125 Water
Light-Duty Tissue Wipers VWR 82003-822 For cleaning dissection supplies
Superscript II invitrogen 18064014 Reverse Transcriptase 
QIAshredder (50) RNA extraction QIAGEN 79654
Oligo(dT)12-18 Primer RT life technologies 18418012
RNeasy MinElute Cleanup Kit (50) RNA extraction QIAGEN 74204
FASTSTART UNIV SG MASTER (5 ML)(500 RXN) qPCR Roche 04913850001
FASTSTART ESSENTIAL GREEN DNA MASTER  qPCR Roche 06402712001
LIGHTCYCLER 480 - MULTIWELL PLATE 96 qPCR Roche 04729692001
NEBNext High-Fidelity 2X PCR Master Mix qPCR NEB M0541S

DOWNLOAD MATERIALS LIST

References

  1. Barish, S., Volkan, P. C. Mechanisms of olfactory receptor neuron specification in Drosophila. Wiley Interdisciplinary Reviews. Developmental Biology. 4, (6), 609-621 (2015).
  2. Pan, J. W., Volkan, P. C. Mechanisms of development and evolution of the insect olfactory system. Cell and Developmental Biology. 2, 130 (2013).
  3. Ramdya, P., Benton, R. Evolving olfactory systems on the fly. Trends in Genetics. 26, (7), 307-316 (2010).
  4. Bellen, H. J., Tong, C., Tsuda, H. 100 years of Drosophila research and its impact on vertebrate neuroscience: a history lesson for the future. Nature Reviews Neuroscience. 11, (7), 514-522 (2010).
  5. Knecht, Z. A., et al. Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila. eLife. 5, 44-60 (2016).
  6. Enjin, A., et al. Humidity sensing in Drosophila. Current Biology. 26, (10), 1352-1358 (2016).
  7. Li, Q., Barish, S., Okuwa, S., Volkan, P. C. Examination of endogenous rotund expression and function in developing Drosophila. olfactory system using CRISPR-Cas9-mediated protein tagging. G3: Genes|Genomes|Genetics. 5, (12), 2809-2816 (2015).
  8. Hueston, C. E., et al. Chromatin modulatory proteins and olfactory receptor signaling in the refinement and maintenance of fruitless expression in olfactory receptor neurons. PLoS Biology. 14, (4), 1002443 (2016).
  9. Li, Q., et al. Combinatorial rules of precursor specification underlying olfactory neuron diversity. Current Biology. 23, (24), 2481-2490 (2013).
  10. Li, Q., et al. A functionally conserved gene regulatory network module governing olfactory neuron diversity. PLoS Genetics. 12, (1), 1005780 (2016).
  11. Pan, J. W., et al. Patterns of transcriptional parallelism and variation in the developing olfactory system of Drosophila species. Scientific Reports. 7, (1), 8804 (2017).
  12. Pan, J. W., et al. Comparative analysis of behavioral and transcriptional variation underlying CO2 sensory neuron function and development in Drosophila. Fly. 11, (4), 239-252 (2017).
  13. Stern, D. L., et al. Genetic and transgenic reagents for Drosophila simulans, D. mauritiana, D. yakuba, D. santomea, and D. virilis. G3: Genes|Genomes|Genetics. 7, (4), 1339-1347 (2017).
Preparación de desarrollar tejido olfatorio periférico para Molecular y el análisis de Immunohistochemical en <em>Drosophila</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).More

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter