Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

PCR כמותי של T7 Bacteriophage מ- Biopanning

doi: 10.3791/58165 Published: September 27, 2018

Summary

לשחזור מדויק, זמן יעיל כמותיים PCR (qPCR) שיטה לספור T7 bacteriophage מתואר כאן. הפרוטוקול מתאר בבירור phage הכנה דנ א גנומי, PCR התגובה הכנה, תנאי הרכיבה qPCR, ניתוח נתונים qPCR.

Abstract

פרוטוקול זה מתאר את השימוש PCR כמותי (qPCR) למנות T7 phages מ phage מבחר ניסויים (קרי, "biopanning"). qPCR היא גישה המבוססת על ידי קרינה פלואורסצנטית לכמת את הדנ א, הנה, זה מותאם לכמת phage הגנום כמדד עבור phage חלקיקים. ב פרוטוקול זה, שיטת הכנה phage נתיישב דנ א מתוארת באמצעות חימום בטמפרטורה גבוהה ללא טיהור DNA נוספים. השיטה צריכה רק כמויות קטנות של phages שילדת כרכים קטנים של התגובה qPCR. qPCR תפוקה גבוהה ומהיר, מסוגל לעבד ולקבל נתונים גישות אחרות ספירה phage צלחת 96-ובכן של תגובות ב- 2-4 ה Compared, qPCR יעיל יותר זמן. כאן, qPCR משמש לציון T7 phages מזוהה של biopanning נגד במבחנה , כמו סיסטיק פיברוזיס ריר מודל. בשיטת qPCR ניתן להרחיב לכמת T7 phages של ניסויים אחרים, כולל סוגים אחרים של biopanning (למשל., מרותק למיטה חלבון מחייב, אין ויוו ההקרנה phage) ומקורות אחרים (למשל, מערכות מים או נוזלי גוף). לסיכום, פרוטוקול זה יכול להיות שונה לכמת וירוסים אנקפסולציה ל- DNA.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

טכנולוגיית התצוגה bacteriophage (phage), שפותחה על ידי ג'ורג סמית בשנת 1985, היא גישה חזקה, תפוקה גבוהה לזיהוי ליגנדים פפטיד או חלבון נגד מטרות או קולטני קרום התא, מחלת אנטיגנים, organelles הסלולר או ספציפי איברים ורקמות1,שני העשורים האחרונים2. כאן, ספריות אקראי של polypeptides או שרשרת אחת נוגדנים יוצגו על החלבונים המעיל של phages (בדרך כלל M13 או T7), ניתן לזהות ליגנדים מסוים ואתה מוריד נגד חלבונים קיבוע במבחנה או vivo בתוך מערכות ביולוגיות באמצעות תהליך הבחירה איטרטיבי. לאחר מכן, ליגנדים יכול להיות יחד עם סוכני דימות או טיפולית באבחון וטיפול של מחלות3,4. זה קריטי לספור במדויק phages במהלך מספר השלבים של biopanning: (1) לכמת phages זה לאגד המצע, (2) לכמת phages כדי לקבוע אם קיים העשרה עם כל סיבוב של בחירה (העשרה phage מציין biopanned phage אהדה עבור היעד). תקן הזהב הנוכחי על כימות, שכבה כפולה פלאק assay, מציג אתגרים מרובים; זה מייגע, מסורבלת, שעשוי להיות לא מדויק עבור מספר גדול של דוגמאות. לכן, הקבוצה שלנו פיתחה שיטה תגובת שרשרת (qPCR) פולימראז כמותיים רגיש, מדויק הדירים היעילה לספור חלקיקים phage M13 ו- T7 biopanning5.

qPCR היא שיטה אפשרית ומושכת לכמת במדויק T7 ו- M13 phages. מאז כל חלקיק phage בודדים יכולים להכיל רק עותק אחד של DNA גנומי (dsDNA או ssDNA), גנום phage אחד שווה ל מחלקיק אחד phage; על ידי לכימות מספר phage הגנום, זה ריאלי כדי לכמת את מספר phages. במהלך qPCR, כתב פלורסנט צבעי לאגד דנ א גנומי phage הלא ספציפית או במפורש דרך רצף ספציפי תחל במהלך ה-PCR-הגברה, זריחה את האות עולה עם כל סיבוב של הגברה. כאשר האות פלורסצנטיות מגיע לפתח עגול/מעגל ההגברה יצויין בתור מחזור הסף (Ct). ריכוז ידוע הפניה phage DNA מותוות נגד הערכים Ct שלהם להקים עיקול רגיל. באמצעות עקומת סטנדרטי עם הערכים Ct של דגימות די אן איי, ריכוזי phages יכול להיות עם אינטרפולציה.

בעוד אסטרטגיות רבות שפותחו בעבר, נעשה שימוש נרחב לכמת phages מן biopanning, לכל אחד מהם יש אתגרים ספציפיים. השיטה המקובלת ביותר היא שכבה כפולה פלאק וזמינותו. . הנה, המארח חיידקים נגועים phages מוכן במלון דילולים טורי, הם מצופים על מצע אגר מוצק, הערוכים בשכבות עם אגר; phages ממוספרים עם המספר של הפלאק נוצר (קרי, יחידות ויוצרים רובד או pfu) צלחת אגר. פלאק assay הוא רגיש אבל מייגע, זמן רב ולא מדויקות, במיוחד עבור דוגמאות רבות, עם ריכוזים גבוהים5. בנוסף, מבחני מקושרים-אנזים immunosorbent (אליסה) הותאמו למנות M13 ו T7 phage חלקיקים6,7,8. . הנה, phages-דילולים שונים מאוגדים, שנתפסו על מצע מוצק (קרי, microplate), שנבדק עם נוגדנים ספציפיים phage ולאחר שאותרו על-ידי שימוש כתבים (לדוגמה, אנזים רגיש סובסטרטים הדפסות כסף, fluorophores) לקבוע את מספר החלקיקים phage הנוכחי. הקריאות (למשל, זריחה, ספיגת) של דגימות ניתן לכמת ריכוזים לא ידוע נגד phage סטנדרטים בריכוזים ידועים. ELISAs מבוססי phage שונים פותחו אבל יש להם מגבלות אפשריות. קבוצה אחת פיתחה המבוסס על נייר כריך אליסה עם מגוון כימות שהשתרעו שבע סדרי גודל (102-109 pfu/mL); עם זאת, שיטה זו נדרש מספר השלבים של נוגדן ציפוי ולקח ליום שלם עבור assay8. הקבוצה שלנו גם פיתח שיטה אליסה לכמת M13 phage חלקיקים אך היה פחות רגיש זיהוי טווח של 106 כדי 11 10 pfu/mL5. לנתניד להחלפה פלורסצנטיות הגששים פותחו כדי למנות M13, כימות הנתונים יכולה להיות מושגת תוך 20 דקות; עם זאת, זו assay יש טווח דינמי צר של 109 ל-12 10 pfu/mL9. קבוצה אחת בשימוש מיקרוסקופ כוח אטומי למנות M13 phage חלקיקים בתמיסה, אך זה דורש מיקרוסקופ אלקטרונים מתקדמים, עבד רק בטווח צר של ריכוזים10. מחקר נוסף המשמש monodisperse אמולסיות השמנה phages כתב פלורסנט M13 ו- 4t ולספור phages לפי מספר טיפות פלורסנט; עם זאת, גישה זו גם הציג מגוון כימות צר מ-102 ל-6 10 pfu/mL11. בזמן droplet ש-PCR דיגיטלית נעשה שימוש כדי לכמת M13 phages, גישה זו אין אפשרות להבחין בין מספר חלקיקים phage זיהומיות וזיהומיות הלא12.

הקבוצה שלנו לאחרונה פיתחה שיטות qPCR למנות phages T7 ו- M13 מזוהה של biopanning נגד מודל תא מחסום הדם - מוח באמצעות הכתב שונה פלורסנט שני צבעי5. בהשוואה לשיטות כימות הנ ל, השיטות qPCR פיתחנו היו תפוקה גבוהה, היעילה לכמת מדגמים רבים מסוגלים להבדיל בין phages זיהומית, שאינן זיהומיות עם DNase שאני קדם בטיפול ו phage דגימות. חשוב לציין, גישה זו יכולים reproducibly ובדייקנות לכמת bacteriophages M13 ו- T7 מדגימות biopanning. כדי להדריך המתחיל חוקרים בתחום phage qPCR, כאן אנו מתארים שיטה qPCR מפורט לספור חלקיקים phage T7 מספריית מוגבל-ציסטאין (CX7C) הזזה נגד מכשול ריר סיסטיק פיברוזיס (CF) במבחנה . מהעבודה הזאת, ניתן להרחיב qPCR שיטת לכמת חלקיקים phage מסוגים אחרים של biopanning, ממקורות אחרים, כולל מים, קרקע של נוזלי הגוף.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. פריימר תכנון וניתוח של דנ א גנומי Phage T7

  1. עיצוב צבעי יסוד הגברה של דנ א גנומי phage T7.
    הערה: F (קדימה) ו- R (הפוכה) תחל (ראה טבלה של חומרים) להגביר את רצף ה-DNA T7 ממוקם במעלה הזרם של האזור משתנה בספריה (איור 1).
  2. לבחור מנתח פריימר מתאים כדי להעריך את הפרמטרים של צבעי יסוד, כולל טמפרטורת ההיתוך (Tm) אחוז תוכן הקטלוגים הכללים (GC %), הדימרים פריימר, היווצרות סיכת ראש, PCR והתאמתם (איור 1).
  3. להזמין את oligonucleotides פריימר (oligos), עם ההגעה, resuspend את oligos lyophilized במים DNase, RNase חינם אולטרה טהורים 100 מיקרומטר ריכוזים מניות בשפופרת צנטרפוגה 1.5 mL ולאחר לאחסן ב-20 מעלות צלזיוס למשך מספר חודשים.
  4. להפוך מספר aliquots (בסביבות 50 µL כל צינור 1.5 מ ל) של המניה פריימר 100 מיקרומטר.
    הערה: שלב זה משמש כדי למנוע מחזורים ההקפאה בתדירות גבוהה-הפשרה.

2. מכינים את הסטנדרטים על כימות של דנ א גנומי Phage T7

  1. באופן סדרתי לדלל 0.1 µg/µL (1.0 x fg8 10/µL) הפניה T7 phage DNA (שנרכשו; ב ריכוז ידוע של 0.1 µg/µL, ראה חומרים) 10-fold מ- 1.0 x 106 1.0 x 100 fg/µL עם אולטרה טהור H2O ב- 0.2 מ"ל המבחנות. להכין את כל הריכוז של הנפח הכולל של 20 µL (איור 2).
  2. מערבולת PCR צינורות כדי להבטיח ערבוב יסודי בכל שלב של דילול. בנוסף, לשנות עצות בעת הוספת לדנ דילול הבאים.
    הערה: מומלץ להכין פתרון חדש של ה-DNA תקנים עבור עיקול רגיל על כל הניסוי qPCR.
  3. השתמש המשוואה 1 (למטה) כדי להמיר לעיון phage T7 ריכוזי ה-DNA מ fg/µL הגנום עותקים (gc) /µL (איור 2).
  4. ריכוז ה-DNA phage T7 ב- gc/µL =
    Equation 1(1)
    הערה: bp: זוג בסיסים; הפניית T7 דנ א גנומי היא 37314 bp.

3. טיפול קדם של דגימות Phage לפני qPCR התגובה הכנה

  1. (אפשרות 1) Pipet 20 µL של T7 אחד שיבוט (phage) שנבחר מתוך biopanning נגד במבחנה סיסטיק פיברוזיס (CF)-כמו מודל ריר לתוך צינורות צנטריפוגה 1.5 mL. הוספת יחידות 1.25 DNase I (0.5 µL) כל מדגם 20 µL.
    הערה: הספרייה heptapeptide המאולץ ציסטאין phage T7 (CX7C) היה biopanned נגד ריר כמו CF מצופה ב- 24-ובכן ממברנה מוסיף (ראה טבלה של חומרים) למשך 15 דקות. פרטים נוספים ניתנים במקטע תוצאות. אחד T7 שיבוט נבחרה עבור הכנת הדוגמא qPCR מ eluate.
    1. אפשרות 2: Pipet 200 µL של T7 לשבט לתוך צינורות 1.5 מ ל, ולהוסיף 5 יחידות לימוד DNase אני
      (2 µL) על כל דגימה.
      הערה: היקף המדגם phage שנבחרו בשלב זה תלוי באמצעי האחסון שנאספו מ- biopanning. בעוד שהמוקד של הפרוטוקול נמצא qPCR של biopanned phage, השלבים עבור biopanning מפורטת פרוטוקול המשתמש phage T7 קיט (ראה טבלה של חומרים)13.
  2. קאפ השפופרות מדגם phage T7 (שלב 3.1), דגירה אותם ב 37 מעלות צלזיוס למשך 10 דקות באמבט יבש מחוממת (קרי, גוש חום).
  3. דגירה צינורות (מתוך שלב 3.2) ב 100 מעלות צלזיוס למשך 15 דקות באמבט יבש מחוממת (איור 3 א).
    התראה: מכיוון אידוי ועיבוי להתרחש במהלך השלב חימום, ודא כי הצינורות צנטריפוגה 1.5 mL הם כתרים לחלוטין.
  4. לסובב את phages שילדת מהשלב 3.3 ב 18,534 x g עבור שילוב ס' 10 phages על ידי הנחת הצינור על מערבל מערבולת להגדיר בכל מגע-הפעלת מצב עבור 10 s ו ספין-18,534 x g עבור 10 s שוב.
    הערה: מחזור ספין-לערבב-ספין היא כדי לוודא שהדגימות phage מחוממת מעורבבים היטב.
  5. לקרר את צינורות מדגם בטמפרטורת החדר (RT) על ידי השארת אותם על ספסל ניסוי או חנות ב 4 ° C במקרר למשך הלילה.
    הערה: ניתן להשהות הניסוי בשלב זה.

4. מכינים qPCR תגובות

הערה: אחד התגובה PCR היא דוגמא אחת. כל תגובה PCR מכיל 5 µL של מאסטר qPCR מערבבים (ראה חומרים), µL 1 של 5 מיקרומטר פריימר זוג מיקס, µL 2 H2O ו- 2 µL שילדת מדגם phage T7. עבור תגובות PCR מרובים, כל ריאגנטים למעט דגימת phage הם premixed אחד צינור 1.5 מ. הנפח של כל ריאגנט של premix תלוי במספר הדגימות phage עבור qPCR.

  1. להכין את premix qPCR 10 biopanned phage דוגמאות ריכוז לא ידוע ודוגמאות 7 של ריכוזים סטנדרטי שהפקידים. כתוצאה מכך, ישנן דוגמאות סה כ 51 ולכן, qPCR 51 תגובות (קרי, תגובה אחת לכל דגימה). עבור תגובות 51, להכין premix של 255 µL של qPCR מיקס מאסטר (51 x 5 µL), µL 51 של תחל (51 x 1 µL), µL 102 של H2O (51 x 2 µL).
    הערה: מומלץ להכין כמה תגובות PCR נוספת כדי לפצות על אבדן נפח במהלך aliquoting המיקס PCR לבאר כל צלחת qPCR 96-ובכן.
  2. µL 8 aliquot של ה-PCR premix לבאר כל צלחת qPCR 96-ובכן בסך 51 וולס (קרי: 51 תגובות qPCR). יש צורך לשנות טיפים במהלך aliquoting.
  3. להוסיף 2 µL של דגימות phage T7 שילדת (שלב 3.4) או הפניה phage T7 DNA (שלב 2.1) כל טוב (איור 3B); לשנות עצות בעת הוספת דגימות דנ א שונה לבאר, כדי למנוע זיהום צולב. כמו כן, לוותר על דגימות ה-DNA µL 2 מתחת לפני השטח של premix "qPCR" (קרי, לתוך premix PCR 8 µL).
  4. חותם את הצלחת qPCR עם סרט דביק.
    הערה: שלב זה הוא קריטי, ללא קשר לסוג לוח qPCR. להשתמש בערכה מומלץ לאטום את הצלחת לחלוטין; אחרת, בכל אזור שאינו אטום בצלחת יגרום אובדן נפח במהלך ה-PCR רכיבה על אופניים.
  5. לעטוף את הצלחת qPCR ברדיד אלומיניום, כדי למזער את זריחה photobleaching והמשך להפעילה על הציוד qPCR.

5. qPCR תנאי רכיבה על אופניים

הערה: תנאי הרכיבה qPCR הוקמו על הציוד הספציפי qPCR (ראה טבלה של חומרים).

  1. הפעל את הצלחת 96-ובכן qPCR על הציוד qPCR. על הציוד, בחר הגדרות ' מתפריט ' כדי להגדיר את התנאים ניסיוני הבאים (איור 3C).
  2. לארגן רכיבה על אופניים התנאים כמפורט להלן עבור אמצעי אחסון מדגם של 10 µL: מחזור אחד ב 50 מעלות צלזיוס למשך 2 דקות, מחזור אחד ב 95 מעלות צלזיוס למשך 2 דקות, ואחריו 40 מחזורי (95 ° C 15 s, 60 מעלות צלזיוס במשך 1 דקה). לאחר מכן, להפעיל את ההגדרות עקומת להמיס: מחזור אחד של 95 ° C עבור s, 60 מעלות צלזיוס במשך 1 דקה, 15 ו- s 95 ° C 15.
  3. להמשיך לנתח את הנתונים כפי שמתואר בשלב 6.

6. לנתח את qPCR הנתונים הגולמיים, להמיר מ qPCR Ct ערך ל- gc/µL עבור T7 Bacteriophages

  1. לנתח את הנתונים הגולמיים qPCR והערכת איכות הנתונים על-ידי ניתוח החלקות האופיינית של הנתונים הגולמיים (איור 4).
    הערה: הגברה מגרש, מגרש ל להמיס עקומת העלילה הם שמאפיין מפתח מתווה לאמת את איכות הנתונים qPCR.
  2. לחשב את ערכי מחזור (Ct) הסף רשע בין דגימות triplicate-כל ריכוז של העקומה סטנדרטי (שלב 2.1).
    1. מגרש אומר Ct (Y) נגד יומן (gc/µL) (X) כדי לקבל את עקומת ליניארי Y = kX + b (k הוא השיפוע של העקומה ליניארי, b הוא נקודת החיתוך).
    2. חשב את מקדם ליניארי14 R2 (R2 בטח > 0.99).
  3. השתמש העקומה תקן Y = kX + b כדי לחשב את מספר T7 phages הדגימות biopanning (קרי, phages נבחר נגד ריר כמו CF) ב- gc/µL (איור 5).
    הערה: k הוא השיפוע של העקומה סטנדרטי.
  4. לחשב את היעילות הגברה באמצעות המשוואה הבאה
    Equation 2(2)
    הערה: k הוא השיפוע של העקומה תקן שנוצר מתוך התייחסות דנ א qPCR. הטווח האידיאלי של הגברה יעילות הוא 90-110%.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

כלי עיצוב פריימר שונים ניתן לעצב תחל qPCR. בדרך כלל, פריימר עיצוב תוכניות יש אלגוריתמים מוכללים משלהם כדי לחשב ולאמת את הפרמטרים מפתח של צבעי יסוד, למשל, GC %, Tm, פריימר דיימר או היווצרות סיכת ראש, וכו ' בדרך כלל, הקריטריונים המרכזיים דומים שונה כלי עיצוב פריימר, תחל יכול להיות מתוכנן ההוראות שלהם. פריימר הפיצוץ יכול לשמש כדי לאשר יחודיות של צבעי יסוד. פריימר אחד לשייך את מטרות במעלה הזרם של אזור משתנה T7 דנ א גנומי מוצג באיור1. כדי לקבוע את ריכוזי phage דגימות biopanning, אבסולוטי לא ידוע כימות גישה - עיקול רגיל כימות - נבחר כדי למנות את העותקים דנ א גנומי phage. הפניה T7 phage DNA (ראה חומרים)-ריכוז ידוע µg 0.1/µL היה מדולל באופן סדרתי מ 1.0 x 100 1.0 x 106 fg / µL. משוואה 1 שימש כדי להמיר T7 phage DNA ריכוזים מ fg/µL הגנום עותקים (gc) / µL; הפניה T7 phage DNA ריכוז היו 2.66 x 101 עד 2.66 x7 10 gc/µL (איור 2).

לאחר הכנת דילולים התייחסות DNA העקומה רגיל, אחד phage CX7C T7 שנבחר הוכן qPCR (איור 3 א). בקצרה, כדי לתאר את biopanning של phage שנבחרו: הריכוז ההתחלתי של 4.2 x 10 phage T7 CX7C pfu9 נוספה על הפסגה תא המטען (תורם) של Transwell לוחית רישוי (ראה טבלה של חומרים) המכיל 100 µL של CF דמוי ריר, µL 600 של פוספט buffered תמיסת מלח (PBS, ראה טבלה של חומרים) בתא basolateral (מקלט), נדגרה למשך 15 דקות בטמפרטורת החדר (25 ° C). לאחר 15 דקות, נאסף את eluate לתוך קנה הבליעה; מ, eluate אחד CX7C T7 שיבוט נבחרה ניתן לכמת על-ידי qPCR. הכנת התגובה qPCR בוצעה על הקרח עם ריאגנטים הדרושים (למשל, מיקס מאסטר qPCR, תחל H2O), כפי שמוצג באיור 3B. התנאים אופניים qPCR סידרו על thermocycler qPCR כדי להפעיל את הדגימות (ראה טבלה של חומרים, איור 3C).

לאחר qPCR להפעיל, מגרש הגברה, להמיס עקומת העלילה עלילה ל (איור 4) נותחו מן הנתונים הגולמיים באמצעות התוכנה (ראה טבלה של חומרים). העלילה הגברה מצביע על הצלחה או כישלון של PCR הגברה של כל דגימה. העלילה ל מציג הגברה ודעיכה של אות קרינה פלואורסצנטית (כתבת צבע SYBR ורקע רוקס צבען) ברחבי המחזורים הגברה. העלילה עקומת להמיס משמש לאימות יחודיות של תחל מאז כל מוצר ה-PCR יש אחד ייחודי טמפרטורת ההיתוך (Tm).

לאחר הערכה של איכות הנתונים הגולמיים qPCR, העקומה רגיל נוצר מהפניה DNA: Ct ערכים (Y) על יומן gc/µL (המרה ריכוז המוצג באיור5); . הנה, זה היה Y =-3.5188 X + 35.09 (R2= 0.999) (5A איור ו- 5B). היעילות הגברה מחושב 92.4%. העקומה סטנדרטי השתמשו אינטרפולציה את ריכוזי מדולל T7 phage CX7C שיבוט מבוסס על ערכיהם Ct לא ידוע. כל הפניה דוגמאות ודוגמאות phage נוהלו שהפקידים, ערכיהם Ct אומר שימשו לחישוב ריכוז ה-DNA ב- gc/µL (איור 5). הפתרון המניות הראשונית של השיבוט T7 היה מדולל באופן סדרתי כדי לאמת את ויציבות הדירות של qPCR עבור ספירת T7 phages5. ב כל דילול, דגימות הוכנו דולר. וזמינותו שכבה כפולה פלאק שימש שיטה ההתייחסות כדי לקבוע את ריכוזי דילולים T7; השיטות שתוארו קודם לכן5. איור 6, התוצאות נציג של qPCR מוצגים בהשוואה לפלאק assay שנבדקו טווח 101 עד 107 gc / µL. Titers או מספר phages של כימות qPCR היו גבוהים יותר מאשר של שכבה כפולה פלאק וזמינותו. הדיר של השיטה qPCR מיוצג על ידי המקדם של השונות (CV) עבור ריכוזים מ-101 עד 107 gc/µL. התוצאות הוצגו בטבלה 1; CV % נע בין 2.85 – 27.2%.

Figure 1
איור 1: פריימר לעיצוב T7-415 phage וקטור ומפתח פרמטרים אנליזת דנ תחל מעוצב. כלי עיצוב Oligo שימשו לעיצוב מספר זוגות של צבעי יסוד phage T7-415 הדנ א. סט אחד נבחר לאחר אימות פרמטרים מרכזיים של צבעי יסוד, למשל, Tm, GC %, היווצרות פריימר דיימר סיכת ראש. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: עקומת סטנדרטי והכנה יחידת המרה של T7 phage הפניה דנ א. טורי דילולים 10-fold היו עשויים מ- 0.1 µg/µL T7 phage התייחסות DNA עיקול רגיל. משוואה 1 השתמשו כדי להמיר את ריכוזי ה-DNA מ fg/µL ל- gc / µL. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: Phage הדגימה טיפול, הכנת התגובה qPCR ו- qPCR לרוץ. אני pretreated דגימות phage T7 DNase היו מחומם ב 100 מעלות צלזיוס למשך 15 דקות לשחרר את T7 הדנ א phage שלם חלקיקים (א); התערובת qPCR הוכן כמפורט בפרוטוקול. כל ההכנות נעשו על קרח (B); qPCR ציוד ותוכנות תואם (C) שימשו כדי להגדיר את תנאי הרכיבה, להפעיל מחזורי PCR, לרכוש, לנתח את הנתונים הגולמיים. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4: חלקות האופיינית של הנתונים הגולמיים qPCR. הגברה מגרש, מגרש ל עלילה עקומת להמיס נרכשו מן הנתונים הגולמיים qPCR של biopanning נגד במבחנה CF דמוי ריר מכשול אחד phage CX7C T7 השיבוט. העלילה ל, לצבוע התייחסות פסיבית (רוקס) הוא מולקולה לצבוע כלול את תערובת הבסיס qPCR אינה משתתפת הגברה PCR, יראה אין אות הגברה בעלילה. SYBR, אשר SYBR מולקולת צבע ירוק בתערובת אב qPCR, תספק אות פלורסצנטיות צריך להגביר, ריקבון במהלך qPCR רכיבה על אופניים. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 5
איור 5: ניתוח נתונים גולמיים של qPCR לחישוב gc/µL של החלקיקים phage T7. סף מחזור ערכים (Ct) של העקומה סטנדרטי של הפניה phage T7 דנ א (Y) שורטטו נגד לוגריתם טרנספורמציה של ריכוז ידוע הפניה DNA ב- gc/µL (X) כדי לקבל את עקומת סטנדרטי (A ו- B). העקומה סטנדרטי שימש לחישוב ערכי X (יומן gc/µL) ריכוזי דגימות phage בהתבסס על הערכים שלהם Ct לא ידוע. (ג) T7 ניתן לחשב ריכוזים phage ב gc/µL. בנוסף, חישוב יעילות הגברה qPCR מסופק. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 6
איור 6: רגישות, הדיר תוצאות qPCR למנות אחד T7 שיבוט של biopanning נגד במבחנה CF דמוי ריר מכשול. אחד שיבוט phage T7 CX7C, שנבחר מתוך ניסוי biopanning היה באופן סדרתי מדולל טווח ריכוז (מסומן בתור E1-E7 לייצג 101 עד 107), שהפקידים qPCR ואת וזמינותו פלאק שכבה כפולה. הן qPCR והן שכבה כפולה פלאק assay שימשו כדי לכמת את הריכוז של השיבוט phage T7-דילול בכל. הנתונים הוצגו בהערך הממוצע עם סטיית תקן (SD)-בכל מידה לכל קבוצה לטיפול. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

הדיר
ריכוז (gc/µL) CV נתונים ב- %
10 1 27.2
10 2 7.65
10 3 2.85
10 4 15.7
10 5 15.6
10 6 5.03
10 7 4.71

טבלה 1: הדיר של שיטת qPCR עבור אחד שיבוט phage CX7C T7. Intra-השתנות נבדקה בקנה מידה כימות של 101 עד 107 gc/µL עבור השיבוט T7-DNA, המקדם של וריאציה (CV) מחושב כמו יחס של סטיית התקן כדי הממוצע לבטא את הדיר של השיטה qPCR. CVs חושבו בטווח של 2.85 – 27.2% עבור ריכוזים שנבדקו.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

פיתחנו שיטות qPCR לכמת phage דנ א גנומי5, כאן אנו המתואר ומותאמים שיטה qPCR למנות T7 phages שנבחרו נגד מחסום CF דמוי ריר. מידע מינימלי עבור הפרסום של כמותיים בזמן אמת PCR ניסויים (MIQE) הנחיות הוסבו לפתח, לאמת את שיטת qPCR עבור ספירה של T7 phages15. פרוטוקול פיתחנו לכמת phages של ניסויים biopanning היא גישה היעילה, אמין, וחסכוני. פרוטוקול שלנו עבור הכנת הדוגמא qPCR רק בשימוש טיפול בטמפרטורות גבוהות (100 ° C, 15 דקות) של הפתרון phage, לא מחייבים phage DNA מיצוי וטיהור צעדים לעומת אסטרטגיות קונבנציונאלי11,17, 18. כמו כן, למנות באופן מדויק יותר phage חלקיקים, DNase נוספה הפתרון phage לפני טיפול בטמפרטורות גבוהות כדי להסיר אי כמוס phage דנ א18,19,20. Non-אנקפסולציה, שרידי DNA בפתרון phage עלולה לגרום מחוסר כימוס במהלך phage הגברה ו/או השפלה של phage חלקיקים. כתוצאה מכך, לכמת במדויק את מספר החלקיקים phage שלם באמצעות DNA גנומי שלהם, טיפול קדם DNase חיוני כדי למנוע ערכים גבוהים artifactually phage הגנום עותקים.

ישנם שיקולים רבים של פיתוח, השימוש qPCR לכמת במדויק את phages. וריאציה של נתונים qPCR יכול להתרחש במהלך הפרוטוקול, הבאות יש לקחת בחשבון על מנת להשיג ספירה מדויקת. חשוב להבטיח פירוק phage עם טמפרטורה גבוהה טיפול ולשמור על צינורות מדגם phage בתנאים אטום כדי למנוע תנודות עוקבות בריכוז לדוגמה עקב התאדות, התעבות מים. הנפח הכולל של תגובת ה-PCR קטן ודורש pipets מכויל ומיומנות pipetting אמין בכל שלב של הכנת הדוגמא. במהלך qPCR רכיבה על אופניים, טמפרטורה אמין שליטה פונקציה הכרחית נתונים qPCR מדויק, כיול שוטף של הצנטרפוגה תרמי בכלי qPCR יש צורך. כדי לשלוט וריאציה, צעדים חלופיים תוארו בפרוטוקול. אם המפעיל חווה את הקושי בנפח נמוך pipetting, התגובה PCR הכולל ניתנים לשינוי 20 או 25 µL. מלבד השלבים הנ ל פתרון בעיות, הפרוטוקול דורש שליטה פנימי של תקן ה-DNA15,21,22,23. כמו שיטת כימות מוחלטת, המקדם ליניארי של עיקול רגיל קובע את הדיוק של הנתונים ספירה phage. באמצעות ה-DNA של בקרה פנימית בטווח מדגם באפשרותך למזער את הווריאציה של משאבות וציוד qPCR.

בהשוואה לשיטות כימות phage שתואר לעיל, פרוטוקול שלנו מאפשרת ספירה של מגוון רחב של ריכוזים phage, יכול להבדיל בין חלקיקים phage זיהומיות, שאינן זיהומיות עם וללא טיפול DNase. בנוסף, פרוטוקול שלנו הוא אטרקטיבי עבור לכימות מספר רב של דוגמאות, שהופך אותו חסכונית יותר, היעילה וגבוה התפוקה בהשוואה כפול שכבת פלאק assay ושיטות אחרות.

לסיכום, פרוטוקול זה ניתן להתאים ספירת חלקיקים phage במגוון רחב של יישומים, כולל biopanning במבחנה , ויוו , phage ספריית DNA הכנה הדור הבא רצפי ולאחר phage סביבתיים זיהום.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgments

עבודה זו נתמכה על ידי חברת פארמה קרן מחקר Starter גרנט ולהעניק הלאומי ללב, ריאות, מכון דם של מכוני הבריאות הלאומיים תחת מספר פרס R01HL138251.

Materials

Name Company Catalog Number Comments
Materials and Reagents
Primers for T7 genomic DNA IDT F: CCTCTTGGGAGGAAGAGATTTG
R: TACGGGTCTCGTAGGACTTAAT
T7 Select packaging control DNA EMD Millipore 69679-1UG
MicroAmp optical 96-well reaction plate ThermoFisher Scientific N8010560
qPCR master mix--Power up SYBR Green master mix Applied biosystems A25742
MicroAmp optical adhesive film kit ThermoFisher Scientific 4313663
T7Select 415-1 Cloning Kit EMD Millipore 70015 User protocols : http://www.emdmillipore.com/US/en/product/T7Select-415-1-Cloning-Kit,EMD_BIO-70015#anchor_USP
DNase I solution ThermoFisher Scientific 90083
24-well transwell plate Corning 3472
UltraPure DNase/RNase-Free Distilled H2O Invitrogen 10977015
Phosphate Buffered Saline (1x) Corning 21040CV
Name Company Catalog Number Comments
Equipments
ViiA7 Real-Time PCR System with Fast 96-Well Block ThermoFisher Scientific 4453535
Heraeus Pico 21 Microcentrifuge ThermoFisher Scientific 75002415
Fisherbrand Digital Vortex Mixer Fisher Scientific 02-215-370
HERMO SCIENTIFIC Multi-Blok Heater ThermoFisher Scientific Model:2001
Sorvall Legend X1 Centrifuge ThermoFisher Scientific 75004220
M-20 Microplate Swinging Bucket Rotor ThermoFisher Scientific 75003624
Name Company Catalog Number Comments
Software
QuantStudio Real-time PCR software ThermoFisher Scientific v1.2
Real-time qPCR primer design IDT
OligoAnalyzer 3.1 IDT

DOWNLOAD MATERIALS LIST

References

  1. Smith, G. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. 228, (4705), 1315-1317 (1985).
  2. Smith, G. P., Petrenko, V. A. Phage Display. Chemical Reviews. 97, (96), 391-410 (1997).
  3. Sergeeva, A., Kolonin, M. G., Molldrem, J. J., Pasqualini, R., Arap, W. Display technologies: Application for the discovery of drug and gene delivery agents. Advanced Drug Delivery Reviews. 58, (15), 1622-1654 (2006).
  4. Dias-Neto, E., et al. Next-generation phage display: Integrating and comparing available molecular tools to enable costeffective high-throughput analysis. PLoS ONE. 4, (12), 1-11 (2009).
  5. Peng, X., Nguyen, A., Ghosh, D. Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR. Journal of Virological Methods. 252, (June 2017), 100-107 (2017).
  6. Khan, M. S., Pande, T., Mvan de Ven, T. G. Qualitative and quantitative detection of T7 bacteriophages using paper based sandwich ELISA. Colloids and Surfaces B: Biointerfaces. 132, 264-270 (2015).
  7. Brasino, M., Lee, J. H., Cha, J. N. Creating highly amplified enzyme-linked immunosorbent assay signals from genetically engineered bacteriophage. Analytical Biochemistry. 470, 7-13 (2014).
  8. Yu, X., Burgoon, M., Shearer, A., Gilden, D. Characterization of phage peptide interaction with antibody using phage mediated immuno-PCR. J immunol Methods. 326, (1-2), 33-40 (2007).
  9. Lehmusvuori, A., Manninen, J., Huovinen, T., Soukka, T., Lamminmäki, U. Homogenous M13 bacteriophage quantification assay using switchable lanthanide fluorescence probes. BioTechniques. 53, (5), 301-303 (2012).
  10. Schlaman, H. R. M., et al. Analysis of interactions of signaling proteins with phage-displayed ligands by fluorescence correlation spectroscopy. Journal of Biomolecular Screening. 13, (8), 766-776 (2008).
  11. Tjhung, K. F., Burnham, S., Anany, H., Griffiths, M. W., Derda, R. Rapid enumeration of phage in monodisperse emulsions. Analytical Chemistry. 86, (12), 5642-5648 (2014).
  12. Reitinger, S., Petriv, O. I., Mehr, K., Hansen, C. L., Withers, S. G. Purification and quantitation of bacteriophage M13 using desalting spin columns and digital PCR. Journal of Virological Methods. 185, (1), 171-174 (2012).
  13. T7Select Biopanning Kit. Millipore Sigma. Available from: https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit,EMD_BIO-70018#anchor_USP (2018).
  14. Schneider, A., Hommel, G., Blettner, M. Linear Regression Analysis. Deutsches Ärzteblatt international. 107, (44), 776-782 (2010).
  15. Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggert, J. The MIQE Guidelines: Minimun information for publication of quantitative real-time PCR experiments. Clinical Chemitry. 55, (4), 611-622 (2009).
  16. Lock, M., Alvira, M. R., Chen, S. -J., Wilson, J. M. Absolute Determination of Single-Stranded and Self-Complementary Adeno-Associated Viral Vector Genome Titers by Droplet Digital PCR. Human Gene Therapy Methods. 25, (2), 115-125 (2014).
  17. Fittipaldi, M., et al. Discrimination of infectious bacteriophage T4 virus by propidium monoazide real-time PCR. Journal of Virological Methods. 168, (1-2), 228-232 (2010).
  18. Lodder, W. J., et al. Reduction of bacteriophage MS2 by filtration and irradiation determined by culture and quantitative real-time RT-PCR. Journal of Water and Health. 11, (2), 256-266 (2013).
  19. Brown-Jaque, M., et al. Antibiotic resistance genes in phage particles isolated from human feces and induced from clinical bacterial isolates. International Journal of Antimicrobial Agents. (2017).
  20. Naveca, F. G., et al. Multiplexed reverse transcription real-time polymerase chain reaction for simultaneous detection of Mayaro, Oropouche, and oropouche-like viruses. Memorias do Instituto Oswaldo Cruz. 112, (7), 510-513 (2017).
  21. Jia, J., et al. Simultaneous detection and differentiation of human parvovirus B19 and human parvovirus 4 by an internally controlled multiplex quantitative real-time PCR. Molecular and Cellular Probes. 36, 50-57 (2017).
  22. Bliem, R., et al. A novel triplex quantitative pcr strategy for quantification of toxigenic and nontoxigenic Vibrio cholerae in aquatic environments. Applied and Environmental Microbiology. 81, (9), 3077-3085 (2015).
  23. Wan, Z., Goddard, N. L. Competition Between Conjugation and M13 Phage Infection in Escherichia coli in the Absence of Selection Pressure: A Kinetic Study. G3 Genes|Genomes|Genetics. 2, (10), 1137-1144 (2012).
PCR כמותי של T7 Bacteriophage מ- Biopanning
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).More

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter