Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

PCR quantitativa del batteriofago T7 da Biopanning

doi: 10.3791/58165 Published: September 27, 2018

Summary

Un tempo, accurato e riproducibile efficiente quantitativa PCR (qPCR) metodo per enumerare fago T7 è descritto qui. Il protocollo descrive chiaramente la preparazione di DNA genomico dei fagi, preparazione di reazione di PCR, qPCR ciclismo condizioni e analisi dei dati di qPCR.

Abstract

Questo protocollo descrive l'uso della PCR quantitativa (qPCR) per enumerare T7 fagi da esperimenti di selezione dei fagi (cioè, "biopanning"). qPCR è un approccio basato su fluorescenza per quantificare il DNA, e qui, è adattato a quantificare i genomi dei fagi come un proxy per particelle dei fagi. In questo protocollo, un metodo di preparazione del DNA dei fagi facile è descritto mediante riscaldamento ad alta temperatura senza ulteriore purificazione del DNA. Il metodo deve solo piccoli volumi di fagi trattato termicamente e piccoli volumi di reazione qPCR. qPCR è alto-rendimento e veloce, in grado di elaborare e ottenere dati da una piastra a 96 pozzetti delle reazioni in 2 – 4 h. rispetto ad altri metodi di enumerazione dei fagi, qPCR è più efficiente in termini di tempo. Qui, qPCR viene utilizzato per enumerare T7 fagi identificati da biopanning contro il modello in vitro fibrosi cistica-come muco. Il metodo di qPCR può essere esteso per quantificare T7 fagi da altri esperimenti, compresi altri tipi di biopanning (ad es., screening di fagi immobilizzato il legame con le proteine, in vivo ) e da altre fonti (ad esempio, sistemi di acqua o fluidi corporei). In sintesi, questo protocollo può essere modificato per quantificare eventuali virus DNA-incapsulato.

Introduction

Tecnologia di visualizzazione del batteriofago (fago), sviluppata da George Smith nel 1985, è un approccio potente, ad alta produttività per identificare ligandi del peptide o della proteina contro bersagli o recettori dalla membrana cellulare, gli antigeni malattia, organelli cellulari o specifici organi e tessuti in passato due decenni1,2. Qui, librerie casuale di polipeptidi o singola catena anticorpi vengono visualizzate sulle proteine cappotto di fagi (in genere M13 o T7) e ligandi specifici possono essere identificati da panning contro proteine immobilizzate in vitro o in vivo sistemi biologici attraverso un processo di selezione iterativi. Quindi, ligandi possono essere accoppiati con agenti terapeutici o di imaging per la diagnosi ed il trattamento di malattie3,4. È fondamentale per enumerare accuratamente fagi durante più passaggi di biopanning: (1) per quantificare i fagi che si legano al substrato e (2) quantificare fagi per determinare se c'è l'arricchimento con ogni turno di selezione (arricchimento dei fagi indica biopanned affinità dei fagi per la destinazione). Il gold standard attuale per la quantificazione, saggio della placca doppio strato, presenta sfide multiple; è noioso, ingombrante e potenzialmente non accurati per un gran numero di campioni. Di conseguenza, il nostro gruppo ha sviluppato un metodo di reazione a catena (qPCR) della polimerasi quantitativa sensibile, riproducibile, preciso e rapido per enumerare le particelle dei fagi M13 e T7 da biopanning5.

qPCR è un metodo attraente e fattibile quantificare con precisione T7 e M13 fagi. Poiché ogni particella individuale dei fagi può contenere solo una copia del DNA genomico (dsDNA o ssDNA), uno dei fagi genoma è equivalente a una particella fago; quantificando il numero di genomi dei fagi, è fattibile quantificare il numero di fagi. Durante qPCR, reporter fluorescente tinture legano il DNA genomico dei fagi non specifico o in particolare attraverso gli iniettori sequenza-specifici durante l'amplificazione di PCR e la fluorescenza segnale aumenta con ogni ciclo di amplificazione. Quando il segnale di fluorescenza raggiunge la soglia, che turno/ciclo di amplificazione è noto come il ciclo di soglia (Ct). Le concentrazioni note di fago riferimento DNA vengono confrontate con i valori di Ct per stabilire una curva standard. Utilizzando la curva standard con i valori di Ct di campioni di DNA, le concentrazioni di fagi possono essere interpolate.

Mentre numerose strategie sviluppate in precedenza e ampiamente utilizzate per quantificare i fagi da biopanning, ognuno di loro ha specifiche sfide. Il metodo più popolare e convenzionale è saggio della placca doppio strato. Qui, alcuni batteri sono infettati con fagi preparati alle diluizioni seriali, sono placcati su un substrato solido agar e sono overlaid con agar; fagi vengono enumerate con il numero delle placche formate (cioè, unità di formazione di placca o pfu) sulla piastra di agar. Saggio della placca è sensibile ma noioso, che richiede tempo e imprecise, soprattutto per i numerosi campioni e con alte concentrazioni di5. Inoltre, analisi enzima-collegate dell'immunosorbente (ELISA) sono state adattate per enumerare M13 e T7 fago particelle6,7,8. Qui, fagi a varie diluizioni sono vincolati e catturato su un substrato solido (cioè, una micropiastra), sondato con gli anticorpi dei fagi-specific e rilevato utilizzando reporter (ad es., substrati cromogeni sensibili enzima, fluorofori) per determinare il numero di particelle fagiche presenti. Letture (ad es., fluorescenza, assorbanza) dei campioni possono essere utilizzate per quantificare le concentrazioni sconosciute contro gli standard dei fagi a concentrazioni note. Sono state sviluppate diverse basati su fagi ELISAs ma hanno limitazioni potenziali. Un gruppo ha sviluppato un panino cartacei ELISA con una gamma di quantificazione che durò sette ordini di grandezza (2-10 109 pfu/mL); Tuttavia, questo metodo necessari più passaggi di rivestimento dell'anticorpo ed ha preso per un'intera giornata per il dosaggio di8. Anche il nostro gruppo ha sviluppato un metodo per quantificare le particelle dei fagi M13 ma aveva una gamma meno sensibile di rilevazione di 106 a 1011 pfu/mL5. Commutabile lantanidi fluorescenza sonde sono state sviluppate per enumerare M13 e quantificazione dati potrebbero essere ottenuti entro 20 min; Tuttavia, questo test ha una gamma dinamica stretta di 109 al 1012 pfu/mL9. Un gruppo ha usato Microscopia a forza atomica per enumerare le particelle dei fagi M13 in soluzione, ma questo richiede la microscopia elettronica avanzata e funzionava solo all'interno di una ristretta gamma di concentrazioni10. Un altro studio ha utilizzato monodispersi emulsioni per intrappolare fagi reporter fluorescente M13 e T4 e contare i fagi per il numero di goccioline fluorescente; Tuttavia, questo approccio inoltre hanno esibito una gamma stretta quantificazione da 102 106 pfu/mL11. Mentre gocciolina che digitale PCR è stato utilizzato per quantificare i fagi M13, questo approccio è in grado di distinguere tra il numero di malattie infettive e non infettive dei fagi particelle12.

Il nostro gruppo ha recentemente sviluppato metodi qPCR per enumerare T7 e M13 fagi identificati da biopanning contro un modello di cellulare della barriera emato - encefalica utilizzando due diversi reporter fluorescente tinture5. Rispetto ai metodi di quantificazione di cui sopra, i metodi di qPCR abbiamo sviluppato erano ad alta velocità e tempo efficiente per quantificare numerosi campioni e in grado di distinguere tra fagi infettive e non infettive con dnasi I pre-trattamento della campioni dei fagi. Cosa importante, questo approccio può riproducibile e accuratamente quantificare batteriofagi M13 e T7 da campioni di biopanning. Per guidare i ricercatori alle prime armi nella zona di fago qPCR, qui descriviamo un metodo qPCR dettagliate per enumerare le particelle dei fagi T7 da una libreria di cisteina-vincolato (CX7C) stroncate contro una barriera muco in vitro della fibrosi cistica (CF). Da questo lavoro, qPCR metodo può essere esteso per quantificare le particelle dei fagi da altri tipi di biopanning e da altre fonti, tra cui acqua, il suolo e fluidi corporei.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. primer Design e analisi di DNA Genomic di fago T7

  1. Disegno primer per l'amplificazione del DNA genomico di fago T7.
    Nota: F (in avanti) e R (retromarcia) primer (Vedi Tabella materiali) amplificano la sequenza del DNA T7 situato a Monte della regione variabile libreria (Figura 1).
  2. Scegliere un analizzatore di primer appropriato per valutare i parametri degli iniettori, compreso temperatura di fusione (Tm), contenuto percentuale di GC (GC %), dimeri dell'iniettore, tornante formazione e idoneità PCR (Figura 1).
  3. Ordinare gli oligonucleotidi primer (oligos) e all'arrivo, risospendere i oligos liofilizzato in dnasi e RNasi gratis acqua ultra-pura per fare le concentrazioni stock di 100 µM in una provetta da centrifuga da 1,5 mL e conservare a-20 ° C per diversi mesi.
  4. Fare diverse aliquote (circa 50 µ l in ogni provetta da 1,5 mL) dello stock primer 100 µM.
    Nota: Questo passaggio viene utilizzato per evitare cicli di gelo-disgelo frequenti.

2. preparare gli standard per la quantificazione del DNA genomico di fago T7

  1. Diluire in serie riferimento 0,1 µ g / µ l (1.0 x 108 fg / µ l) del DNA del fago T7 (acquistato; a una concentrazione nota di 0,1 µ g / µ l, vedi materiali) 10 volte da 1.0 x 106 a 1,0 x 100 fg / µ l con ultra-puro di H2O in provette per PCR 0,2 mL. Preparare ciascuna concentrazione in un volume totale di 20 µ l (Figura 2).
  2. Vortice della PCR provette per garantire la miscelazione accurata in ogni fase di diluizione. Inoltre, modificare suggerimenti quando si aggiunge il campione di DNA per la diluizione seguente.
    Nota: Si consiglia di preparare la nuova soluzione di campioni di DNA per una curva standard per ogni batch dell'esperimento qPCR.
  3. Utilizzare l'equazione 1 (sotto) per convertire per riferimento fago T7 concentrazioni nel DNA da fg / µ l in copie del genoma (gc) /µL (Figura 2).
  4. Concentrazione di DNA fago T7 in gc / µ l =
    Equation 1(1)
    Nota: bp: coppia di basi; riferimento del DNA di genomic T7 è 37314 bp.

3. pre-trattamento dei campioni prima di fago qPCR reazione preparazione

  1. (Opzione 1) Pipettare 20 µ l di un clone di T7 (fago) selezionati da biopanning contro in vitro la fibrosi cistica (CF)-come modello di muco in provette per centrifuga da 1,5 mL. Aggiungere 1,25 unità di dnasi I (0,5 µ l) per ogni 20 µ l di campione.
    Nota: Libreria di T7 dei fagi cisteina eptapeptide vincolata (CX7C) era biopanned contro muco CF-come rivestito su inserti di membrana 24-pozzo (Vedi Tabella materiali) per 15 min. Ulteriori dettagli sono forniti nella sezione risultati. Un clone di T7 è stato scelto per la preparazione del campione di qPCR dall'eluato.
    1. Opzione 2: Dispensare 200 µ l di T7 clonare in un provette da 1,5 mL e aggiungere 5 unità della dnasi I
      (2 µ l) per ciascun campione.
      Nota: Il volume del campione dei fagi selezionato in questa fase dipende dal volume raccolto da biopanning. Mentre l'obiettivo del protocollo è la qPCR di biopanned dei fagi, i passaggi per biopanning sono dettagliate nel protocollo utente del fago T7 kit (Vedi Tabella materiali)13.
  2. Tappare le provette dei campioni fago T7 (punto 3.1) e li Incubare a 37 ° C per 10 min in un bagno secco riscaldato (vale a dire, blocco di calore).
  3. Incubare le provette (dal punto 3.2) a 100 ° C per 15 min in un bagno secco riscaldato (Figura 3A).
    Attenzione: Poiché l'evaporazione e la condensazione si verificano durante la fase di riscaldamento, assicurarsi che le provette da 1,5 mL sono limitate completamente.
  4. Girare i fagi trattato termicamente dal punto 3.3 a 18.534 x g per 10 s. Mix i fagi inserendo il tubo su un Vortex insieme alle modalità di attivazione touch per 10 s e spin a 18.534 x g per 10 s di nuovo.
    Nota: Il ciclo di spin-mix-spin è per assicurarsi che i campioni dei fagi riscaldata sono ben miscelati.
  5. Raffreddare le provette a temperatura ambiente (TA) lasciandoli sul banco di esperimento o conservare a 4 ° C in frigorifero durante la notte.
    Nota: Esperimento può essere messo in pausa in questa fase.

4. preparare qPCR reazioni

Nota: Una reazione di PCR è per un campione. Ogni reazione di PCR contiene 5 µ l di qPCR master mix (Vedi materiali), 1 µ l di miscela di coppia 5 µM primer, 2 µ l di H2O e 2 µ l di campione di fago T7 trattato termicamente. Per le reazioni di PCR multiple, tutti i reagenti tranne campione dei fagi sono premiscelati in una provetta da 1,5 mL. Il volume di ciascun reagente in premix dipende dal numero di campioni dei fagi per qPCR.

  1. Preparare la premiscela qPCR per 10 biopanned dei fagi campioni di concentrazione sconosciuta e 7 campioni di concentrazioni standard in triplice copia. Di conseguenza, ci sono 51 campioni totali e quindi, 51 qPCR reazioni (cioè, una reazione per campione). Per 51 reazioni, preparare una premiscela di 255 µ l di mix master qPCR (51 x 5 µ l), 51 µ l di primer (51 x 1 µ l) e 102 µ l di H2O (51 x 2 µ l).
    Nota: Si consiglia di preparare alcune reazioni di PCR extra per compensare la perdita di volume durante Aliquotare il mix di PCR in ciascun pozzetto della piastra 96 pozzetti qPCR.
  2. Aliquotare 8 µ l di premiscela PCR in ciascun pozzetto della piastra a 96 pozzetti qPCR per un totale di 51 pozzi (cioè, 51 qPCR reazioni). Non c'è nessuna necessità di cambiare suggerimenti durante aliquotare.
  3. Aggiungere 2 µ l di campioni di fago T7 trattato termicamente (punto 3.4) o riferimento di fago T7 DNA (punto 2.1) ad ogni pozzetto (Figura 3B); cambiare suggerimenti quando si aggiungono diversi campioni di DNA al pozzo per evitare la contaminazione incrociata. Inoltre, dispensare i campioni di DNA µ l 2 sotto la superficie di qPCR premix (cioè, nella premiscela PCR 8 µ l).
  4. Sigillare la piastra qPCR con pellicola adesiva.
    Nota: Questo passaggio è fondamentale, indipendentemente dal tipo di piastra qPCR. Utilizzare il kit consigliato per sigillare la piastra completamente; in caso contrario, qualsiasi regione non sealed nella piastra causerà la perdita di volume durante la PCR in bicicletta.
  5. Avvolgere la piastra qPCR con foglio di alluminio per ridurre al minimo la fluorescenza photobleaching e procedere per eseguirlo sulle attrezzature qPCR.

5. qPCR condizioni di escursioni in bicicletta

Nota: qPCR ciclismo condizioni sono state istituite sulle attrezzature specifiche qPCR (Vedi Tabella materiali).

  1. Eseguire la piastra 96 pozzetti qPCR sull'apparecchiatura qPCR. Sulle attrezzature, selezionare impostazioni dal menu per impostare le seguenti condizioni sperimentali (Figura 3).
  2. Impostare condizioni come segue per un volume di campione di 10 µ l di ciclismo: un ciclo a 50 ° C per 2 min, un ciclo a 95 ° C per 2 min, seguiti da 40 cicli di (95 ° C per 15 s, 60 ° C per 1 min). Dopo, eseguire le impostazioni della curva di fusione: un ciclo di 95 ° C per 15 s, 60 ° C per 1 min e 95 ° C 15 s.
  3. Procedere per analizzare i dati come descritto nel passaggio 6.

6. analizzare la qPCR dati grezzi e convertire da qPCR Ct valore in gc / µ l per i batteriofagi T7

  1. Analizzare i dati raw qPCR e valutare la qualità dei dati analizzando i grafici caratteristici dei dati grezzi (Figura 4).
    Nota: Amplificazione trama, trama multicomponente e trama di curva di fusione sono che la caratteristica chiave trame convalidare la qualità dei dati di qPCR.
  2. Calcolare i valori di soglia media ciclo (Ct) dai campioni triplici a ciascuna concentrazione della curva standard (punto 2.1).
    1. Trama media Ct (Y) contro log (gc / µ l) (X) per ottenere la curva lineare Y = kX + b (k è la pendenza della curva lineare, b è l'intercetta).
    2. Calcolare il coefficiente lineare14 R2 (R2 deve essere > 0,99).
  3. Utilizzare la curva standard Y = kX + b per calcolare il numero di T7 fagi nei campioni biopanning (cioè, fagi selezionati contro CF-come muco) in gc / µ l (Figura 5).
    Nota: k è la pendenza della curva standard.
  4. Calcolare l'efficienza di amplificazione dalla seguente equazione
    Equation 2(2)
    Nota: k è la pendenza della curva standard generata da qPCR di DNA di riferimento. La gamma ideale di efficienza di amplificazione è 90 – 110%.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Strumenti di progettazione di differenti dell'iniettore possono essere utilizzati per disegnare primers qPCR. In genere, disegno dell'iniettore di programmi hanno i propri algoritmi incorporati per calcolare e convalidare i parametri chiave del primer, per esempio GC %, Tm, dimero di primer o formazione di tornante, ecc. in generale, i criteri principali sono simili in diverse strumenti di progettazione di primer e primer può essere progettato seguendo le loro istruzioni. Primer BLAST può essere utilizzato per confermare la specificità dei primer. Un iniettore coppia destinato a Monte della regione variabile di T7 del DNA di genomic è illustrato nella Figura 1. Per determinare le concentrazioni sconosciute dei campioni dei fagi da biopanning, un assoluto metodo di quantificazione - quantificazione curva standard - è stato scelto per enumerare le copie di DNA genomiche dei fagi. Riferimento del DNA del fago T7 (Vedi materiali) a una concentrazione nota 0.1 µ g / µ l è stato diluito serialmente da 1.0 x 100 a 1.0 x 106 fg / µ l. equazione 1 è stato utilizzato per convertire il T7 dei fagi del DNA concentrazioni da fg / µ l a copie del genoma (gc) / µ l; le concentrazioni di riferimento T7 dei fagi del DNA erano 2,66 x 101 a 2,66 x 107 gc / µ l (Figura 2).

Dopo la preparazione di diluizioni di riferimento del DNA per la curva standard, uno selezionato CX7C T7 fago è stato preparato per qPCR (Figura 3A). Brevemente, per descrivere il biopanning del fago selezionato: una concentrazione iniziale di 4,2 x 109 pfu T7 CX7C dei fagi è stato aggiunto in cima l'apicale vano (donatore) di un Transwell piastra (Vedi Tabella materiali) contenente 100 µ l di CF-come muco e Soluzione salina tamponata con 600 µ l di fosfato (PBS, Vedi Tabella materiali) nel comparto basolaterale (ricevitore) ed è stato incubato per 15 min a temperatura ambiente (25 ° C). Dopo 15 min, è stato raccolto l'eluato nel ricevitore; dall'eluato, un clone di CX7C T7 è stato selezionato per essere quantificati da qPCR. preparazione di reazione qPCR è stato effettuato su ghiaccio con i reagenti necessari (ad es., qPCR mix master, primer, H2O), come mostrato nella Figura 3B. Le condizioni di ciclismo qPCR sono stata istituite su un termociclatore qPCR per eseguire gli esempi (Vedi Tabella materiali, Figura 3).

Dopo la qPCR eseguire, amplificazione trama, trama di curva di fusione e trama multicomponente (Figura 4) sono stati analizzati dai dati grezzi usando il software (Vedi Tabella materiali). La trama di amplificazione indica il successo o il fallimento di amplificazione di PCR di ogni campione. La trama multicomponente presenta amplificazione e decadimento del segnale di fluorescenza (reporter colorante SYBR e sfondo della tintura ROX) durante i cicli di amplificazione. La trama di curva di fusione viene utilizzata per convalidare la specificità dei primer, dal momento che ogni prodotto PCR ha un'unica temperatura di fusione (Tm).

Dopo la valutazione della qualità dei dati grezzi di qPCR, la curva standard è stata generata dal riferimento del DNA: i valori di Ct (Y) sopra registro gc / µ l (conversione di concentrazione illustrato nella Figura 5); qui, era Y =-3.5188 X + 35,09 (R2= 0,999) (Figura 5A e 5B). L'efficienza di amplificazione è stata calcolata per essere 92,4%. La curva standard è stata utilizzata per interpolare le concentrazioni sconosciute di diluito clone di CX7C fago T7 in base ai loro valori di Ct. Tutti i campioni di riferimento e dei fagi campioni sono stati eseguiti in triplice copia, e loro valori Ct medi sono stati utilizzati per calcolare la concentrazione di DNA in gc / µ l (Figura 5). La soluzione di riserva iniziale del clone T7 è stata diluita serialmente per convalidare la stabilità e ripetibilità di qPCR per l'enumerazione di T7 fagi5. Ad ogni diluizione, i campioni sono stati preparati in triplice copia. Il saggio della placca doppio strato è stato utilizzato come metodo di riferimento per determinare le concentrazioni delle diluizioni T7; metodi sono stati descritti in precedenza5. In Figura 6, i risultati rappresentativi da qPCR sono riportati rispetto al saggio della placca alla collaudata gamma di 10 da1 a 107 gc / µ l. titoli o numero di fagi da qPCR quantificazione erano superiori da saggio della placca doppio strato. La ripetibilità del metodo qPCR è rappresentata dal coefficiente di variazione (CV) per le concentrazioni da 101 a 107 gc / µ l. I risultati sono stati riportati nella tabella 1; il coefficiente di variazione % variato da 2,85 – 27,2%.

Figure 1
Figura 1: disegno di Primer per T7-415 dei fagi del DNA vettore chiave parametri analisi e degli iniettori progettati. Strumenti di progettazione di oligo sono stati utilizzati per progettare più coppie di primers per fago T7-415 del DNA. Un insieme è stato selezionato dopo la convalida dei parametri chiave del primer, per esempio, Tm, GC %, formazione primer-dimero e tornante. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: preparazione della curva Standard e unità di conversione del fago T7 riferimento DNA. Diluizioni seriali 10 volte sono state fatte da 0,1 µ g / µ l T7 dei fagi di riferimento del DNA per una curva standard. Equazione 1 è stato utilizzato per convertire le concentrazioni di DNA da fg / µ l a gc / µ l. per favore clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: trattamento del campione dei fagi, qPCR reazione preparazione e qPCR eseguire. Dnasi pretrattati campioni fago T7 sono stati riscaldati a 100° C per 15 min liberare il DNA di T7 da particelle fagiche intatto (A); la miscela di qPCR è stata preparata come descritto nel protocollo. Tutti i preparativi sono stati fatti su ghiaccio (B); qPCR attrezzature e software compatibili (C) sono stati utilizzati per impostare le condizioni di ciclismo, eseguire i cicli PCR, acquisire e analizzare i dati grezzi. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: caratteristici trame di dati grezzi qPCR. Amplificazione trama, trama multicomponente e trama di curva di fusione sono stati acquisiti dai dati grezzi qPCR di un clone di fago CX7C T7 da biopanning contro in vitro barriera CF-come muco. Nella trama multicomponente, la tintura di riferimento passiva (ROX) è una molecola di colorante inclusa nel mix master qPCR che non partecipa l'amplificazione di PCR e non mostrerà nessun segnale di amplificazione nella trama. SYBR, che è la molecola di colorante verde di SYBR nel mix master qPCR, fornirà un segnale di fluorescenza che dovrebbe amplificare e deperimento durante qPCR in bicicletta. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5: analisi dei dati grezzi di qPCR per calcolare gc / µ l delle particelle dei fagi T7. Soglia del ciclo i valori (Ct) della curva standard di riferimento del fago T7 DNA (Y) sono state tracciate contro trasformazione logaritmo delle concentrazioni note di riferimento DNA in gc / µ l (X) per ottenere la curva standard (A e B). La curva standard è stata utilizzata per calcolare i valori di X (log gc / µ l) delle concentrazioni sconosciute di campioni dei fagi in base ai loro valori di Ct. T7 (C) possono essere calcolate le concentrazioni dei fagi in gc / µ l. Inoltre, il calcolo dell'efficienza di amplificazione qPCR è fornito. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 6
Figura 6: Risultati di sensibilità e ripetibilità di qPCR per enumerare una T7 clonare da biopanning contro in vitro barriera muco simil-CF. Un clone di fago T7 CX7C selezionato da biopanning esperimento in serie è stato diluito in un intervallo di concentrazione (indicata come E1-E7 per rappresentare 10 da1 a 107) e in triplice copia per qPCR e saggio della placca doppio strato. Sia qPCR e saggio della placca doppio strato sono stati usati per quantificare la concentrazione del clone fago T7 ad ogni diluizione. I dati sono stati mostrati in valore medio con la deviazione standard (SD) a ogni scala per ogni gruppo di trattamento. Clicca qui per visualizzare una versione più grande di questa figura.

Ripetibilità
Concentrazione (gc / µ l) Dati di CV in %
10 1 27,2
10 2 7.65
10 3 2.85
10 4 15,7
10 5 15,6
10 6 5.03
10 7 4.71

Tabella 1: ripetibilità del metodo qPCR per un clone di CX7C fago T7. Intra-variabilità è stato testato a scala di quantificazione di 10 da1 a 107 gc / µ l per il clone di T7 del DNA, il coefficiente di variazione (CV) è stato calcolato come rapporto tra la deviazione standard alla media per esprimere la ripetibilità del metodo qPCR. CVs sono stati computati nella gamma di 2,85 – 27,2% alle concentrazioni testate.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Abbiamo sviluppato metodi di qPCR per quantificazione di DNA genomico dei fagi5, e qui abbiamo descritto e adattato un metodo qPCR per enumerare T7 fagi selezionati contro una barriera di CF-come muco. Informazioni minime per le linee guida di pubblicazione di quantitativa Real-Time PCR esperimenti (MIQE) sono stati adattati per sviluppare e validare il metodo qPCR per l'enumerazione di T7 fagi15. Il protocollo che abbiamo sviluppato per quantificare i fagi da esperimenti di biopanning è un approccio efficiente, affidabile ed economico. Il nostro protocollo per la preparazione del campione di qPCR solo usato il trattamento ad alta temperatura (100 ° C, 15 min) della soluzione dei fagi e non richiede passaggi estrazione e purificazione del DNA di fago rispetto a strategie convenzionali11,17, 18. Inoltre, per enumerare più accuratamente le particelle dei fagi, DNasi è stato aggiunto alla soluzione dei fagi prima del trattamento ad alta temperatura per rimuovere non-incapsulato dei fagi del DNA18,19,20. DNA non-incapsulato, residuo nella soluzione dei fagi può provocare dalla mancanza di incapsulamento durante l'amplificazione dei fagi e/o degradazione delle particelle dei fagi. Di conseguenza, per quantificare con precisione il numero di particelle fagiche intatto usando il loro DNA genomic, DNasi pre-trattamento è fondamentale per prevenire artifactually alti valori di copie del genoma dei fagi.

Ci sono numerose considerazioni nello sviluppo e uso di qPCR quantificare con precisione i fagi. Variazione dei dati di qPCR può verificarsi in tutto il protocollo e che segue deve essere considerato per raggiungere accurata enumerazione. È importante garantire la lisi dei fagi con trattamento ad alta temperatura e mantenere provette dei campioni dei fagi in condizioni sigillate per impedire successive fluttuazioni nella concentrazione di campione a causa di evaporazione e condensazione dell'acqua. Un volume totale di reazione di PCR è piccolo e richiede pipette calibrate e abilità di pipettaggio affidabile in ogni fase di preparazione del campione. Durante qPCR ciclismo, affidabile funzione di controllo di temperatura è necessario dati accurati qPCR e calibrazione di routine del termociclatore nello strumento qPCR è necessaria. Per controllare la variazione, passaggi alternativi sono stati descritti nel protocollo. Se l'operatore sperimenta la difficoltà di basso volume pipettaggio, la reazione di PCR totale può essere scalata a 20 o 25 µ l. Oltre la suddetta procedura per la risoluzione, il protocollo richiede che il controllo interno di standard del DNA15,21,22,23. Come metodo di quantificazione assoluta, il coefficiente lineare della curva standard determina la precisione dei dati di enumerazione dei fagi. Utilizzando un DNA di controllo interno nell'esecuzione del campione può minimizzare la variazione dalla preparazione del campione e qPCR attrezzature.

Rispetto ai metodi di quantificazione dei fagi precedentemente descritto, il nostro protocollo consente l'enumerazione di una vasta gamma di concentrazioni dei fagi e può differenziare particelle infettive e non infettive dei fagi con e senza trattamento della dnasi. Inoltre, il nostro protocollo è attraente per un gran numero di campioni, che lo rende più conveniente, efficiente e ad alta velocità di trasmissione rispetto al doppio strato placca analisi e altri metodi di misura.

In sintesi, questo protocollo può essere adattato per enumerare le particelle dei fagi in una varietà di applicazioni, tra cui biopanning in vitro e in vivo , preparazione di DNA libreria dei fagi nel sequenziamento di prossima generazione e ambientale dei fagi contaminazione.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

Questo lavoro è stato supportato da PhRMA Foundation Research Grant Starter e cuore nazionale, polmone e sangue Institute of National Institutes of Health concedere sotto numero premio R01HL138251.

Materials

Name Company Catalog Number Comments
Materials and Reagents
Primers for T7 genomic DNA IDT F: CCTCTTGGGAGGAAGAGATTTG
R: TACGGGTCTCGTAGGACTTAAT
T7 Select packaging control DNA EMD Millipore 69679-1UG
MicroAmp optical 96-well reaction plate ThermoFisher Scientific N8010560
qPCR master mix--Power up SYBR Green master mix Applied biosystems A25742
MicroAmp optical adhesive film kit ThermoFisher Scientific 4313663
T7Select 415-1 Cloning Kit EMD Millipore 70015 User protocols : http://www.emdmillipore.com/US/en/product/T7Select-415-1-Cloning-Kit,EMD_BIO-70015#anchor_USP
DNase I solution ThermoFisher Scientific 90083
24-well transwell plate Corning 3472
UltraPure DNase/RNase-Free Distilled H2O Invitrogen 10977015
Phosphate Buffered Saline (1x) Corning 21040CV
Name Company Catalog Number Comments
Equipments
ViiA7 Real-Time PCR System with Fast 96-Well Block ThermoFisher Scientific 4453535
Heraeus Pico 21 Microcentrifuge ThermoFisher Scientific 75002415
Fisherbrand Digital Vortex Mixer Fisher Scientific 02-215-370
HERMO SCIENTIFIC Multi-Blok Heater ThermoFisher Scientific Model:2001
Sorvall Legend X1 Centrifuge ThermoFisher Scientific 75004220
M-20 Microplate Swinging Bucket Rotor ThermoFisher Scientific 75003624
Name Company Catalog Number Comments
Software
QuantStudio Real-time PCR software ThermoFisher Scientific v1.2
Real-time qPCR primer design IDT
OligoAnalyzer 3.1 IDT

DOWNLOAD MATERIALS LIST

References

  1. Smith, G. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. 228, (4705), 1315-1317 (1985).
  2. Smith, G. P., Petrenko, V. A. Phage Display. Chemical Reviews. 97, (96), 391-410 (1997).
  3. Sergeeva, A., Kolonin, M. G., Molldrem, J. J., Pasqualini, R., Arap, W. Display technologies: Application for the discovery of drug and gene delivery agents. Advanced Drug Delivery Reviews. 58, (15), 1622-1654 (2006).
  4. Dias-Neto, E., et al. Next-generation phage display: Integrating and comparing available molecular tools to enable costeffective high-throughput analysis. PLoS ONE. 4, (12), 1-11 (2009).
  5. Peng, X., Nguyen, A., Ghosh, D. Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR. Journal of Virological Methods. 252, (June 2017), 100-107 (2017).
  6. Khan, M. S., Pande, T., Mvan de Ven, T. G. Qualitative and quantitative detection of T7 bacteriophages using paper based sandwich ELISA. Colloids and Surfaces B: Biointerfaces. 132, 264-270 (2015).
  7. Brasino, M., Lee, J. H., Cha, J. N. Creating highly amplified enzyme-linked immunosorbent assay signals from genetically engineered bacteriophage. Analytical Biochemistry. 470, 7-13 (2014).
  8. Yu, X., Burgoon, M., Shearer, A., Gilden, D. Characterization of phage peptide interaction with antibody using phage mediated immuno-PCR. J immunol Methods. 326, (1-2), 33-40 (2007).
  9. Lehmusvuori, A., Manninen, J., Huovinen, T., Soukka, T., Lamminmäki, U. Homogenous M13 bacteriophage quantification assay using switchable lanthanide fluorescence probes. BioTechniques. 53, (5), 301-303 (2012).
  10. Schlaman, H. R. M., et al. Analysis of interactions of signaling proteins with phage-displayed ligands by fluorescence correlation spectroscopy. Journal of Biomolecular Screening. 13, (8), 766-776 (2008).
  11. Tjhung, K. F., Burnham, S., Anany, H., Griffiths, M. W., Derda, R. Rapid enumeration of phage in monodisperse emulsions. Analytical Chemistry. 86, (12), 5642-5648 (2014).
  12. Reitinger, S., Petriv, O. I., Mehr, K., Hansen, C. L., Withers, S. G. Purification and quantitation of bacteriophage M13 using desalting spin columns and digital PCR. Journal of Virological Methods. 185, (1), 171-174 (2012).
  13. T7Select Biopanning Kit. Millipore Sigma. Available from: https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit,EMD_BIO-70018#anchor_USP (2018).
  14. Schneider, A., Hommel, G., Blettner, M. Linear Regression Analysis. Deutsches Ärzteblatt international. 107, (44), 776-782 (2010).
  15. Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggert, J. The MIQE Guidelines: Minimun information for publication of quantitative real-time PCR experiments. Clinical Chemitry. 55, (4), 611-622 (2009).
  16. Lock, M., Alvira, M. R., Chen, S. -J., Wilson, J. M. Absolute Determination of Single-Stranded and Self-Complementary Adeno-Associated Viral Vector Genome Titers by Droplet Digital PCR. Human Gene Therapy Methods. 25, (2), 115-125 (2014).
  17. Fittipaldi, M., et al. Discrimination of infectious bacteriophage T4 virus by propidium monoazide real-time PCR. Journal of Virological Methods. 168, (1-2), 228-232 (2010).
  18. Lodder, W. J., et al. Reduction of bacteriophage MS2 by filtration and irradiation determined by culture and quantitative real-time RT-PCR. Journal of Water and Health. 11, (2), 256-266 (2013).
  19. Brown-Jaque, M., et al. Antibiotic resistance genes in phage particles isolated from human feces and induced from clinical bacterial isolates. International Journal of Antimicrobial Agents. (2017).
  20. Naveca, F. G., et al. Multiplexed reverse transcription real-time polymerase chain reaction for simultaneous detection of Mayaro, Oropouche, and oropouche-like viruses. Memorias do Instituto Oswaldo Cruz. 112, (7), 510-513 (2017).
  21. Jia, J., et al. Simultaneous detection and differentiation of human parvovirus B19 and human parvovirus 4 by an internally controlled multiplex quantitative real-time PCR. Molecular and Cellular Probes. 36, 50-57 (2017).
  22. Bliem, R., et al. A novel triplex quantitative pcr strategy for quantification of toxigenic and nontoxigenic Vibrio cholerae in aquatic environments. Applied and Environmental Microbiology. 81, (9), 3077-3085 (2015).
  23. Wan, Z., Goddard, N. L. Competition Between Conjugation and M13 Phage Infection in Escherichia coli in the Absence of Selection Pressure: A Kinetic Study. G3 Genes|Genomes|Genetics. 2, (10), 1137-1144 (2012).
PCR quantitativa del batteriofago T7 da Biopanning
Play Video
PDF DOI

Cite this Article

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).More

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter