Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Kvantitativ PCR av T7 Bacteriophage fra Biopanning

doi: 10.3791/58165 Published: September 27, 2018

Summary

En reproduserbare, nøyaktig og tid effektiv kvantitative PCR (qPCR) metode for å liste opp T7 bacteriophage er beskrevet her. Protokollen tydelig beskriver phage genomisk DNA forberedelse, PCR reaksjon forberedelse, qPCR sykling forhold og qPCR dataanalyse.

Abstract

Denne protokollen beskriver bruken av kvantitative PCR (qPCR) til å nummerere T7 phages fra phage utvalg eksperimenter (dvs. "biopanning"). qPCR er en fluorescens tilnærming å kvantifisere DNA, og her er det tilpasset å kvantifisere phage genomer som en proxy for phage partikler. I denne protokollen beskrives lettvinte phage DNA forberedelse metode med høy temperatur varme uten ekstra DNA rensing. Metoden må bare små mengder varmebehandlet phages og små mengder qPCR reaksjonen. qPCR er høy gjennomstrømming og rask, behandle og hente data fra en 96-brønns plate reaksjoner i 2-4 h. forhold til andre phage opplisting tilnærminger, qPCR er mindre tidkrevende. Her qPCR til å Nummerer T7 phages identifisert fra biopanning mot i vitro cystisk fibrose-lignende Slim modell. Metoden qPCR kan utvides for å kvantifisere T7 phages fra andre eksperimenter, inkludert andre typer biopanning (f.eks., immobilisert protein bindende, i vivo phage screening) og andre kilder (f.eks vannsystemer eller kroppsvæsker). I sammendraget, kan denne protokollen endres for å kvantifisere DNA-innkapslet virus.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bacteriophage (phage) teknologien, utviklet av George Smith i 1985, er en kraftig, høy gjennomstrømming tilnærming til å identifisere peptid eller protein ligander mot mål eller reseptorer cellemembranen, sykdom antigener, mobilnettet organeller eller spesifikke organer og vev i de siste to tiår1,2. Her, tilfeldig biblioteker av polypeptides eller enkelt kjede antistoffer vises på frakken proteiner av phages (vanligvis M13 eller T7), og bestemte ligander kan identifiseres fra panorering mot immobilisert proteiner i vitro eller i vivo biologiske systemer gjennom en iterativ utvelgelsesprosessen. Deretter kan ligander kombineres med bildebehandling eller terapeutiske agenter for diagnostisering og behandling av sykdommer3,4. Det er viktig å nøyaktig liste phages i flere trinnene i biopanning: (1) å kvantifisere phages som binder til underlaget og (2) å kvantifisere phages om det er berikelse med hver runde utvalg (phage berikelse angir biopanned phage affinitet for målet). Gjeldende gullstandarden for kvantifisering, tolags plakk analysen, presenterer flere utfordringer; Det er kjedelig, tungvint og potensielt unøyaktige for mange eksempler. Derfor har vår gruppe utviklet en følsom, reproduserbare, nøyaktig og tidseffektive kvantitative polymerase kjedereaksjon (qPCR) metode for å nummerere M13 og T7 phage partikler fra biopanning5.

qPCR er en attraktive og gjennomførbare metoden å tallfeste nøyaktig T7 og M13 phages. Siden hver individuelle phage partikkel kan bare inneholde én kopi av genomisk DNA (dsDNA eller ssDNA), tilsvarer en phage genomet en phage partikkel; kvantifisere antall phage genomer, er det mulig å kvantifisere antall phages. Under qPCR, fluorescerende reporter fargestoffer binde phage genomisk DNA nonspecifically eller spesielt gjennom sekvens-spesifikke primere under PCR forsterkning og fluorescensen signal øker med hver runde forsterkning. Når fluorescens signalet når grenseverdien, som runde/syklus av forsterkning er kjent som den terskel syklusen (Ct). Kjente konsentrasjonen av referanse phage DNA plottes mot Ct verdiene for å etablere en standard kurve. Bruk av standardkurve med Ct verdiene av DNA-prøver, kan konsentrasjonen av phages være interpolert.

Mens mange strategier har vært utviklet og mye brukt om å kvantifisere phages fra biopanning, har hver av dem spesifikke utfordringer. Den mest populære og konvensjonelle metoden er tolags plakk analysen. Her, vert bakterier er infisert med phages forberedt på seriell fortynninger, er belagt på et solid agar substrat og er kledde med agar; phages er nummerert med antall plaketter dannet (dvs. plakk danner enheter eller pfu) på agar tallerkenen. Plakk analysen er følsom men kjedelig, tidkrevende og unøyaktig, spesielt for mange eksempler og med høye konsentrasjoner5. I tillegg er enzym knyttet immunosorbent analyser (ELISA) tilpasset nummerere M13 og T7 phage partikler6,7,8. Her phages på ulike fortynninger er bundet og tatt på et solid substrat (dvs. en microplate), analysert med phage-spesifikke antistoffer og oppdaget med journalister (f.eks enzym følsom kromogent underlag, fluorophores) å bestemme antall phage partikler tilstede. Readouts (f.eks fluorescens, absorbans) av prøver kan brukes å kvantifisere ukjent konsentrasjoner mot phage standarder i kjente konsentrasjoner. Forskjellige phage-baserte ELISAs har blitt utviklet, men de har potensielle begrensninger. En gruppe utviklet en papirbasert sandwich ELISA med et kvantifisering område som spredte syv størrelsesordener (102-109 pfu/mL); men denne metoden krevde flere trinn av antistoff belegg og tok opp til en hel dag for analysen8. Vår gruppe også utviklet en ELISA metode for å kvantifisere M13 phage partikler, men hadde en mindre sensitive rekkevidde på 106  1011 pfu/mL5. Valgbar transisjonsmetall fluorescens sonder er utviklet for å nummerere M13 og kvantifisering data kan hentes innen 20 min; Denne analysen har imidlertid et lite dynamisk område med 109 til 1012 pfu/mL9. En gruppe brukt atomic force mikroskopi nummerere M13 phage partikler i løsningen, men dette krever avansert elektronmikroskop og bare jobbet innenfor et lite område med konsentrasjoner10. En annen studie brukes monodisperse emulsjoner å felle fluorescerende M13 og T4 reporter phages og telle phages på antall fluorescerende dråper; men denne tilnærmingen også utstilt en smal kvantifisering varierer fra 102 til 106 pfu/mL11. Mens slippverktøy digital PCR har blitt brukt om å kvantifisere M13 phages, er denne tilnærmingen stand til å skille mellom den smittsomme og ikke-smittsomme phage partikler12.

Vår gruppe har nylig utviklet qPCR metoder for å liste opp T7 og M13 phages identifisert fra biopanning mot en blod - hjerne barrieren celle modell bruker to ulike fluorescerende reporter fargestoffer5. Sammenlignet med nevnte kvantifisering metoder, qPCR metodene vi utviklet var høy gjennomstrømming og tidkrevende å kvantifisere mange eksempler og kunne skille mellom infeksjonssykdommer og ikke-smittsomme phages med DNase jeg pre-behandling av den phage prøver. Viktigere, kan denne tilnærmingen reproduserbar og nøyaktig kvantifisere M13 og T7 bacteriophages fra biopanning prøver. For å veilede nybegynnere forskere innen phage qPCR, beskriver her vi en detaljert qPCR metode for å liste opp T7 phage partikler fra et cystein begrenset bibliotek (CX7C) panorert mot en i vitro cystisk fibrose (CF) slim-barriere. Fra dette arbeidet, kan qPCR metoden utvides for å kvantifisere phage partikler fra andre typer biopanning og fra andre kilder, inkludert vann, jord og kroppsvæsker.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. primer Design og analyse for T7 Phage genomisk DNA

  1. Utforme primere for forsterkning av T7 phage genomisk DNA.
    Merk: F (fremover) og R (bakover) primer (se Tabell for materiale) forsterke T7 DNA sekvensen ligger oppstrøms av biblioteket variable regionen (figur 1).
  2. Velg en passende primer analyserer evaluere parametere primerne, inkludert Smeltetemperaturen (Tm), prosent GC innhold (GC %), primer dimers, hårnål formasjon og PCR egnethet (figur 1).
  3. Bestille primer oligonucleotides (oligos), og ved ankomst, resuspend den lyofilisert oligos i DNase og RNase gratis ultra rent vann å gjøre 100 µM lager konsentrasjoner i en 1,5 mL sentrifuge rør, og lagre på 20 ° C i flere måneder.
  4. Gjør flere dele (rundt 50 µL i hver 1,5 mL tube) 100 µM primer aksjen.
    Merk: Dette trinnet er brukt til å forebygge hyppige fryse-Tin sykluser.

2. Forbered standarder for kvantifisering av T7 Phage genomisk DNA

  1. Serielt fortynne 0,1 µg/µL (1.0 x 108 fg/µL) referanse T7 phage DNA (kjøpt, på en kjent konsentrasjon av 0,1 µg/µL, se materialer) 10 ganger 1.0 x 106 1.0 x 100 fg/µL med ultra ren H2O i 0,2 mL PCR rør. Forberede hver konsentrasjon i et totalvolum på 20 µL (figur 2).
  2. Virvelen av PCR rør for å sikre grundig blande på hvert trinn av fortynning. Også endre tips når du legger til DNA-prøve følgende fortynning.
    Merk: Det anbefales å forberede ny løsning av DNA standarder en standardkurven for hver gruppe med qPCR eksperimentet.
  3. Bruk formel 1 (nedenfor) vil konvertere T7 phage referanse DNA konsentrasjoner fra fg/µL genomet kopier (gc) /µL (figur 2).
  4. T7 phage DNA konsentrasjon i gc/µL =
    Equation 1(1)
    Merk: bp: base nøkkelparet. referansen T7 genomisk DNA er 37314 bp.

3. pre-behandling av prøvene før du Phage qPCR reaksjon forberedelse

  1. (Alternativ 1) Pipetter 20 µL av en T7 klone (phage) valgt fra biopanning mot i vitro cystisk fibrose (CF)-som mucus modell i 1,5 mL sentrifuge rør. Legge til 1,25 enheter av DNase I (0,5 µL) til hvert 20 µL utvalg.
    Merk: T7 phage cystein begrenset heptapeptide biblioteket (CX7C) var biopanned mot CF-lignende Slim belagt på 24-vel membran inserts (se Tabell for materiale) i 15 min. Ytterligere detaljer finnes på resultatinndelingen. En T7 klone ble valgt qPCR eksempel forberedelse fra eluate.
    1. Alternativ 2: Pipetter 200 µL av T7 klone inn en 1,5 mL rørene og legge 5 enheter av DNase jeg
      (2 µL) til hvert utvalg.
      Merk: Volumet av phage eksempel valgt på dette trinnet avhenger samlet fra biopanning. Mens fokus for protokollen er på qPCR av biopanned phage, kit trinnene for biopanning er detaljert i bruker protokollen for T7 phage (se Tabell for materiale)13.
  2. Cap T7 phage eksempel rør (trinn 3.1) og ruge dem ved 37 ° C i 10 min i en oppvarmet tørr bad (dvs. varme blokk).
  3. Inkuber rør (fra trinn 3.2) ved 100 ° C i 15 minutter i en oppvarmet tørr bad (figur 3A).
    Advarsel: Siden fordampning og kondensasjon oppstår under oppvarming trinnet, kontroller at 1,5 mL sentrifuge rørene er satt helt.
  4. Spinne de varmebehandlet phages fra trinn 3.3 18,534 x g for 10 s. blanding phages ved å plassere røret på en vortex mikser satt på touch-aktivisering modus for 10 s og spinn på 18,534 x g for 10 s igjen.
    Merk: Spin-mix-spin syklus er å sikre at de oppvarmede phage prøvene er godt blandet.
  5. Avkjøl eksempel rør ved romtemperatur (RT) ved å gi dem på eksperimentet benk eller butikken på 4 ° C i kjøleskap over natten.
    Merk: Eksperiment kan pauses på dette trinnet.

4. forberede qPCR reaksjoner

Merk: En PCR reaksjon er ett eksempel. Hver PCR reaksjon inneholder 5 µL qPCR Master blande (se materialer), 1 µL av 5 µM primer par mix, 2 µL av H2O og 2 µL av varmebehandlet T7 phage prøve. For flere PCR reaksjoner, er alle reagenser bortsett phage smake Forhåndsblandet i en 1,5 mL tube. Volumet av hver reagensen i premix avhenger av phage prøver for qPCR.

  1. Forberede qPCR premix 10 biopanned phage prøver av ukjent konsentrasjon og 7 prøver av standard konsentrasjoner i tre eksemplarer. Følgelig finnes 51 totale prøver og derfor 51 qPCR reaksjoner (dvs. en reaksjon per prøve). For 51 reaksjoner, forberede en premix av 255 µL qPCR master mix (51 x 5 µL), 51 µL av primere (51 x 1 µL) og 102 µL av H2O (51 x 2 µL).
    Merk: Det anbefales å forberede noen ekstra PCR reaksjoner å kompensere for volum tap under aliquoting PCR blandingen i hver brønn av 96-brønnen qPCR plate.
  2. Aliquot 8 µL av PCR premix i hver brønn av 96-brønnen qPCR plate for totalt 51 (dvs. 51 qPCR reaksjoner). Det er ikke nødvendig å endre tips under aliquoting.
  3. Tilsett 2 µL av varmebehandlet T7 phage prøver (trinn 3.4) eller T7 phage referanse DNA (trinn 2.1) hver brønn (figur 3B); endre tips når forskjellige DNA-prøver til godt for å unngå kryss-smitte. Også dispensere 2 µL DNA-prøvene under overflaten av qPCR premix (dvs. i 8 µL PCR premix).
  4. Forsegle qPCR platen med selvklebende folien.
    Merk: Dette trinnet er kritisk, uavhengig av qPCR plate. Bruk den anbefalte kit å forsegle platen helt; ellers, en ikke-forseglet region i platen vil føre volum tap under PCR sykling.
  5. Pakk qPCR platen med aluminiumsfolie å minimere fluorescens photobleaching og fortsette å kjøre den på qPCR utstyret.

5. qPCR sykling forhold

Merk: qPCR sykling betingelser ble satt opp på bestemt qPCR utstyret (se Tabell for materiale).

  1. Kjør 96-brønnen qPCR platen på qPCR utstyret. Velg innstillinger på menyen for å sette opp følgende eksperimentelle forhold (Figur 3 c) på utstyret.
  2. Definere sykling forhold som følger for et eksempel volum på 10 µL: en syklus ved 50 ° C i 2 minutter, en syklus på 95 ° C i 2 minutter, etterfulgt av 40 sykluser av (95 ° C i 15 s, 60 ° C i 1 min). Etter kjøre smelte kurve innstillinger: en syklus av 95 ° C for 15 s, 60 ° C i 1 min, og 95 ° C 15 s.
  3. Fortsette å analysere dataene som beskrevet i trinn 6.

6. analysere qPCR rådata og konvertere fra qPCR Ct verdien til gc/µL for T7 Bacteriophages

  1. Analysere rå qPCR dataene og evaluere datakvaliteten ved å analysere karakteristiske plott av rådata (Figur 4).
    Merk: Forsterkning plot, multicomponent plot og smelte kurve tomten er den viktigste karakteristiske tomter til å validere datakvaliteten på qPCR.
  2. Beregne mener terskelen syklus (Ct) verdier fra tre eksemplarer prøvene på hver konsentrasjon av standardkurve (trinn 2.1).
    1. Tomt betyr Ct (Y) mot Logg (gc/µL) (X) for å få den lineær kurven Y = kX + b (k er stigningstallet for den lineære kurven, b er skjæringspunktet).
    2. Beregne lineær koeffisienten14 R2 (R2 må være > 0,99).
  3. Bruke standardkurven Y = kX + b for å beregne hvor mange T7 phages i biopanning prøver (dvs. phages valgt mot CF-lignende Slim) i gc/µL (figur 5).
    Merk: k er skråningen av standardkurve.
  4. Beregn forsterking effektiviteten med følgende ligning
    Equation 2(2)
    Merk: k er skråningen av standardkurve generert fra referanse DNA qPCR. Den ideelle forsterkning effektivitet er 90-110%.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Forskjellige primer verktøy kan brukes til å utforme qPCR primere. Vanligvis primer design programmer har sin egen innebygde algoritmer for å Beregn og Valider nøkkelparameterne grunning, f.eks GC %, Tm, primer dimer eller hårnål formasjon, etc. generelt, de viktigste kriteriene er lignende i ulike primer verktøy og primere kan utformes fulgt sine instruksjoner. Primer BLAST kan brukes til å bekrefte spesifisitet primerne. En primer par mot oppstrøms av variable regionen av T7 genomisk DNA er vist i figur 1. For å finne ukjente konsentrasjonen av phage prøver fra biopanning, en absolutt ble kvantifisering tilnærming - standardkurve kvantifisering - valgt til å nummerere phage genomisk DNA kopiene. Refererer til T7 phage DNA (se materialer) i en kjent konsentrasjon 0,1 µg/µL var serielt utvannet 1.0 x 100 til 1.0 x 106 fg / µL. Formel 1 ble brukt til å konvertere T7 phage DNA konsentrasjoner fra fg/µL genomet kopier (gc) / µL; Referanse T7 phage DNA konsentrasjoner ble 2,66 x 101 til 2,66 x 107 gc/µL (figur 2).

Etter forbereder fortynninger av referanse DNA standardkurven, var en valgt CX7C T7 phage forberedt på qPCR (figur 3A). Kort, å beskrive biopanning av den valgte phage: en innledende konsentrasjon av 4,2 x 109 pfu T7 CX7C phage ble lagt på apikale kupé (giveren) av en Transwell plate (se Tabell for materiale) inneholder 100 µL av CF-lignende Slim og 600 µL av fosfat bufret saltvann (PBS, se Tabellen for materiale) i basolateral rommet (mottaker) og ble inkubert i 15 min ved romtemperatur (25 ° C). Etter 15 min, ble eluate i mottakeren innsamlet til, fra eluate, ble en CX7C T7 klone valgt til å være kvantifisert ved qPCR. qPCR reaksjon forberedelse ble utført på isen med nødvendig reagenser (f.eks qPCR master mix, primere, H2O), som vist i figur 3B. QPCR sykling forholdene ble satt opp på en qPCR thermocycler å kjøre prøvene (se Tabell av materialer, Figur 3 c).

Etter qPCR kjøre, forsterkning plot, smelte kurve plot og multicomponent plot (Figur 4) ble analysert fra rå data ved hjelp av programvaren (se Tabell for materiale). Forsterkning handlingen angir suksess eller fiasko av PCR forsterkning av hvert utvalg. Multicomponent handlingen presenterer forsterkning og forfall fluorescens signal (reporter fargestoff SYBR og bakgrunn ROX fargestoff) gjennom forsterkning sykluser. Smelt kurve tomten brukes til å validere spesifisitet primerne siden hver PCR produktet har en unik Smeltetemperaturen (Tm).

Etter evaluering av qPCR rådata kvalitet, standardkurven ble generert fra referanse DNA: Ct verdiene (Y) over Logg gc/µL (konsentrasjon konvertering er vist i figur 5); Her var det Y =-3.5188 X + 35.09 (R-2= 0.999) (figur 5A og 5B). Forsterkning effektiviteten var beregnet til 92,4%. Standardkurven ble brukt til interpolere ukjent konsentrasjoner av fortynnet T7 phage CX7C klone basert på Ct-verdiene. Alle referanse prøver og phage prøver ble kjørt i tre eksemplarer, og deres betyr Ct verdier som ble brukt til å beregne DNA konsentrasjon i gc/µL (figur 5). Den første lager løsningen av T7 klone var serielt utvannet for å validere stabilitet og repeatability av qPCR for opplistingen T7 phages5. På hver fortynning, ble prøver utarbeidet i tre eksemplarer. Tolags plakk analysen ble brukt som referanse for å bestemme konsentrasjonen av T7 fortynninger; metodene beskrevet tidligere5. Figur 6, representant resultatene fra qPCR vises i forhold til plakk analysen på testet området 101 til 107 gc / µL. Titers eller antall phages fra qPCR kvantifisering var høyere enn fra tolags plakk analysen. Repeatability av metoden qPCR representeres av koeffisient av varians (CV) for konsentrasjoner 101 til 107 gc/µL. Resultatene ble vist i tabell 1. CV % varierte fra 2,85-27,2%.

Figure 1
Figur 1: Primer design for T7-415 phage DNA vektor og nøkkel parametere analyse designet primerne. Oligo verktøy ble brukt til å utforme flere par av primere for T7-415 phage DNA. Ett sett ble valgt etter validering av nøkkelparameterne grunning, f.eks Tm, GC %, primer-dimer og hårnål formasjon. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: standardkurven forberedelse og enhet konvertering av T7 phage referanse DNA. Seriell 10 ganger fortynninger ble gjort fra 0,1 µg/µL T7 phage referanse DNA for en standard kurve. Formel 1 ble brukt til å konvertere DNA konsentrasjoner fra fg/µL til gc / µL. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: Phage prøve behandling, qPCR reaksjon forberedelse og qPCR kjøre. DNase jeg forbehandlet T7 phage prøver ble oppvarmet ved 100° C i 15 min å løslate T7 DNA fra intakt phage partikler (A); qPCR blandingen ble utarbeidet som beskrevet i protokollen. Alle forberedelsene ble gjort på is (B); qPCR utstyr og kompatibel programvare (C) ble brukt til å definere sykling betingelsene, kjøre PCR sykluser, hente og analysere rådataene. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: karakteristisk tomter qPCR rådata. Forsterkning plot, multicomponent plot og smelte kurve tomten anskaffet fra qPCR rådata om en T7 phage CX7C klone fra biopanning mot i vitro CF-lignende Slim barriere. I multicomponent plottet er passiv referanse fargestoff (ROX) et fargestoff molekyl i qPCR master mix som ikke deltar i PCR forsterkning og viser ingen signal forsterkning i plottet. SYBR, som er SYBR grønt fargebad molekyl i qPCR master mix, vil gi en fluorescens signal som skal forsterke og forfalle under qPCR sykling. Klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: analyse av rådata om qPCR til å beregne gc/µL T7 phage partikler. Terskelen syklus (Ct) verdier av standardkurve T7 phage referanse DNA (Y) var plottet mot logaritmen transformasjon av kjente konsentrasjonen av referanse DNA i gc/µL (X) for å få standardkurven (A og B). Standardkurven ble brukt til å beregne X (Logg gc/µL) verdiene av ukjent konsentrasjonen av phage eksempler basert på Ct-verdiene. (C) T7 phage konsentrasjoner i gc/µL kan beregnes. Også er beregningen av qPCR forsterkning effektivitet gitt. Klikk her for å se en større versjon av dette tallet.

Figure 6
Figur 6: Følsomhet og repeterbarhet resultatene qPCR nummerere en T7 klone fra biopanning mot i vitro CF-lignende Slim barriere. En T7 CX7C phage klone valgte fra biopanning eksperiment ble serielt fortynnet i mange konsentrasjon (som E1-E7 representerer 101 til 107) og tre eksemplarer for qPCR og tolags plakk analysen. Både qPCR og tolags plakk analysen ble brukt om å kvantifisere konsentrasjonen av T7 phage klone på hver fortynning. Data ble vist i middelverdien med standardavviket (SD) på hver skala for hver behandling. Klikk her for å se en større versjon av dette tallet.

Repeterbarhet
Konsentrasjon (gc/µL) CV-data i %
10 1 27,2
10 2 7.65
10 3 2,85
10 4 15.7
10 5 15,6
10 6 5.03
10 7 4,71

Tabell 1: Repeatability av metoden qPCR for en T7 phage CX7C klone. Intra-variasjon ble testet på kvantifisering skala fra 101 til 107 gc/µL for T7 klone DNA, variasjonskoeffisienten (CV) beregnet som forholdet mellom standardavviket middelverdien uttrykke repeatability av metoden qPCR. CVs ble beregnet i størrelsesorden 2.85-27,2% på for testet konsentrasjoner.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vi utviklet qPCR metoder for å kvantifisere phage genomisk DNA5, og her vi beskrev og tilpasset en qPCR metode for å liste opp T7 phages valgt mot en CF-lignende Slim barriere. Minimum informasjon om retningslinjer for publisering av kvantitative Real-Time PCR eksperimenter (MIQE) ble tilpasset for å utvikle og validere metoden qPCR for opplisting T7 phages15. Protokollen vi utviklet for å kvantifisere phages fra biopanning eksperimenter er en tidkrevende, pålitelig og økonomisk tilnærming. Våre Protokoll for qPCR prøve forberedelse bare brukt høy temperatur behandling (100 ° C, 15 min) phage løsningen og krever ikke phage DNA utvinning og rensing trinnene sammenlignet med konvensjonelle strategier11,17, 18. Også å mer nøyaktig nummerere phage partikler, ble DNase lagt til den phage løsningen før høy temperatur behandlingen å fjerne ikke-kapslet phage DNA18,19,20. Ikke-kapslet, gjenværende DNA i phage løsningen kan føre til mangel på innkapsling under phage forsterkning og/eller nedbrytning av phage partikler. Resultatet for å nøyaktig måle antall intakt phage partikler bruker genomisk DNA, er DNase pre-behandling avgjørende å hindre artifactually høye verdier av phage genomet kopier.

Det er mange hensyn i utvikling og bruk av qPCR å tallfeste nøyaktig phages. Variant av qPCR data kan oppstå gjennom protokollen og følgende må anses å oppnå nøyaktig opplisting. Det er viktig å sikre phage lyse med høy temperatur behandling og holde phage eksempel rør i forseglet betingelser for å forhindre påfølgende svingninger i prøven konsentrasjon på grunn av fordampning og kondensasjon vann. Et totalt volum på PCR reaksjon er liten og krever kalibrert Pipetter for flergangsbruk og pålitelig pipettering dyktighet i hvert trinn av prøven forberedelse. Under qPCR sykling, pålitelig temperatur kontroll funksjonen er nødvendig for nøyaktig qPCR data og rutinemessig kalibrering av termisk cycler i qPCR apparatet er nødvendig. Bestemme variasjoner, ble alternative fremgangsmåten beskrevet i protokollen. Hvis operatoren opplever problemer med lavt volum pipettering, kan totalt PCR reaksjonen skaleres til 20 eller 25 µL. Foruten de nevnte trinnene for feilsøking krever protokollen internkontroll standard DNA15,21,22,23. Som en absolutt kvantifisering metode bestemmer lineær koeffisient av standardkurve nøyaktigheten av phage-nummerering dataene. Bruke en intern kontroll DNA i prøven kjøre kan minimere variasjon fra prøven forberedelse og qPCR utstyr.

Sammenlignet med tidligere beskrevet phage kvantifisering metoder, vår protokollen tillater opplisting av en rekke phage konsentrasjoner og kan skille infeksjonssykdommer og ikke-smittsomme phage partikler med og uten DNase behandling. Våre protokollen er også attraktivt for kvantifisere mange prøver, noe som gjør det mer kostnadseffektiv, tidseffektive og høy gjennomstrømning sammenlignet med dobbelt lag plakk analysen og andre metoder.

I sammendraget, kan denne protokollen tilpasses til å nummerere phage partikler i en rekke programmer, inkludert i vitro og vivo biopanning, phage biblioteket DNA forberedelser i neste generasjons sekvensering, og miljømessige phage forurensning.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Dette arbeidet ble støttet av PhRMA Foundation Starter forskningsstipend og nasjonale hjerte, lunge og blod Institutt for National Institutes of Health gi prisen nummer R01HL138251.

Materials

Name Company Catalog Number Comments
Materials and Reagents
Primers for T7 genomic DNA IDT F: CCTCTTGGGAGGAAGAGATTTG
R: TACGGGTCTCGTAGGACTTAAT
T7 Select packaging control DNA EMD Millipore 69679-1UG
MicroAmp optical 96-well reaction plate ThermoFisher Scientific N8010560
qPCR master mix--Power up SYBR Green master mix Applied biosystems A25742
MicroAmp optical adhesive film kit ThermoFisher Scientific 4313663
T7Select 415-1 Cloning Kit EMD Millipore 70015 User protocols : http://www.emdmillipore.com/US/en/product/T7Select-415-1-Cloning-Kit,EMD_BIO-70015#anchor_USP
DNase I solution ThermoFisher Scientific 90083
24-well transwell plate Corning 3472
UltraPure DNase/RNase-Free Distilled H2O Invitrogen 10977015
Phosphate Buffered Saline (1x) Corning 21040CV
Name Company Catalog Number Comments
Equipments
ViiA7 Real-Time PCR System with Fast 96-Well Block ThermoFisher Scientific 4453535
Heraeus Pico 21 Microcentrifuge ThermoFisher Scientific 75002415
Fisherbrand Digital Vortex Mixer Fisher Scientific 02-215-370
HERMO SCIENTIFIC Multi-Blok Heater ThermoFisher Scientific Model:2001
Sorvall Legend X1 Centrifuge ThermoFisher Scientific 75004220
M-20 Microplate Swinging Bucket Rotor ThermoFisher Scientific 75003624
Name Company Catalog Number Comments
Software
QuantStudio Real-time PCR software ThermoFisher Scientific v1.2
Real-time qPCR primer design IDT
OligoAnalyzer 3.1 IDT

DOWNLOAD MATERIALS LIST

References

  1. Smith, G. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. 228, (4705), 1315-1317 (1985).
  2. Smith, G. P., Petrenko, V. A. Phage Display. Chemical Reviews. 97, (96), 391-410 (1997).
  3. Sergeeva, A., Kolonin, M. G., Molldrem, J. J., Pasqualini, R., Arap, W. Display technologies: Application for the discovery of drug and gene delivery agents. Advanced Drug Delivery Reviews. 58, (15), 1622-1654 (2006).
  4. Dias-Neto, E., et al. Next-generation phage display: Integrating and comparing available molecular tools to enable costeffective high-throughput analysis. PLoS ONE. 4, (12), 1-11 (2009).
  5. Peng, X., Nguyen, A., Ghosh, D. Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR. Journal of Virological Methods. 252, (June 2017), 100-107 (2017).
  6. Khan, M. S., Pande, T., Mvan de Ven, T. G. Qualitative and quantitative detection of T7 bacteriophages using paper based sandwich ELISA. Colloids and Surfaces B: Biointerfaces. 132, 264-270 (2015).
  7. Brasino, M., Lee, J. H., Cha, J. N. Creating highly amplified enzyme-linked immunosorbent assay signals from genetically engineered bacteriophage. Analytical Biochemistry. 470, 7-13 (2014).
  8. Yu, X., Burgoon, M., Shearer, A., Gilden, D. Characterization of phage peptide interaction with antibody using phage mediated immuno-PCR. J immunol Methods. 326, (1-2), 33-40 (2007).
  9. Lehmusvuori, A., Manninen, J., Huovinen, T., Soukka, T., Lamminmäki, U. Homogenous M13 bacteriophage quantification assay using switchable lanthanide fluorescence probes. BioTechniques. 53, (5), 301-303 (2012).
  10. Schlaman, H. R. M., et al. Analysis of interactions of signaling proteins with phage-displayed ligands by fluorescence correlation spectroscopy. Journal of Biomolecular Screening. 13, (8), 766-776 (2008).
  11. Tjhung, K. F., Burnham, S., Anany, H., Griffiths, M. W., Derda, R. Rapid enumeration of phage in monodisperse emulsions. Analytical Chemistry. 86, (12), 5642-5648 (2014).
  12. Reitinger, S., Petriv, O. I., Mehr, K., Hansen, C. L., Withers, S. G. Purification and quantitation of bacteriophage M13 using desalting spin columns and digital PCR. Journal of Virological Methods. 185, (1), 171-174 (2012).
  13. T7Select Biopanning Kit. Millipore Sigma. Available from: https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit,EMD_BIO-70018#anchor_USP (2018).
  14. Schneider, A., Hommel, G., Blettner, M. Linear Regression Analysis. Deutsches Ärzteblatt international. 107, (44), 776-782 (2010).
  15. Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggert, J. The MIQE Guidelines: Minimun information for publication of quantitative real-time PCR experiments. Clinical Chemitry. 55, (4), 611-622 (2009).
  16. Lock, M., Alvira, M. R., Chen, S. -J., Wilson, J. M. Absolute Determination of Single-Stranded and Self-Complementary Adeno-Associated Viral Vector Genome Titers by Droplet Digital PCR. Human Gene Therapy Methods. 25, (2), 115-125 (2014).
  17. Fittipaldi, M., et al. Discrimination of infectious bacteriophage T4 virus by propidium monoazide real-time PCR. Journal of Virological Methods. 168, (1-2), 228-232 (2010).
  18. Lodder, W. J., et al. Reduction of bacteriophage MS2 by filtration and irradiation determined by culture and quantitative real-time RT-PCR. Journal of Water and Health. 11, (2), 256-266 (2013).
  19. Brown-Jaque, M., et al. Antibiotic resistance genes in phage particles isolated from human feces and induced from clinical bacterial isolates. International Journal of Antimicrobial Agents. (2017).
  20. Naveca, F. G., et al. Multiplexed reverse transcription real-time polymerase chain reaction for simultaneous detection of Mayaro, Oropouche, and oropouche-like viruses. Memorias do Instituto Oswaldo Cruz. 112, (7), 510-513 (2017).
  21. Jia, J., et al. Simultaneous detection and differentiation of human parvovirus B19 and human parvovirus 4 by an internally controlled multiplex quantitative real-time PCR. Molecular and Cellular Probes. 36, 50-57 (2017).
  22. Bliem, R., et al. A novel triplex quantitative pcr strategy for quantification of toxigenic and nontoxigenic Vibrio cholerae in aquatic environments. Applied and Environmental Microbiology. 81, (9), 3077-3085 (2015).
  23. Wan, Z., Goddard, N. L. Competition Between Conjugation and M13 Phage Infection in Escherichia coli in the Absence of Selection Pressure: A Kinetic Study. G3 Genes|Genomes|Genetics. 2, (10), 1137-1144 (2012).
Kvantitativ PCR av T7 Bacteriophage fra Biopanning
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).More

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter