Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Kvantitativ PCR av T7 Bacteriophage från Biopanning

doi: 10.3791/58165 Published: September 27, 2018

Summary

En reproducerbar, korrekt och tid effektiv kvantitativ PCR (qPCR) metod att räkna upp T7 bacteriophage beskrivs här. Protokollet beskrivs tydligt phage genomisk DNA förberedelse, PCR-reaktion förberedelse, qPCR cykling villkor och qPCR dataanalys.

Abstract

Det här protokollet beskriver användningen av kvantitativ PCR (qPCR) att räkna upp T7 fagocyt från phage urval experiment (dvs, ”biopanning”). qPCR är en fluorescens-baserad metod för att kvantifiera DNA, och här är det anpassat till kvantifiera phage genomen som en proxy för phage partiklar. I detta protokoll beskrivs en lättköpt phage DNA förberedelse metod med hög temperatur värme utan ytterligare DNA-rening. Metoden behöver bara små volymer av värmebehandlad fagocyt och små volymer av qPCR reaktionen. qPCR är hög genomströmning och snabb, bearbeta och få data från en plattan med 96 brunnar av reaktioner i 2 – 4 h. jämfört med andra phage uppräkning synsätt, qPCR är mer tidseffektivt. Här används qPCR att räkna upp T7 fagocyt identifierade från biopanning mot i vitro cystisk fibros-liknande slem modell. Metoden qPCR kan utvidgas till att kvantifiera T7 fagocyt från andra experiment, inklusive andra typer av biopanning (t.ex., orörlig proteinbindning, invivo phage screening) och andra källor (t.ex. vattensystem eller kroppsvätskor). Sammanfattningsvis kan detta protokoll ändras för att kvantifiera eventuella DNA-inkapslade virus.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bacteriophage (fag) displayteknik, utvecklad av George Smith 1985, är en kraftfull, hög genomströmning metod att identifiera peptid eller protein ligander mot mål eller receptorer från cellmembranet, antigener, cellulära organeller eller specifika organ och vävnader i senaste två decennierna1,2. Här random bibliotek av polypeptider eller enda kedja antikroppar visas på pälsen proteiner av Fager (vanligtvis M13 eller T7) och specifika ligander kan identifieras från panorering mot immobiliserade proteiner in vitro- eller in vivo biologiska system genom en iterativ urvalsprocess. Ligander kan sedan kopplas till imaging eller terapeutiska agens för diagnos och behandling av sjukdomar3,4. Det är viktigt att noggrant räkna upp Fager under flera steg av biopanning: (1) för att kvantifiera Fager som binder till underlaget och (2) för att kvantifiera fagocyt för att avgöra om det finns berikning med varje omgång av urval (phage anrikning indikerar biopanned phage affinitet för målet). Nuvarande guldmyntfoten för kvantifiering, dubbla lager plack assay, presenterar flera utmaningar; Det är tråkiga, besvärliga och potentiellt felaktiga för ett stort antal prover. Vår grupp har därför utvecklat en känslig, reproducerbara, korrekt och tidseffektiv kvantitativa polymerase chain reaktion (qPCR) metod för att räkna upp M13 och T7 phage partiklar från biopanning5.

qPCR är en attraktiv och genomförbar metod att exakt kvantifiera T7 och M13 Fager. Eftersom varje enskild phage partikel kan endast innehålla en kopia av genomisk DNA (dsDNA eller ssDNA), är en phage genomet motsvarande en phage partikel; kvantifiera antalet phage genomen, är det möjligt att kvantifiera antalet Fager. Under qPCR, fluorescerande reporter färgämnen binder phage genomiskt DNA icke-specifikt eller särskilt genom sekvens-specifika primers under PCR-amplifiering, och fluorescensen signal ökar med varje runda av förstärkning. När fluorescens signalen når tröskeln, som runda/cykel av förstärkning noteras som tröskel cykeln (Ct). De kända koncentrationerna av referens phage DNA ritas mot sin Ct-värden att upprätta en standardkurva. Med standardkurvan med Ct värdena av DNA-prover, kan koncentrationerna av fagocyt interpoleras.

Medan många strategier har tidigare utvecklats och i stor utsträckning använts för att kvantifiera fagocyt från biopanning, har alla av dem särskilda utmaningar. Den mest populära och konventionella metoden är dubbla lager plack assay. Här, värd bakterier är infekterade med fagocyt beredd på seriespädningar, är pläterade på en solid agar substrat och överdras med agar; Fager är uppräknade med antalet plack bildas (dvs plack bildar enheter eller pfu) på en agarplatta. Plack-analysen är känslig men tråkiga, tidskrävande och felaktig, särskilt för många prover och med höga koncentrationer5. Dessutom har enzyme-linked immunosorbent assays (ELISA) anpassats till räkna upp M13 och T7 phage partiklar6,7,8. Här, Fager på olika spädningar är bundna och fångas på ett fast underlagsmaterial (dvs. en mikroplattan), utforskad med phage-specifika antikroppar och påvisas med hjälp av reportrar (t.ex. enzymet känsliga kromogent substrat, fluorophores) till bestämma antalet phage partiklar. Avläsning (t.ex. fluorescens, absorbans) prover kan användas för att kvantifiera okända koncentrationer mot phage standarder på kända koncentrationer. Olika phage-baserade Elisatest har utvecklats men de har potentiella begränsningar. En grupp utvecklat en pappersbaserade sandwich-ELISA med en kvantifiering utbud som sträcker sig över sju tiopotenser (102-109 pfu/mL); men denna metod krävs flera steg av antikropp beläggning och tog upp till en hel dag för assay8. Vår grupp också utvecklat en ELISA-metod för att kvantifiera M13 phage partiklar men hade en mindre känsliga detekteringsområde 106 till 1011 pfu/mL5. Omkopplingsbar lanthanide fluorescens sonder har utvecklats för att räkna upp M13 och kvantifiering uppgifter kunde erhållas inom 20 min; denna analys har dock ett smalt dynamiska omfång med 109 1012 pfu/mL9. En grupp används atomic force microscopy att räkna upp M13 phage partiklar i lösning, men detta kräver avancerad elektronmikroskopi och bara arbetat inom ett snävt intervall av koncentrationer10. En annan studie används monodisperse emulsioner att fälla fluorescerande M13 och T4 reporter fagocyt och räkna fagocyt av antalet fluorescerande droppar; dock detta tillvägagångssätt också uppvisade ett smalt kvantifiering utbud från 102 106 pfu/mL11. Samtidigt droplet digital PCR har använts för att kvantifiera M13 fagocyt, är detta tillvägagångssätt inte kan skilja mellan antalet smittsamma och icke-infektiös phage partiklar12.

Vår grupp har nyligen utvecklat qPCR metoder för att räkna upp T7 och M13 fagocyt identifierade från biopanning mot en blod - hjärnbarriären cell modell med två olika fluorescerande reporter färgämnen5. Jämfört med tidigare nämnda kvantifiering metoder, qPCR metoder vi utvecklat var hög genomströmning och tidseffektivt att kvantifiera många prover och kunna skilja mellan smittsamma och icke-infektiös fagocyt med DNAS jag förbehandling av den phage prover. Detta tillvägagångssätt kan allt reproducibly och exakt kvantifiera M13 och T7 bakteriofager från biopanning prover. För att vägleda nybörjare forskare i området i phage qPCR, beskriver här vi en detaljerad qPCR metod för att räkna upp T7 phage partiklar från ett cystein-constrained bibliotek (CX7C) panoreras mot en slem i vitro cystisk fibros (CF) barriär. Från detta arbete, kan qPCR metod utvidgas till att kvantifiera phage partiklar från andra typer av biopanning och från andra källor, inklusive vatten, jord och kroppsvätskor.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. primer Design och analys för T7 Phage genomiskt DNA

  1. Design primers för förstärkning av T7 phage genomiskt DNA.
    Obs: F (framåt) och R (omvänd) primers (se Tabell för material) förstärka T7 DNA-sekvensen ligger uppströms i regionen bibliotek variabel (figur 1).
  2. Välja en lämplig primer analyzer att utvärdera parametrar av primers, inklusive smälttemperatur (Tm), procent GC innehåll (GC %), primer dimerer, hårnål bildandet och PCR lämplighet (figur 1).
  3. Beställ de primer oligonukleotider (oligos), och vid ankomsten, Omsuspendera den frystorkade oligos i DNAS och RNase gratis ultrarent vatten att göra 100 µM lager koncentrationer i ett 1,5 mL centrifugrör och förvaras vid-20 ° C under flera månader.
  4. Göra flera portioner (ca 50 µL i varje 1,5 mL tub) av 100 µM grundfärg beståndet.
    Obs: Detta steg används för att förhindra frekventa frysning-tining cykler.

2. Förbered standarder för kvantifiering av T7 Phage genomiskt DNA

  1. Seriellt späd 0.1 µg/µL (1,0 x 108 fg/µL) referens T7 phage DNA (köpt, med en känd koncentration på 0,1 µg/µL, se material) 10-faldig från 1,0 x 106 till 1,0 x 100 fg/µL med ultra ren H2O i 0,2 mL PCR-rören. Förbereda varje koncentration i en total volym på 20 µL (figur 2).
  2. Vortex PCR-rör för att säkerställa omsorgsfull blandning vid varje steg i utspädning. Även ändra tips när du lägger till DNA-provet den följande spädning.
    Obs: Det rekommenderas att förbereda nya lösning av DNA standarder för en standardkurva för varje parti av qPCR experiment.
  3. Använd ekvationen 1 (nedan) för att konvertera T7 phage referens DNA koncentrationer från fg/µL till genomet kopior (gc) / µl (figur 2).
  4. T7 phage DNA-koncentration i gc/µL =
    Equation 1(1)
    Obs: bp: baspar; referens T7 genomiskt DNA är 37314 bp.

3. förbehandling av Phage prover innan qPCR reaktion förberedelse

  1. (Alternativ 1) Pipettera 20 µL av en T7 klon (fag) väljs från biopanning mot i vitro cystisk fibros (CF)-som slem modell i 1,5 mL centrifugrör. Lägg till 1,25 enheter av DNAS I (0,5 µL) till varje 20 µL prov.
    Obs: T7 phage cystein begränsad heptapeptid bibliotek (CX7C) var biopanned mot CF-liknande slem belagd på 24-väl membran skär (se Tabell för material) för 15 min. Ytterligare information finns i resultatavsnittet. En T7 klon valdes för qPCR provberedning från eluatet.
    1. Alternativ 2: Pipettera 200 µL av T7 klon i ett 1,5 mL rör och Lägg till 5 enheter av DNAS jag
      (2 µL) till varje prov.
      Obs: Phage provmängden valt i detta steg beror på insamlade volymen från biopanning. Medan protokollet fokuserar på qPCR av biopanned fag, kit stegen för biopanning är detaljerad i protokollet användaren av den T7 phage (se Tabell för material)13.
  2. Mössa i T7 phage provrör (steg 3.1) och inkubera dem vid 37 ° C i 10 min i en uppvärmd torr bad (dvs. värme block).
  3. Inkubera rören (från steg 3,2) vid 100 ° C i 15 min i en uppvärmd torr badkar (figur 3A).
    FÖRSIKTIGHET: Sedan avdunstning och kondensation uppstår under värme steg, kontrollera att de 1,5 mL centrifugrör är helt täckta.
  4. Snurra de värmebehandlade fagocyt från steg 3.3 vid 18,534 x g för 10 s. Mix fagocyt genom att placera röret på en vortex mixer inställd på touch-aktiveringen-läge för 10 s och spinn på 18,534 x g för 10 s igen.
    Obs: Spin-mix-spin cykeln är att se till att de uppvärmda phage proverna är väl blandade.
  5. Kyla ner prov rören vid rumstemperatur (RT) genom att lämna dem på experiment bänk eller förvaras vid 4 ° C i kylskåp över natten.
    Obs: Experiment kan pausas vid detta steg.

4. Förbered qPCR reaktioner

Obs: En PCR-reaktion är ett exempel. Varje PCR-reaktion innehåller 5 µL av qPCR master mix (se material), 1 µL 5 µM grundfärg par mix, 2 µL H2O och 2 µL av värmebehandlad T7 phage provet. För flera PCR-reaktioner, är alla reagenser utom phage prov färdigblandad i en 1,5 mL tub. Volymen av varje reagens i premix beror på antalet phage prover för qPCR.

  1. Förbereda den qPCR premix för 10 biopanned phage prover av okänd koncentration och 7 prover av standard koncentrationer i tre exemplar. Som ett resultat finns det 51 totala prover och därför 51 qPCR reaktioner (dvs. en reaktion per prov). För 51 reaktioner, förbereda en premix på 255 µL av qPCR master mix (51 x 5 µL), 51 µL av primers (51 x 1 µL) och 102 µL av H2O (51 x 2 µL).
    Obs: Det rekommenderas att förbereda några extra PCR-reaktioner att kompensera för den volym förlusten under alikvotering PCR-mixen i varje brunn av 96 brunnar qPCR plattan.
  2. Alikvotens 8 µL av PCR premix i varje brunn av 96 brunnar qPCR plattan för sammanlagt 51 wells (dvs 51 qPCR reaktioner). Det finns ingen anledning att ändra tips under alikvotering.
  3. Tillsätt 2 µL av värmebehandlad T7 phage prover (steg 3,4) eller T7 phage referens DNA (steg 2.1) till varje brunn (figur 3B); ändra tips när du lägger till olika DNA-prover till brunnen för att förhindra korskontaminering. Också fördela de 2 µL DNA-proverna under ytan av den qPCR-premix (dvs. i de 8 µL PCR premix).
  4. Försegla qPCR plattan med självhäftande film.
    Obs: Detta steg är kritiska, oavsett typ av qPCR plattan. Använd rekommenderade kit för att försegla plattan helt; Annars, någon icke-förseglade region i plattan kommer att orsaka volymförlust under PCR cykling.
  5. Wrap qPCR plattan med aluminiumfolie att minimera fluorescens fotoblekning och fortsätta att köra det på qPCR utrustningen.

5. qPCR cykling villkor

Obs: qPCR cykling villkor sattes upp på specifik qPCR utrustningen (se Tabell för material).

  1. Kör 96 brunnar qPCR plattan på qPCR utrustningen. Utrustningen, Välj inställningar från menyn för att ställa in följande experimentella villkor (figur 3 c).
  2. Ställa in cykling villkor enligt följande för en provvolymen av 10 µL: en cykel vid 50 ° C i 2 min, en cykel vid 95 ° C i 2 min, följt av 40 cykler av (95 ° C under 15 s, 60 ° C i 1 min). Efter, kör de smälta kurvinställningar: en cykel av 95 ° C för 15 s, 60 ° C i 1 min, och 95 ° C 15 s.
  3. Fortsätt att analysera data som beskrivs i steg 6.

6. analysera qPCR rådata och konvertera från qPCR Ct-värde till gc/µL för T7 bakteriofager

  1. Analysera raw qPCR data och utvärdera datakvalitet genom att analysera de karakteristiska tomterna av rådata (figur 4).
    Obs: Amplification plot, flerkomponents tomt och smälta kurva tomt är viktiga kännetecken tomter att validera kvaliteten på uppgifterna för qPCR.
  2. Beräkna genomsnittlig tröskelvärdena cykel (Ct) från de tre exemplar proverna vid varje koncentration av standardkurvan (steg 2.1).
    1. Rita genomsnittliga Ct (Y) mot log (gc/µL) (X) för att få den linjära kurvan Y = kX + b (k är lutningen på en linjär kurva, b är interceptet).
    2. Beräkna den linjära utvidgningskoefficient14 R2 (R2 måste vara > 0,99).
  3. Använd standard kurvan Y = kX + b att beräkna antalet T7 Fager i biopanning prover (dvs fagocyt markerat mot CF-liknande slem) i gc/µL (figur 5).
    Obs: k är lutningen på standardkurvan.
  4. Beräkna förstärkning effektiviteten av följande ekvation
    Equation 2(2)
    Obs: k är lutningen på standardkurvan genereras från referens DNA qPCR. Perfekt är förstärkning verkningsgrad 90 – 110%.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Olika primer designverktyg kan användas för att utforma qPCR primers. Typiskt, primer design program har sina egna inbyggda algoritmer för att beräkna och verifiera de centrala parametrarna av primers, t.ex., GC %, Tm, primer dimer eller hårnål bildandet, etc. allmänt, de centrala kriterierna är liknande i olika primer designverktyg och primers kan utformas efter deras instruktioner. Primer BLAST kan användas för att bekräfta specificiteten av primers. En primer para som riktar uppströms i regionen variabel i den T7 genomiskt DNA visas i figur 1. För att fastställa de okända koncentrationerna av phage prover från biopanning, ett absolut valdes kvantifiering metod - standardkurvan kvantifiering - att räkna upp de phage genomiska DNA-kopiorna. Referera till T7 phage DNA (se material) på en känd koncentration var 0,1 µg/µL seriellt spädas från 1,0 x 100 till 1,0 x 106 fg / µL. ekvation 1 användes för att konvertera T7 phage DNA koncentrationer från fg/µL till genomet kopior (gc) / µL; referens T7 phage DNA koncentrationer var 2,66 x 101 till 2,66 x 107 gc/µL (figur 2).

Efter förbereder utspädningar av referens DNA för standardkurvan, förbereddes en valda CX7C T7 phage för qPCR (figur 3A). Kortfattat, att beskriva biopanning av den valda phage: en initial koncentration av 4,2 x 109 pfu T7 CX7C phage lades ovanpå den apikala fack (givare) av en Transwell tallrik (se Tabell för material) innehållande 100 µL av CF-liknande slem och 600 µL av fosfat buffrad koksaltlösning (PBS, se Tabell för material) i basolateral facket (mottagare) och var inkuberas i 15 min i rumstemperatur (25 ° C). Efter 15 min samlades eluatet i mottagaren; från eluatet valdes en CX7C T7 klon att kvantifieras av qPCR. qPCR reaktion förberedelse utfördes på isen med nödvändigt reagens (t.ex. qPCR huvudmixen, primers, H2O), som visas i figur 3B. QPCR cykling villkoren sattes upp på en qPCR termocykler att köra proverna (se Tabell för material, figur 3 c).

Efter den qPCR kör, amplification plot, smälta kurva handlingen och flerkomponents tomt (figur 4) analyserades från raw-data med hjälp av programvaran (se Tabell för material). Förstärkning tomten anger framgång eller misslyckande av PCR-amplifiering av varje prov. Flerkomponents tomten presenterar förstärkning och förfall av fluorescens signal (reporter dye SYBR och bakgrunden ROX färgämne) under de förstärkning cyklerna. Smälta kurva tomten används för att validera primers specificitet eftersom varje PCR-produkt har en unik smälttemperatur (Tm).

Efter utvärdering av qPCR rådata kvalitet, standardkurvan genereras från referens DNA: Ct-värden (Y) över log gc/µL (koncentration konvertering visas i figur 5); Det var här, Y =-3.5188 X + 35.09 (R2= 0,999) (figur 5A och 5B). Förstärkning effektivitet beräknades till 92,4%. Standardkurvan användes för att interpolera de okända koncentrationerna av utspädda T7 phage CX7C klon baserat på deras Ct-värden. Alla referensprov och phage prover kördes i tre exemplar, och deras genomsnittliga Ct-värdena användes för att beräkna DNA-koncentration i gc/µL (figur 5). Inledande stamlösning av T7 klon var seriellt spädas för att validera stabilitets- och repeterbarhet av qPCR för uppräkning av T7 fagocyt5. På varje utspädning, var prover förberedda i tre exemplar. Dubbla lager plack analysen användes som referensmetod för att fastställa koncentrationerna av T7 spädningarna; metoder har beskrivits tidigare5. I figur 6visas representativa resultat från qPCR jämfört med plack assay på testade utbud av 101 107 gc / µL. titrar eller antal fagocyt från qPCR kvantitering var högre än från dubbla lager plack-analysen. Repeterbarheten för metoden qPCR representeras av koefficienten för variansen (CV) för koncentrationer från 101 till 107 gc/µL. Resultatet visades i tabell 1. de CV % varierade från 2,85 – 27,2%.

Figure 1
Figur 1: Primer design för T7-415 phage DNA vektor och nyckeln parametrar analys av designade primers. Oligo designverktyg användes för att utforma flera par av primers för T7-415 phage DNA. En uppsättning valdes efter validering av nyckelparametrar primers, t.ex., Tm, GC %, primer-dimer och hårnål bildandet. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: standardkurvan förberedelse och enhetskonvertering av T7 phage referera DNA. 10-faldig seriespädningar var gjorda av 0,1 µg/µL T7 phage referens DNA för en standardkurva. Ekvation 1 användes att konvertera DNA koncentrationer från fg/µL till gc / µL. vänligen klicka här för att visa en större version av denna siffra.

Figure 3
Figur 3: Phage prov behandling, qPCR reaktion förberedelse och qPCR köra. DNAS jag förbehandlade T7 phage prover värmdes vid 100° C i 15 min att släppa T7 DNA från intakt phage partiklar (A). qPCR blandningen var beredd som beskrivs i protokollet. Alla förberedelser var klara på is (B). qPCR utrustning och kompatibel programvara (C) användes för att ställa in villkor som cykling, köra PCR cykler, inhämta och analysera rådata. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: karakteristiska tomter av qPCR rådata. Amplification plot, flerkomponents tomt och smälta kurva tomt förvärvades från qPCR rådata av en T7 phage CX7C klon från biopanning mot in vitro- CF-liknande slem barriär. I flerkomponents tomten är passiv referens färgen (ROX) en dye molekyl ingår i qPCR huvudmixen som inte deltar i den PCR-amplifieringen och visar ingen amplifiering signal i handlingen. SYBR, som är SYBR grön dye molekyl i qPCR master mix, kommer att ge en fluorescens-signal som ska förstärka och förfalla under qPCR cykling. Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: analys av rådata för qPCR att beräkna gc/µL av T7 phage partiklarna. Tröskelvärde för cykel (Ct) värden av standardkurvan T7 phage referenspunkt DNA (Y) var plottas mot logaritmen omvandlingen av de kända koncentrationerna av referens DNA i gc/µL (X) att få standardkurvan (A och B). Standardkurvan användes för att beräkna X (log gc/µL) värdena för de okända koncentrationerna av phage prover utifrån sin Ct-värden. (C) T7 phage koncentrationer i gc/µL kan beräknas. Dessutom tillhandahålls beräkning qPCR förstärkning effektivitet. Klicka här för att se en större version av denna siffra.

Figure 6
Figur 6: Känslighet och repeterbarhet resultaten av qPCR att räkna upp en T7 klona från biopanning mot in vitro- CF-liknande slem barriär. En T7 CX7C phage klon väljs från biopanning experiment var seriellt spädas till ett koncentrationsintervall (betecknas som E1-E7 att representera 101 107) och i tre exemplar för qPCR och dubbla lager plack haltbestämning. Både qPCR och dubbla lager plack assay användes att kvantifiera koncentration av T7 phage klon vid varje spädning. Data visades i medelvärdet med standardavvikelsen (SD) på varje skala för varje behandlingsgrupp. Klicka här för att se en större version av denna siffra.

Repeterbarhet
Koncentration (gc/µL) CV data i %
10 1 27,2
10 2 7,65
10 3 2,85
10 4 15,7
10 5 15,6
10 6 5,03
10 7 4,71

Tabell 1: repeterbarhet av qPCR metoden för en T7 phage CX7C klon. Inom variabilitet testades vid kvantifiering skala 101 till 107 gc/µL för T7 klonen DNA, variationskoefficienten (CV) beräknades som kvoten mellan standardavvikelsen till medelvärdet att uttrycka repeterbarheten för metoden qPCR. CVs beräknades i spänna av 2,85 – 27,2% på för testade koncentrationerna.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vi utvecklat qPCR metoder för att kvantifiera phage genomisk DNA5och här vi beskrivit och anpassas en qPCR metod för att räkna upp T7 fagocyt markerat mot CF-liknande slem barriär. Minsta Information för offentliggörande av kvantitativa Real-Time PCR-experiment (MIQE) riktlinjer anpassades för att utveckla och validera metoden qPCR för uppräkning av T7 fagocyt15. Det protokoll som vi utvecklat för att kvantifiera fagocyt från biopanning experiment är en tidseffektiv, tillförlitlig och ekonomisk strategi. Våra protokoll för qPCR provberedning endast används hög temperatur behandling (100 ° C, 15 min) av phage lösningen och kräver inte phage DNA extraktion och rening steg jämfört med konventionella strategier11,17, 18. Också, för att mer exakt räkna upp phage partiklar, DNase lades till phage lösningen före hög temperatur behandling att ta bort icke-inkapslat phage DNA18,19,20. Icke-inkapslat, kvarvarande DNA i phage lösningen kan leda till brist på inkapsling under phage förstärkning eller nedbrytning av phage partiklar. Som ett resultat, för att exakt kvantifiera antalet intakt phage partiklar med hjälp av deras genomiskt DNA, är DNase förbehandling kritisk för att förhindra artifactually höga värden phage genomet kopior.

I området i närheten finns det många överväganden i utveckling och användning av qPCR att exakt kvantifiera Fager. Variationer av qPCR data kan uppstå i hela protokollet och följande skall anses uppnå noggrann uppräkning. Det är viktigt att säkerställa phage lysis med hög temperatur behandling och hålla phage provrör i förseglade villkor för att förhindra efterföljande fluktuationer i provets koncentration på grund av avdunstning och kondensation av vatten. En total volym av PCR-reaktionen är liten och kräver kalibreras pipetter och pålitlig pipettering skicklighet vid varje steg i provberedning. Under qPCR Cykling, pålitlig temperatur kontrollerande funktion är nödvändig för korrekt qPCR data och rutinmässig kalibrering av termocykel i qPCR instrumentet behövs. Om du vill styra variationen, beskrevs alternativa steg i protokollet. Om operatören svårigheten att låg volym pipettering, kan totala PCR-reaktionen vara skalas upp till 20 eller 25 µL. Förutom ovan nämnda stegen för felsökning kräver protokollet internkontroll av standard DNA15,21,22,23. Som en absolut kvantifiering metod avgör den linjär utvidgningskoefficient av standardkurvan phage uppräkning data noggrannhet. Använder en intern kontroll-DNA i provet körningen kan minimera variationen från provberedning och qPCR utrustning.

Jämfört med tidigare beskrivna phage kvantifiering metoder, våra protokoll tillåter uppräkning av ett brett utbud av phage koncentrationer och kan skilja smittsamma och icke-infektiös phage partiklar med och utan DNAS behandling. Våra protokoll är också attraktiva för kvantifiering av ett stort antal prover, vilket gör den mer kostnadseffektiv, tidseffektiv och hög genomströmning jämfört med dubbla lager plack assay och andra metoder.

Sammanfattningsvis, kan detta protokoll anpassas att räkna upp phage partiklar i en mängd olika tillämpningar, inklusive in vitro- och in-vivo biopanning, phage bibliotek DNA förberedelse i nästa generations sekvensering och miljömässiga phage kontaminering.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Detta arbete stöds av PhRMA Foundation forskningsbidrag Starter och den nationella hjärta, lungor och blod Institute of National Institutes of Health bevilja under award nummer R01HL138251.

Materials

Name Company Catalog Number Comments
Materials and Reagents
Primers for T7 genomic DNA IDT F: CCTCTTGGGAGGAAGAGATTTG
R: TACGGGTCTCGTAGGACTTAAT
T7 Select packaging control DNA EMD Millipore 69679-1UG
MicroAmp optical 96-well reaction plate ThermoFisher Scientific N8010560
qPCR master mix--Power up SYBR Green master mix Applied biosystems A25742
MicroAmp optical adhesive film kit ThermoFisher Scientific 4313663
T7Select 415-1 Cloning Kit EMD Millipore 70015 User protocols : http://www.emdmillipore.com/US/en/product/T7Select-415-1-Cloning-Kit,EMD_BIO-70015#anchor_USP
DNase I solution ThermoFisher Scientific 90083
24-well transwell plate Corning 3472
UltraPure DNase/RNase-Free Distilled H2O Invitrogen 10977015
Phosphate Buffered Saline (1x) Corning 21040CV
Name Company Catalog Number Comments
Equipments
ViiA7 Real-Time PCR System with Fast 96-Well Block ThermoFisher Scientific 4453535
Heraeus Pico 21 Microcentrifuge ThermoFisher Scientific 75002415
Fisherbrand Digital Vortex Mixer Fisher Scientific 02-215-370
HERMO SCIENTIFIC Multi-Blok Heater ThermoFisher Scientific Model:2001
Sorvall Legend X1 Centrifuge ThermoFisher Scientific 75004220
M-20 Microplate Swinging Bucket Rotor ThermoFisher Scientific 75003624
Name Company Catalog Number Comments
Software
QuantStudio Real-time PCR software ThermoFisher Scientific v1.2
Real-time qPCR primer design IDT
OligoAnalyzer 3.1 IDT

DOWNLOAD MATERIALS LIST

References

  1. Smith, G. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. 228, (4705), 1315-1317 (1985).
  2. Smith, G. P., Petrenko, V. A. Phage Display. Chemical Reviews. 97, (96), 391-410 (1997).
  3. Sergeeva, A., Kolonin, M. G., Molldrem, J. J., Pasqualini, R., Arap, W. Display technologies: Application for the discovery of drug and gene delivery agents. Advanced Drug Delivery Reviews. 58, (15), 1622-1654 (2006).
  4. Dias-Neto, E., et al. Next-generation phage display: Integrating and comparing available molecular tools to enable costeffective high-throughput analysis. PLoS ONE. 4, (12), 1-11 (2009).
  5. Peng, X., Nguyen, A., Ghosh, D. Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR. Journal of Virological Methods. 252, (June 2017), 100-107 (2017).
  6. Khan, M. S., Pande, T., Mvan de Ven, T. G. Qualitative and quantitative detection of T7 bacteriophages using paper based sandwich ELISA. Colloids and Surfaces B: Biointerfaces. 132, 264-270 (2015).
  7. Brasino, M., Lee, J. H., Cha, J. N. Creating highly amplified enzyme-linked immunosorbent assay signals from genetically engineered bacteriophage. Analytical Biochemistry. 470, 7-13 (2014).
  8. Yu, X., Burgoon, M., Shearer, A., Gilden, D. Characterization of phage peptide interaction with antibody using phage mediated immuno-PCR. J immunol Methods. 326, (1-2), 33-40 (2007).
  9. Lehmusvuori, A., Manninen, J., Huovinen, T., Soukka, T., Lamminmäki, U. Homogenous M13 bacteriophage quantification assay using switchable lanthanide fluorescence probes. BioTechniques. 53, (5), 301-303 (2012).
  10. Schlaman, H. R. M., et al. Analysis of interactions of signaling proteins with phage-displayed ligands by fluorescence correlation spectroscopy. Journal of Biomolecular Screening. 13, (8), 766-776 (2008).
  11. Tjhung, K. F., Burnham, S., Anany, H., Griffiths, M. W., Derda, R. Rapid enumeration of phage in monodisperse emulsions. Analytical Chemistry. 86, (12), 5642-5648 (2014).
  12. Reitinger, S., Petriv, O. I., Mehr, K., Hansen, C. L., Withers, S. G. Purification and quantitation of bacteriophage M13 using desalting spin columns and digital PCR. Journal of Virological Methods. 185, (1), 171-174 (2012).
  13. T7Select Biopanning Kit. Millipore Sigma. Available from: https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit,EMD_BIO-70018#anchor_USP (2018).
  14. Schneider, A., Hommel, G., Blettner, M. Linear Regression Analysis. Deutsches Ärzteblatt international. 107, (44), 776-782 (2010).
  15. Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggert, J. The MIQE Guidelines: Minimun information for publication of quantitative real-time PCR experiments. Clinical Chemitry. 55, (4), 611-622 (2009).
  16. Lock, M., Alvira, M. R., Chen, S. -J., Wilson, J. M. Absolute Determination of Single-Stranded and Self-Complementary Adeno-Associated Viral Vector Genome Titers by Droplet Digital PCR. Human Gene Therapy Methods. 25, (2), 115-125 (2014).
  17. Fittipaldi, M., et al. Discrimination of infectious bacteriophage T4 virus by propidium monoazide real-time PCR. Journal of Virological Methods. 168, (1-2), 228-232 (2010).
  18. Lodder, W. J., et al. Reduction of bacteriophage MS2 by filtration and irradiation determined by culture and quantitative real-time RT-PCR. Journal of Water and Health. 11, (2), 256-266 (2013).
  19. Brown-Jaque, M., et al. Antibiotic resistance genes in phage particles isolated from human feces and induced from clinical bacterial isolates. International Journal of Antimicrobial Agents. (2017).
  20. Naveca, F. G., et al. Multiplexed reverse transcription real-time polymerase chain reaction for simultaneous detection of Mayaro, Oropouche, and oropouche-like viruses. Memorias do Instituto Oswaldo Cruz. 112, (7), 510-513 (2017).
  21. Jia, J., et al. Simultaneous detection and differentiation of human parvovirus B19 and human parvovirus 4 by an internally controlled multiplex quantitative real-time PCR. Molecular and Cellular Probes. 36, 50-57 (2017).
  22. Bliem, R., et al. A novel triplex quantitative pcr strategy for quantification of toxigenic and nontoxigenic Vibrio cholerae in aquatic environments. Applied and Environmental Microbiology. 81, (9), 3077-3085 (2015).
  23. Wan, Z., Goddard, N. L. Competition Between Conjugation and M13 Phage Infection in Escherichia coli in the Absence of Selection Pressure: A Kinetic Study. G3 Genes|Genomes|Genetics. 2, (10), 1137-1144 (2012).
Kvantitativ PCR av T7 Bacteriophage från Biopanning
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).More

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter