Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

En oligonukleotid-baserede Tandem RNA isolering Procedure at inddrive eukaryote mRNA-Protein komplekser

doi: 10.3791/58223 Published: August 18, 2018
* These authors contributed equally

Summary

En tandem RNA isolering procedure (tur) inddrivelse af endogent dannes mRNA-protein komplekser er beskrevet. Specifikt, RNA-protein komplekser er crosslinked i vivo, polyadenylated RNA'er er isoleret fra ekstrakter med oligo(dT) perler, og særlig mRNAs er fanget med modificerede RNA antisense oligonukleotider. Proteiner er bundet til mRNAs registreres af immunblot analyse.

Abstract

RNA-bindende proteiner (RBPs) spiller vigtige roller i den post-transcriptional kontrol af genekspression. Derfor, biokemiske karakterisering af mRNA-protein komplekser er nødvendigt for at forstå mRNA forordning udledes af interagerende proteiner eller ikke-kodende RNA'er. Heri, beskriver vi en tandem RNA isolering procedure (tur) der gør det muligt for rensning af endogent dannes mRNA-protein komplekser fra cellulære ekstrakter. To-trins protokol omfatter isolering af polyadenylated mRNAs med antisense oligo(dT) perler og efterfølgende opsamling af et mRNA af interesse med 3'-biotinylated 2'-O-methylerede antisense RNA oligonukleotider, som derefter kan være isoleret med streptavidin perler. Turen blev brugt til at tilbagesøge gær, nematoder og menneskelige celler til yderligere RNA og protein analyse i vivo crosslinked mRNA-ribonucleoprotein (mRNP) komplekser. TUR er således en alsidig tilgang, som kan tilpasses til alle typer af polyadenylated RNA'er på tværs af organismer til at studere det dynamiske re arrangement af mRNPs pålagt af intracellulære eller miljømæssige stikord.

Introduction

Post-Transcriptional genregulering drives gennem interaktioner mellem RNA-bindende proteiner (RBPs), ikke-kodende RNA'er (klarlægning) og mRNAs, som direkte forarbejdning, lokalisering, oversættelse og henfald af hver udskrift i celler1 , 2. identifikation af RBPs og ncRNA interagerer med særlig mRNAs, om oprettelse af det såkaldte ribonucleoprotein komplekser/partikler (RNPs), er derfor nøglen til at forstå skæbnen af mRNAs og gen expression kontrol. Komplementære metoder foretages med biokemiske karakterisering af RNP komplekser3,4: mens "protein-centric" tilgangen er baseret på rensning af specifikke RBPs, "RNA-centreret" tilgangen indebærer den isolering af delpopulationer eller individuelle RNA'er og efterfølgende analyse af interagerende proteiner eller RNA'er. For nylig, en RNA-centreret tilgang til identifikation af RBP repertoire interagere med polyadenylated (poly(A)) RNA'er5 er blevet stadig mere populære ved at indarbejde en ultraviolet (UV) lys crosslinking skridt for at stabilisere protein-RNA interaktioner forudgående isolering af mRNAs, som dramatisk udvidet katalog af RBPs i humane celler6,7,8,9,10,11, Caenorhabditis elegans 12, saccharomyces cerevisiae12,13,14, og andre organismer15,16,17,18, 19,20. Kortlægning af proteiner og/eller klarlægning samlet på særlige udskrifter er imidlertid stadig en stor udfordring. Til dette formål, to vigtigste tilgange bruges aktuelt: på den ene side RNA aptamer tags er sammenvokset til RNA af interesse at aktivere affinitet rensning. Derved binder RNA aptamers med høj affinitet aminoglykosid antibiotika inklusive tobramycin og streptomycin21,22,23,24, eller proteiner, som pels protein fra den R17/MS2 bacteriophage eller bakterielle streptavidin S125,26,27,28,29. Selv om denne tilgang blev vist sig at være relativt robust og alsidig, det kræver kloning til design af RNA under efterforskning, og dermed ikke kan bruges til at fange naturlige mRNAs. På den anden side antisense oligonukleotider (ASOs) blev brugt tidligt til genopretning og karakterisering af stærkt udtrykt indfødte RNPs30,31 og viral RNA'er32. Mere nylig, ASOs blev anvendt for at fange længe ikke kodning RNA'er33,34,35 og in vitro- dannet mRNPs36. En større begrænsende faktor med alle RNA centreret tilgange er kopi antal RNA af interesse, at foretage inddrivelse af lav-udtrykt mRNAs mere problematisk. Denne begrænsning kan overvindes ved opskalering reaktion; men dette kan potentielt føre til stigende baggrunden.

Heri, beskriver vi vores nyligt udviklede ASO-baserede tandem RNA isolering procedure (tur) at isolere indfødte mRNA-protein komplekser med høj selektivitet37 (figur 1). Protokollen indebærer to sekventielle ASO-baserede rensning trin, nemlig isolation af poly(A) mRNAs med kommercielt tilgængelige oligo(dT) kombineret perler efterfulgt af fanger af specifikke mRNAs ved hjælp af specielt designede kort biotinylated 2'-methoxy RNA ASOs. Denne totrinsprocedure hjælper med at fjerne forurenende proteiner og tilføjer muligheder for justering og optimering. I dette tilfælde, turen blev anvendt på valgte mRNAs fra gær, nematoder og menneskelige celler til at bekræfte i vivo dannes mRNA-protein komplekser.

Protocol

1. design Antisense oligonukleotider (ASOs)

  1. Analysere mRNA eller et brudstykke heraf ved hjælp af tilgængelige online værktøjer38sekundær struktur. Derfor angive nucleotidsekvensen (nt) i det tomme felt. Vælg Minimum fri energi (MFE) og partition funktion og undgå isolerede basepari boksen grundlæggende indstillinger. Vælg interaktive RNA sekundærstruktur plot i indstillingsboksen output og endelig klikke på knappen Fortsæt . Et nyt vindue vil pop-up, der viser den sekundære struktur af mRNA af interesse.
  2. Vælg mindst tre forskellige 21-24 nts lange sekvenser i mRNA af interesse, fortrinsvis i regioner mangler påviselige sekundære strukturer (fx., i ustrukturerede sløjfer) og i 3' utranslaterede regioner (UTR).
    Bemærk: Man har konstateret, at ASOs udglødning til sekvenser i de 3' utranslaterede regioner (UTR) klarede sig bedst. En mulighed er at ribosomer bundet til den kodende sekvens (cd'er) lejlighedsvis kan hindre Udglødning af ASOs. ASOs udglødning til 5' UTRs var ikke testet.
    1. Vælg regionerne med forholdet guanidin/cytosin tæt på 50% og mangler nukleotid tandem gentager for at undgå potentielle dannelsen af Hårnåle eller selvstændige udglødning.
  3. Design 2'-methoxy ændret manuelt RNA-oligonukleotider forsynet med et biotin gruppe på de 3', fuldt ud supplerer de udvalgte regioner (trin 1.2) inden for den ønskede målrette mRNA.
    Bemærk: 2'-methoxy ændringer render RNA resistente til cellulære RNases og øger duplex smeltende temperatur, som giver mulighed for strengere vask. Biotin gruppe er forpligtet til at indfange ASOs med streptavidin.
    1. Justere smeltepunktet af RNA hybrider til ~ 60-65 ° C og sikre, at det har en høj sproglig sekvens kompleksitet (> 60%) som bestemmes med passende online værktøjer39.
    2. Bruge de grundlæggende lokale justering søgeværktøj40 til at søge efter potentielle ASO cross-hybridisering med andre mRNAs i transkriptom. Vælg Nukleotid BLAST, indsætte sekvenser i den tomme boks og vælg organisme af interesse. Holde de resterende parametre som standard og klikke på BLAST.
      Bemærk: Selv delvis løbende justering af 8-10 nts kan føre til cross-hybridisering og genoprettelse af dette mRNA.

2. celle kultur, UV-bestråling og celle Lysis

Bemærk: I følgende proceduren, der er beskrevet for spirende gær S. cerevisiae, nematoder C. elegansog menneskelige embryonale nyreceller (HEK293). Ikke desto mindre, det kan tilpasses til andre organismer samt, selvom det ikke var eksplicit testet endnu.

  1. S. cerevisiae
    1. Vokse gærceller (fx., stamme BY4743 afledte; MATa/α his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 LYS2/lys2Δ0 met15Δ0/MET15 ura3Δ0/ura3Δ0 PFK2:TAP / PFK2) i 500 mL YPD medier (1% gær extract, 2% pepton, 2% D-glucose) ved 30 ° C under konstant omrystning på 220 rpm.
    2. Indsamle cellerne på midten log fase (optisk tæthed på 600 nm (OD)600 ~ 0,6) ved filtrering ved hjælp af 0,45 µm nylon filtre eller ved centrifugering ved 3.000 × g i 2 min. ved stuetemperatur (RT). Kassér gennemstrømnings- eller supernatanten, henholdsvis.
    3. Cellerne vaskes tre gange med 25 mL af fosfat-buffer-saltvand (PBS) ved hjælp af filteret 0,45 µm nylon eller indsamle ved centrifugering ved 3.000 × g i 2 min på RT og supernatanten. Indsamle cellerne så hurtigt som muligt, da den pålagte stress kan have en indvirkning på RNA-protein interaktioner.
    4. Resuspend celler i 25 mL PBS og derefter hælde suspension i en 15 cm petriskål. Placer skålen på is, Fjern låget, og udsætte celler tre gange med 400 mJ cm-2 254 nm UV lys i en UV-crosslinker med 2-minutters pauser på isen mellem hver eksponering cyklus med blide blanding.
    5. Overføre cellerne til en 50 mL tube og indsamle cellerne ved centrifugering ved 3.000 × g i 3 min. ved 4 ° C. Supernatanten og holde pelleten.
      Bemærk: Celler kan være snap frosset i flydende nitrogen og opbevares ved-80 ° C.
    6. Resuspend celler i 4 mL af kølet lysisbuffer A (LB-A; 100 mM Tris-HCl, pH 7,5, 500 mM LiCl, 10 mM EDTA, 1% Triton X-100, 5 mM DTT, 20 U ml-1 DNase jeg, 100 U ml-1 RNasin, komplet EDTA-fri protease-inhibitor cocktail).
    7. Overføre cellerne i to 2 mL rør. Tilføj max. ⅔ mængder af kølede glasperler og forstyrre cellerne i et væv lyser på 30 Hz til 10 min. ved 4 ° C.
    8. Punch et hul i bunden af røret med en hot nål og overføre den lysate til en frisk 1,5 mL tube ved centrifugering ved 600 × g for 30 s.
    9. Klare den lysate af tre sekventielle centrifugations ved 4 ° C ved 3.000 × g i 3 min, så 5.000 × g og 10.000 × g i 5 min.
      Bemærk: Uddrag kan være snap-frosset i flydende nitrogen og opbevares ved-80 ° C.
  2. C. elegans
    1. Kultur Bristol N2 orme ved 20 ° C på Nematode vækst Medium (NGM) plader (0,3% NaCl, 1,7% agar, 0,25% pepton, 1 mM CaCl2, 5 µg/mL kolesterol, 1 mM MgSO4, 25 mM KPO4 buffer, pH 6.0) med OP50 Escherichia coli -stamme 41 .
    2. Der tilsættes 5 mL af M9 buffer41 (0,3% KH2PO4, 0,6% Na2HPO4, 0,5% NaCl, 1 mM MgSO4) til hver plade, ryste plade resuspend orme og overføre orme til en 15 mL tube. Placer 2 µL af suspension i et dias og tælle orme i suspension med et mikroskop. Derefter anvende faktor for at beregne antallet af orme pr. plade.
    3. Indsamle ~ 120.000 orme ved centrifugering ved stuetemperatur (400 × g, 2 min, RT) og supernatanten.
    4. Vask orme tre gange. Derfor tilsættes 10 mL af M9 buffer, blandes ved inversion og indsamle ormene ved centrifugering ved 400 × g i 2 min på RT.
    5. Tilsættes 15 mL af M9 buffer til orme og placere på en rotatorisk hjul for 15 min på RT.
    6. Overføre orme til NGM plader (~ 4.000 orme pr. plade) og udsættes for UV-lys (254 nm) på 300 mJ cm-2 i en UV-crosslinker.
    7. Der tilsættes 5 mL af M9 buffer direkte til pladen og ryste plade for at resuspend orme i bufferen. Overføre suspension med en pipette til en 15 mL tube og indsamle ormene ved centrifugering ved 400 × g i 2 min på RT.
    8. Resuspend orme i 2 mL af lysisbuffer B (LB-B; 100 mM Tris-HCl, pH 8,0, 150 mM NaCl, 1 mM EDTA, 0,75% IGEPAL, 1 mM DTT, 20 U mL-1 DNase jeg, 100 U mL-1 RNasin, komplet EDTA-fri protease-inhibitor cocktail).
    9. Grind orme i en morter, fyldt med flydende kvælstof. Indsamle pulver i en 50 mL tube og en optøning på RT.
      Bemærk: Flydende kvælstof skal håndteres efter sikkerhedsprocedurer (fx, aftræk hood og sikkerhed handsker)
    10. Klart den lysate herunder det fedtlag ved centrifugering ved 14.000 × g i 10 min og derefter passere det klarede lysate gennem et 0,45 μm filter med en sprøjte.
  3. Kulturperler menneskeceller
    Bemærk: Den følgende beskrivelse bygger på forbigående Transfektion af HEK293 celler med pGL3-CDKN1B-3'UTR reporter plasmid, der udtrykker 3′UTR CDKN1B/27 nedstrøms af firefly luciferase gen42.
    1. Kultur HEK293 celler i Dulbeccos modificerede Eagle Medium (DMEM) der indeholder 25 mM glukose og 1 mM natrium pyruvat, suppleret med 100 U mL-1 penicillin, 100 µg mL-1 streptomycin og 10% føtal bovint serum (FBS), og der inkuberes ved 37 ° C i en befugtet kammer (inkubator) indeholdende 5% CO2.
    2. Frø ~ 3 × 106 HEK293 celler i vævskultur en standard 10 cm parabol dagen før Transfektion. Tælle celler med en hemocytometer.
    3. Bland 2 µg af reporter gen (fx., pGL3-p27-3'UTR) med 20 µL Transfektion reagens og transfect celler på 70% confluency (~ 7 × 106 celler).
    4. Placer cellerne i en inkubator ved 37 ° C i yderligere 48 timer før høst.
    5. Fjern mediet med en serologisk pipette og hurtigt cellerne vaskes to gange med 10 mL PBS pre varmes ved 37 ° C. Fjerne PBS med en serologisk pipette.
    6. Tilføj 6 mL PBS til fadet, Anbring på is og så udsætte celler for UV-lys (254 nm) på 100 mJ cm-2 i en UV-crosslinker.
      Bemærk: Pladen skal holdes på is under UV-lys eksponering.
    7. Skrabe ned celler (i samlede ~ 107 celler) i PBS og overførsel til en 15 mL tube.
    8. Spin ned celler ved 250 × g i 10 min. ved 4 ° C og derefter på Fjern supernatanten med en pipette.
      Bemærk: Celle pellet kan snap-frosset i flydende nitrogen og opbevares ved-80 ° C indtil brug.
    9. Resuspend celler i 2 mL af pre kølet lysisbuffer (LB-A) af pipettering op og ned til 5 - 6 gange, samtidig med at røret på is.
    10. Overfør lysate med en pipette til en 5 mL tube anbringes på is.
    11. Underlagt de lysate til tre runder af sonikering bestående af 20 s byger på 10 μm amplitude med 30 s af køling perioder på is.
      Bemærk: Sonikering anbefales som det fuldender lysering af celler og fragmenter DNA.
    12. Overførsel af lysate til 2 mL rør og centrifugeres ved 15.000 × g i 10 min. ved 4 ° C. Indsamle supernatanten (= ekstrakt) og overførsel til en ny tube. Fjerne en analyseprøve (5-10%) for yderligere proteiner og RNA analyse.
      Bemærk: Dette trin er afgørende for at fjerne enhver resterende celle debris og kan gentages.

3. første trin: Poly(A) RNA isolering

  1. Blandingen henstår 1 mg oligo(dT)25-kombineret magnetiske perler i 500 µL af de respektive lysisbuffer.
  2. Kombiner 5 mg, 10 mg eller 4 mg (protein) S. cerevisiae, C. elegans eller HEK293 ekstrakter, henholdsvis med 1 mg oligo(dT)25 -kombineret magnetiske perler. Bland prøver kraftigt i 10 minutter ved 25 ° C i en mixer.
    Bemærk: Protein koncentrationer af ekstrakter kan bestemmes med Bradford assay med bovint serumalbumin (BSA) som en referencestandard. Kraftig rysten af prøver forhindrer sedimentation af perler. For at vurdere specificiteten af mRNA isolation, kan et kontrol-eksperiment udføres parallelt ved at tilføje et overskud (20 µg) af polyadenylic syrer (pA).
  3. Sted rør på et magnetisk står for 10 s og Fjern supernatanten. Holde supernatanten på isen for efterfølgende runder af recovery (trin 3.7).
  4. Tilføje 500 µL af wash buffer A (10 mM Tris-HCl, pH 7,5, 600 mM LiCl, 1 mM EDTA, 0,1% Triton X-100) perler og vortex for 5 s.
    Bemærk: Koncentrationen af LiCl i vask buffere kan variere. 600 mM LiCl anbefales at men lavere koncentrationer blev også testet (500 mM for C. elegans, 300 mM for HEK293).
  5. Indsamle perler med en magnet, og derefter vaske perlerne to gange med 500 µL af vaskebuffer B (WB; 10 mM Tris-HCl, pH 7,5, 600 mM LiCl, 1 mM EDTA).
  6. Elueres RNA i 30 µL af 10 mM Tris-HCl, pH 7,5 ved 80 ° C i 2 min. under konstant omrystning (1000 rpm) i en mixer. Straks røret anbringes i den magnetiske stå og eluatet efter 10 s. gemme perler for yderligere runder af rensning.
    Bemærk: Eluatet opsamles så hurtigt som muligt for at forhindre potentielle genindbundet af mRNAs til perlerne ved lavere temperaturer.
  7. Tilføje perlerne fra forrige trin til supernatanten indsamlet på trin 3.3, og Gentag opsamling, vask og eluering af mRNAs to gange (trin 3,3-3,6). Eluater fra gentagne runder kombineres derefter og kan opbevares ved-80 ° C.

4. det andet skridt: hentning af specifikke mRNAs med 3'-Biotinylated 2'-Methoxy ændret Antisense RNA oligonukleotider

Bemærk: For at teste egnetheden af ASOs, følgende fremgangsmåde kan udføres med samlede RNA'er isoleret fra celler.

  1. Reagensglasset 30 µL af streptavidin-kombineret magnetiske perler i 1 mL af bindende og vaske buffer (B & W buffer; 10 mM Tris-HCl, pH 7,5, 150 mM NaCl, 0,5 mM EDTA, pH 8,0) som indeholder 0,1 mg mL-1Escherichia coli transfer RNA (tRNA) på en rotator i 1 time på RT.
    1. Vaske perlerne tre gange med 750 µL af B & W buffer.
    2. Resuspend perlerne i 30 µL af B & W buffer og holde på køl indtil brug.
  2. Fortynd ~ 35 µg af total protein fra den tidligere poly(A) isolation (Se 3) i 100 µL af B & W buffer i en 1,5 mL tube.
    Bemærk: For at teste specificiteten af ASOs med total RNA, tilføje 600 ng af renset total RNA til 100 µL af B & W buffer.
  3. Tilføje 200 pmol af de respektive ASO og inkuberes ved 70 ° C i 5 min.
    Bemærk: Den forhøjede temperatur løser sekundære strukturer i RNA lette Udglødning af ASO.
  4. Fjern den hele varme-blok fra enheden og placere den på RT for 10 min til at afkøle langsomt.
  5. Tilføje 30 µL af afbalancerede streptavidin-kombineret magnetiske perler fra trin 4.1 til prøven.
  6. Inkuber blanding i 30 min. ved 25 ° C under konstant omrystning på 950 rpm i en mixer.
    Bemærk: Det anbefales at bladre rør hver 10 min for at forhindre sedimentation af perler.
  7. Sted rør på den magnetiske stå, Fjern supernatanten og vaske perlerne tre gange med 750 µL af pre varmede B & W buffer på 55 ° C.
    Bemærk: Den optimale vask temperatur lidt afviger/variere mellem forskellige ASOs. Det anbefales at justere denne betingelse ikke-crosslinked total RNA forudgående udfører eksperiment med celle ekstrakter.
  8. Elueres RNA i 20 µL af 10 mM Tris-HCl, pH 7,5 ved 90 ° C i 10 min med konstant ryster på 950 rpm i en mixer. Sted rør i den magnetiske stå og straks eluatet.
    Bemærk: Til proteinanalyse, tilføje 20 µL 1 × Laemmli buffer til perlerne og inkuberes ved 95 ° C til 5 min. proteiner er overvåget af immunblot analyse efter standard laboratorium protokoller.

Representative Results

Vi udviklede en ASO-baserede RNA isolering strategi, kaldes tur, for at fange bestemt mRNAs med deres bundne proteiner fra tre forskellige organismer37. Det væsentlige, RNA-protein komplekser blev crosslinked i vivo af UV-bestråling af celler på 254 nm, og poly(A) RNA'er blev inddrevet med kommercielt tilgængelige oligo (dT) kombineret-magnetiske perler, så mRNA af interesse blev isoleret med 3'-biotinylated 2-0'-methoxy ændrede antisense RNA-oligonukleotider (figur 1). Vi derfor designet flere 21-24 nts ændret ASOs med fuld-komplementaritet til regioner i den valgte mRNAs fra gær, C. elegans og menneskelige, og testet deres egnethed til at inddrive mRNA af interesse (en liste over primere og ASOs er givet i tabel 1). effektiviteten og specificiteten af individuelle ASOs blev først vurderet med ikke-crosslinked total RNA isoleret fra de respektive organisme. I disse eksperimenter var RNA ASOs koblet til streptavidin-konjugeret Paramagnetiske perler og inkuberes med ikke-crosslinked total RNA forberedt fra den tilsvarende organisme. Efter udgivelsen af erobrede mRNAs fra glasperler, tilstedeværelsen af mRNA mål såvel som ikke-forretningsmæssigt forbundne kontrol mRNAs blev overvåget af reverse transkription (RT)-polymerase kædereaktion (PCR)37. Vi har bemærket, at to variabler, saltkoncentration og temperatur på vask buffere, spillede afgørende roller i effektivitet af separation af PFK2 mRNA fra gæren, der blev testet med tre forskellige ASOs (figur 2A). Sænkning salt (NaCl) koncentrationen til 25 mM reduceret genopretning af negativt kontrol mRNA (PFK1) til ikke-sporbare niveauer med alle ASOs, men det også reduceret genopretning af den ønskede målrette mRNA PFK2 (10-15% af input). Omvendt, en stigning af salt koncentrationer til fysiologiske niveauer (150 mM NaCl) steg tilbagesøgning af PFK2 mRNAs op til 75% med ASO PFK2-2, overskridelse af kontrol PFK1 mRNA af mindst 5-fold (figur 2A). Yderligere bemærke viste de forskellige ASOs stor variation af mRNA target fange efficacies i fysiologisk salt-koncentrationer, understreger behovet for empirisk efterprøvelse af ASOs. Afhængighed af mRNA opsving temperatur af wash buffer er eksemplificeret for C. elegans cep-1 og gær RPS20 mRNAs, ved hjælp af respektive ASOs (tabel 1). Vi bemærkede, at den optimale vask temperatur var mellem 50 ° C og 55 ° C, som fremgår af den lave baggrunden med uafhængige mRNAs og effektiv inddrivelse af mRNAs mål (figur 2B). På dette tidspunkt, vil vi gerne understrege muligheden for cross-hybridisering af ASOs med andre mRNAs. For eksempel, DNM1 ASO er fuldt ud supplerer en sekvens i DNM1 kodende sekvens, men det også delvist anneals med Akt1 mRNA. DNM1 ASOs genvundet både mRNAs uanset temperaturen vask viser stærk tilbøjelighed til cross-hybridisering (figur 2 c). Endelig, vi har brugt de ovenfor beskrevne test og optimeringer at vælge tre ASOs, der var egnet til genopretning af respektive mål mRNAs fra total RNA isoleret fra S. cerevisiae, C. elegans og menneskelige celler (figur 2D ).

Efter første udvælgelse af passende ASOs in vitro udførte vi tur med celle ekstrakter fremstillet af UV-crosslinked organismer/celler (figur 1). Specifikt, vi testet genopretning af tre forskellige mRNAs fra tre forskellige organismer: PFK2 mRNA fra gæren S. cerevisiae, cep-1 fra den ødelægge C. elegans, og en reporter mRNA (pGL3-CDKN1B-3'UTR) forsynet med 3' UTR sekvens af menneskelige CDKN1B/p27 mRNA smeltet til en luciferase (luc) reporter for forbigående udtryk i humane HEK293 celler. Du kan styre specificiteten af RNA isolering, vi overvåges inddrivelse af flere uafhængige mRNAs, og vi udførte eksperimenter for konkurrence ved tilsætning af et overskud af pA til celle ekstrakter, der konkurrerer med bindingen af cellulære mRNAs til oligo(dT)25 perler i løbet af de første trin rensning trin. Som tidligere set med ikke-crosslinked total RNA prøver (figur 2), RT-PCR bekræftede berigelse af de respektive mRNAs målrette mRNA under turen, der henviser til, at flere ikke-relaterede kontrol mRNAs ikke var beriget (figur 3A). Desuden hverken mRNAs blev opdaget på perler uden ASOs, med angivelse af passende blokerende procedurer, at undgår uspecifik bindende. På denne linje, kan uafhængige/scrambled ASOs også bruges som kontrol, selv om mulighederne for cross-hybridisering med visse mRNAs og afledt erobringen af bundne proteiner derefter skal tages i betragtning. Da proteiner i det endelige eluatet kunne visualiseres næppe på sølv-farvede polyacrylamidgeler (data ikke vist), blev tilstedeværelsen af tidligere kendte mRNA interagerende proteiner yderligere vurderet af immunblot analyse. Dette omfatter Pfk2p fra S. cerevisiae, som binder sig selektivt til PFK2 mRNA i et ribosom uafhængigt12; C. elegans GLD-1, en kanonisk RBP, der binder sig til 3' UTR sekvenser af cep-1 mRNA for Translationel forordning43; og HuR, en RBP, der regulerer mRNA stabilitet og oversættelse af p27/CDKN1B mRNA44. Som forventet, var alle disse proteiner identificeret i tur eluater af respektive mRNAs ved Western Blot analyse (figur 3B).

Figure 1
Figur 1. Skematisk fremstilling af tur. Proteiner er crosslinked til RNA i vivo af UV-bestråling. I det første trin (lys grøn boks) inddrives poly(A) RNA-protein komplekser med oligo(dT)25 perler anvender strenge vask betingelser at fjerne ubundne proteiner. I det andet trin (pink box), target mRNP er trukket ud med biotinylated antisense RNA-oligonukleotider og streptavidin perler. De rensede mRNPs er derefter analyseret af RT-PCR og immunblot /-massespektrometri (MS) at identificere RNA'er og proteiner interagere med mRNA af interesse, hhv. Tallet blev ændret fra tidligere publikation37 med tilladelse. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2. Isolering af valgte mRNAs fra total RNA ikke-crosslinked celler/organismer ved anvendelse af modificerede antisensstoffer RNA capture sonder. (A) virkningen af salt koncentrationer om fanger af effektiviteten af gær PFK2 mRNA med ASOs. Total RNA fra gærceller blev kombineret med de angivne ASOs og vasket med buffer, som indeholder den angivne salt (NaCl) koncentration ved 55 ° C. Grøn, blå og orange linjer repræsenterer PFK2 mRNA opsving med forskellige ASOs som fastlagt af RT-PCR37: PFK2-1 og PFK2 -2 bind i 3' UTR, PFK2-4 i CDS. PFK1 er en negativ kontrol mRNA. PCR blev udført med 32 forstærkning cyklusser og kvantificeres som tidligere beskrevet37. (B) brøkdel af C. eleganscep-1 og gær RPS20 ASO bundet mRNAs ved forskellige vask temperaturer, repræsenteret i sorte og røde linjer, henholdsvis. C. eleganspgk-1 og gær Akt1 er ikke-målarter (kontrol) mRNAs. 30 og 32 PCR cykler blev anvendt til påvisning af gær og C. elegans mRNAs, henholdsvis. (C) skematisk gengivelse af hybridisering af DNM1 ASO (rød) med sekvenser i det DNM1 mRNA samt potentielle cross-hybridisering med Akt1 mRNA er vist til venstre. En agarosegel viser produkter fra RT-PCR reaktioner (30 cyklusser) til påvisning af gær DNM1 og Akt1 mRNAs elueres fra perler er vist til højre. Input, total RNA; Sn, supernatanten efter inkubation med ASOs; E, eluater fra perler vasket på angivne temperaturer forudgående eluering (40 ° C, 50 ° C og 60 ° C). Et kontrol-eksperiment (Ctrl) blev udført sideløbende uden at tilføje ASO. (D) Agarosen gel viser RT-PCR produkter til påvisning af mRNAs (højre) erobret fra total RNA gær S. cerevisiae, C. elegansog humane HEK293 celler (H. sapiens). Input, total RNA; Sn, supernatanten; E, eluater fra glasperler. PCR blev udført af 30 forstærkning cyklusser for gær mRNAs, 32 cyklusser for C. elegans mRNAs, og 28 og 30 cykler for menneskelige tubulin og p27 mRNAs, henholdsvis. Tallet blev ændret fra tidligere publikation37 med tilladelse. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3. Erobringen af specifikke mRNA-protein komplekser fra uddrag stammer fra UV crosslinked celler med tur. (A) Agarosen geler til påvisning af mRNAs (til højre) med RT-PCR ved opsamling med oligo(dT) og angivne ASOs fra S. cerevisiae, C. elegans og menneskelige (H. sapiens) celle ekstrakter. Input, total RNA fra crosslinked celler/organismer; CTRL, kontrol uden ASO. Poly(A), konkurrence med poly(A). RT-PCR blev udført som beskrevet37 med 35 forstærkning cyklusser for LUC, 32 cyklusser for p27, og 29 cykler til tubulin. (B) immunblot analyse af mRNA-bundet proteiner med angivne antistoffer (til højre). Indlæst fraktioner er som følger: 0,1%, 2,5% og 1% for gær, ødelægge og menneskelige indgange; 10%, 10% og 5% for gær, ødelægge og menneskelige oligo(dT) baner; og 66% for alle ASOs baner. Molekylær vægt (MW) er angivet i kilodaltons (kDa). Figur genudgives med tilladelse37. Venligst klik her for at se en større version af dette tal.

Primer navn Sekvens Target Størrelse
Pfk2_Fwd GTGTTAAGGGTTCACATGTCG PFK2 S. cerevisiae 133 bp
Pfk2_Rev CTTCCAACCAAATGGTCAGC PFK2 S. cerevisiae 133 bp
Pfk1_Fwd GGTGATTCTCCAGGTATGAATG PFK1 S. cerevisiae 97 bp
Pfk1_Rev CTTCGTAACCTTCGTAAACAGC PFK1 S. cerevisiae 97 bp
Act1_Fwd GTCTGGATTGGTGGTTCTATC Akt1 S. cerevisiae 85 bp
Act1_Rev GGACCACTTTCGTCGTATTC Akt1 S. cerevisiae 85 bp
Dnm1_Fwd CTGTGTTCGATGCATCAGAC DNM1 S. cerevisiae 156 bp
Dnm1_Rev CGCACTCCAATTCTTCTCTC DNM1 S. cerevisiae 156 bp
Rps20_Fwd CGCTGAACAACACAACTTGG RPS20 S. cerevisiae 228 bp
Rps20_Rev GGAAGCAACAACAACTTCGAC RPS20 S. cerevisiae 228 bp
Cep1_Fwd CGATGAAGAGAAGTCGCTGT CEP-1 C. elegans 110 bp
Cep1_Rev ATCTGGGAACTTTTGCTTCG CEP-1 C. elegans 110 bp
Pgk1_Fwd GCGATATTTATGTCAATGATGCTTTC PGK-1 C. elegans 74 bp
Pgk1_Rev TGAGTGCTCGACTCCAACCA PGK-1 C. elegans 74 bp
Mpk1_Fwd TGCTCAGTAATCGGCCATTG MPK-1 C. elegans 74 bp
Mpk1_Rev TCCAACAACTGCCAAAATCAAA MPK-1 C. elegans 74 bp
p27_Fwd TTTAAAAATACATATCGCTGACTTCATGG P27 H. sapiens 212 bp
p27_Rev CAAAGTTTATGTGCTACATAAAAGGTAAAAA P27 H. sapiens 212 bp
Luc_Fwd AATGGCTCATATCGCTCCTGGAT Luciferase P. pγralis 117 bp
Luc_Rev TGGACGATGGCCTTGATCTTGTCT Luciferase P. pγralis 117 bp
Β-TUBULIN_Fwd CTGAACCACCTTGTCTCAGC Β-TUBULIN H. sapiens 136 bp
Β-TUBULIN_Rev AGCCAGGCATAAAGAAATGG Β-TUBULIN H. sapiens 136 bp
PFK2-1 ASO AAUAGAAAGUGUAAUAAAAGGUCAU 3' UTR PFK2 S. cerevisiae -
PFK2-2 ASO GUUUCAUGGGGUAGUACUUGU 3' UTR PFK2 S. cerevisiae -
PFK2-4 ASO CUUGAAGAGGAGCGUUCAUA ORF PFK2 S. cerevisiae -
DNM1 ASO UCGGUCAGUGGAGGUUCAGCGUUU ORF DNM1 S. cerevisiae -
RPS20 ASO GUCGGUAAUAGCCUUCUCAUUCUUG ORF RPS20 S. cerevisiae -
CEP-1 ASO GUGAGAAAUGCGGUGCUUUGAAA 3' UTR cep-1 C. elegans -
P27 ASO UCAUACCCCGCUCCACGUCAGUU 3' UTR p27 H. sapiens -

Tabel 1. Oligonukleotid sekvenser. Liste over PCR primere og ASOs bruges i dette arbejde, primer sekvens, gen mål og forventede fragment størrelse efter forstærkning.

Discussion

TUR tillader analyse af proteiner bundet til specifikke mRNAs i vivo biokemiske midler. Mens vi har brugt metoden til validering af samspillet mellem bestemte RBPs og mRNA mål fra forskellige organismer/celler, kunne turen også være relevant at undersøge andre typer poly(A) RNA'er, såsom cytoplasmatisk lang klarlægning. Derudover kunne systematisk analyse af bundne proteiner og/eller RNA'er med MS eller RNA sekventering opnås ved en opskalering af proceduren. I denne forbindelse tyder vores foreløbige data på, at 1 L af gær kulturer og mindst 100 millioner af humane HEK293 celler kunne give tilstrækkelig råvare for at opnå pålidelige MS data for godt udtrykt mRNAs (upubliceret resultater).

Den beskrevne tur protokol omfatter bestråling af celler med UV-lys ved 254 nm til bitmapgenkendelse RNA-protein interaktioner. Dette giver mulighed for gennemførelse af strenge vask betingelser under rensningen. Ikke desto mindre, selv ikke udtrykkeligt testet, vi ønsker at Bemærk at crosslinking er valgfri og aktive RNPs kan også inddrives med fysiologiske buffere. Men, i dette tilfælde den potentielle re arrangement af proteiner og eller RNA'er på target RNA i lysates bør tages i betragtning. Omvendt, hvis UV eller andre crosslinking procedurer er anvendt (f.eks, formaldehyd), integriteten af RNA bør evalueres som RNA nedbrydning kan føre til formindsket inddrivelse af mRNPs. Derudover UV crosslinking er temmelig ineffektive (~ 5%) og endnu mindre for proteiner interagere med dobbelt-strenget RNA, som kunne indføre bias til påvisning af visse klasser af RBPs12. Endelig, UV-bestråling kan også fremkalde protein-protein og protein-DNA krydsbindinger, der bør overvejes for data fortolkning45,46. Derfor, alternative crosslinking procedurer, for eksempel med formaldehyd, kunne også være af særlig interesse at fange større protein forsamlinger på mRNAs.

En af nøglefunktionerne i tur er to-trin ASO-baserede rensning procedure at inddrive bestemt RNA'er, således øge selektiviteten og faldende sandsynligheden for Co rensende forurenende stoffer. For eksempel, vedrører en bekymring tilføjelse biotinylated ASOs direkte til celle ekstrakter, hvilket kunne føre til co rensning af biotin-bindende proteiner. Dette er omgået i tur ved at gennemføre en første runde af rensning af poly(A) RNA'er ved hjælp af kovalent koblede oligo-(dT)25 magnetiske perler, som giver mulighed for strengere rensning betingelser som gjort for RNA-protein interactome fange. Derudover poly(A) RNA udvalg fjerner meget rigelige klarlægning, såsom ribosomale RNA'er og tRNAer, og derfor reducerer kompleksiteten af prøve- og potentielle kilder til cross-hybridisering og forurening. I det andet trin, særlig mRNAs inddrives med biotinylated og ændrede ASOs, at anneal med regioner på mRNA mål. Alternativt, modificerede ASOs kunne også direkte kovalent knyttes til magnetiske perler via en Amin-linker, reducere tilbøjeligheden til at fange biotin-bindende proteiner. Imidlertid vores erfaring inddrevet inkubation af poly(A) RNA fraktion med ASOs før tilsætning af streptavidin perler mRNPs mere effektivt end direkte tilsætning af ASO-kombineret perler. Eventuelt er gratis oligos kinetically begunstiget med bedre adgang til sekvenser i struktureret RNA sammenlignet med immobiliserede oligos. Derfor, ASOs kovalente koblingen til perler før inkubation med prøven kunne være til skade for inddrivelse af RNA mål og afprøves empirisk.

En ulempe med ASO baseret metoder er ineffektive genopretning af nogle mål mRNAs. Derfor anbefaler vi evalueringen af flere ASOs, at anneal til forskellige regioner i afskriften. Konkret foreslår vi, at udformningen af 2-3 ASOs, at anneal med sekvenser i 3'-UTR eller CDS af mRNA af interesse. Hver ASO kan udstille en anden effektivitet til genopretning af de respektive mRNA mål og bør være empirisk testet (figur 2A, B, data ikke vist). Ved udgangen fandt vi at ASOs udglødning at 3' UTRs klarede sig bedre i forhold til dem, udglødning til cd'er. Dette kunne være på grund af øget tilgængelighed af bindende websteder i UTRs på grund af manglen oversættelse af ribosomer, hvorimod ribosomer kan hindrer effektiv hybridisering inden for cd'er. Vi har også oplevet at kombinationen af flere ASOs kunne føre til øget forurening fra rigelige ikke-målarter mRNAs og reduceret pull-down effektivitet. Under alle omstændigheder af den valgte oligos selektivitet kan styres af konkurrence eksperimenter (fx., tilsætning af konkurrerende oligos).

En yderligere bekymring vedrører potentielle cross-hybridisering med uafhængige RNA'er, så vi observeret, at selv en delvis hybridisering med andre mRNAs kan føre til genopretning af dette mRNA (figur 2 c). For at vurdere egnetheden af de designede ASOs, anbefaler vi derfor, udfører indledende in vitro- test med samlede RNA'er at optimere salt koncentrationer og vask temperatur af buffere. Vask af streptavidin-kombineret magnetiske perler i buffere indeholdende 150 mM NaCl ved 55 ° C klarede sig bedst i vores hænder, men vi anbefaler uafhængige tests af betingelserne for hver enkelt designet ASO. Bemærkelsesværdigt, fandt vi, at alle ASOs valgte fra in vitro forsøg, (figur 2D) var passende til at indfange de respektive mRNA målværdi crosslinked celle ekstrakter (figur 3), yderligere underbygger gyldigheden af i vitro test. Udover designe egnet ASOs til mRNA capture, kan yderligere faktorer indvirke på selektivitet. Således kan omfattende blokerende procedurer med BSA og/eller tRNA specifikationerne type perle forhindre uspecifik binding til perler. For yderligere at reducere uspecifik absorption af proteiner, anbefale vi også brugen af Lo-binde rør, især når du arbejder med små mængder af prøver.

Generelt, turen kan supplere tidligere etablerede metoder til at fange RNA'er med ASOs. For eksempel, blev ikke-kodende RNA Xist isoleret med bundne proteiner fra nukleare uddrag stammer fra 200-800 millioner UV crosslinked celler ved hjælp af en bred vifte af lange (90-mer) biotinylated DNA oligonukleotider som dækkede hele udskriften 34,35. Imidlertid valgte flisebelægning tilgang kunne blive problematiske i lyset af det store potentiale for cross-hybridisering med uafhængige RNA'er, og det kan ikke bruges til at vælge specifikke udskrift, fx., alternativt splejset former. For nylig, specialdesignet låst nukleinsyre (LNA) eller DNA ASO mixmers blev kovalent knyttet til en magnetisk harpiks til at inddrive i vitro udskrift eller stærkt udtrykt ribosomale RNA'er fra celle-gratis uddrag; Det blev dog ikke testet for inddrivelse af i vivo dannes mRNA-protein komplekser36. I lyset af den øgede anerkendelse af post-transcriptional gen kontrol af RBPs og ncRNA mener vi, at turen er en nyttig metode til at undersøge sammensætningen og dynamikken i RNP komplekser i celler ved intracellulær og miljømæssige stikord og dens konsekvenser i sundhed og sygdom.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Vi er taknemmelige for Dr. Jonathan Hall og Mauro Zimmermann (ETH Zürich) syntese af PFK2 og cep-1 ASOs, Dr. Maikel Wouters for udformningen af p27/CDKN1B ASOs, og Dr. Rafal Ciosk (Friedrich Miescher Institut for biomedicinsk forskning Basel) for anti-GLD-1 antistoffer. Dette arbejde blev støttet af bioteknologien og biologiske Sciences Research Council (BB/K009303/1) og en Royal Society Wolfson forskning Merit Award (WM170036) til A.P.G.

Materials

Name Company Catalog Number Comments
MaxQ 5000 Large Incubated and Refrigerated Orbital Shaker Thermo Fisher Scientific SHKE5000-8CE Floor shaker to grow yeast cells
BBD 6220 Thermo Fisher Scientific CO2 incubator to grow human cells
Sonicator Soniprep150 MSE MSS150.CX4.5 Sonicator/cell disruptor. Used to shear DNA in human cell lysates
Stratalinker 1800 Stratagene Stratalinker to expose cells to UV light at 254 nm
Tissue Lyser Qiagen RETSCH MM200 Device to mechanically disrupt yeast cells
Refrigerated Centrifuge Eppendorf 5810R Centrifuge to spin down cells, lysates
Shaking incubator, Thriller Peqlab Thermoshaker for 1.5 mL tubes
Glass beads 0.5mm Stratech Scientific Limited 11079105 Lysis of yeast cells
Nylon Filter, 0.41 μm Millipore NY4104700 Collection of yeast cells
Millex-HA Filter, 0.45 µm EMD Millipore SLHA02510 Filter to clear nematode lysate
Eppendorf LoBind microcentrifuge tubes Protein 1.5 mL Sigma-Aldrich 22431081 Minimise protein loss
2 mL microfuge tube Ambion AM12425 Yeast extract preparation and other applications
5 mL tube Thermo Fisher Scientific 129A Collection of HEK293 cell lysate
15 mL tube Sarstedt 62.547.254 Collection C. elegans
50 mL plastic tube Sarstedt 62.554.502 Collection yeast cells
DMEM, high glucose, pyruvate Thermo Fisher Scientific 41966 Media for culturing HEK293 cells
Penicillin-Streptomycin Sigma-Aldrich P4333 Used to supplement cell culture media to control bacterial contamination
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 Used to supplement cell culture media
Lipofectamine 2000 Thermo Fisher Scientific 11668027 Transfection reagent
RQ1 RNase-Free DNase Promega M6101 DNAse I to degrade DNA from cell lysate
RNasin Plus RNase Inhibitor Promega N2611 RNase inhibitor to avoid RNA degradation
cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail Roche 11836170001 Protease inhibitor cocktail to avoid protein degradation
Dynabeads Oligo (dT)25 Thermo Fisher Scientific 61011 Magnetic beads required for the first step of mRNA-protein complex purification
Dynabeads M-280 Streptavidin Thermo Fisher Scientific 11205D Magnetic beads required for the second step of mRNA-protein complex purification
E. coli tRNA Sigma-Aldrich 10109550001 transfer RNA from E. coli used for blocking streptavidin beads and avoid unsepecific interactions
Quick Start Bradford 1x Dye Reagent BioRad 5000205 To determine protein concentration within lysates, using BSA as reference
Bovine Serum Albumin Sigma A7906-100G Used to perform the standard curve that will be used as reference for protein concentration determination
mouse anti-Act1 MP Biomedicals 869100 Antibody for detection of yeast actin in Western blot (1:2,500)
mouse anti-Act1 Sigma A1978 Antibody for detection of human actin in Western blot (1:2,000)
mouse anti-HuR Santa Cruz sc-5261 Antibody for detection of HuR in Western blot (1:500)
mouse anti–CYC-1 Invitrogen 456100 Antibody for detection of Cyc-1 in Western blot (1:1,000)
peroxidase anti-peroxidase soluble complex Sigma P1291 Detection of Pfk2:TAP in Western blot (1:5,000)
HRP-conjugated sheep anti-mouse IgG Amersham NXA931 HRP-coupled secondary antibody

DOWNLOAD MATERIALS LIST

References

  1. Mitchell, S. F., Parker, R. Principles and properties of eukaryotic mRNPs. Molecular Cell. 54, (4), 547-558 (2014).
  2. Iadevaia, V., Gerber, A. P. Combinatorial Control of mRNA Fates by RNA-Binding Proteins and Non-Coding RNAs. Biomolecules. 5, (4), 2207-2222 (2015).
  3. McHugh, C. A., Russell, P., Guttman, M. Methods for comprehensive experimental identification of RNA-protein interactions. Genome Biology. 15, (1), 203 (2014).
  4. Matia-González, A. M., Gerber, A. P. Ch. 14. Fungal RNA Biology. Sesma, A., von der Haar, T. Springer. 347-370 (2014).
  5. Tsvetanova, N. G., Klass, D. M., Salzman, J., Brown, P. O. Proteome-wide search reveals unexpected RNA-binding proteins in Saccharomyces cerevisiae. PLoS One. 5, (9), (2010).
  6. Castello, A., et al. Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell. 149, (6), 1393-1406 (2012).
  7. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Molecular Cell. 46, (5), 674-690 (2012).
  8. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nature Protocols. 8, (3), 491-500 (2013).
  9. Liao, Y., et al. The Cardiomyocyte RNA-Binding Proteome: Links to Intermediary Metabolism and Heart Disease. Cell Reports. 16, (5), 1456-1469 (2016).
  10. Liepelt, A., et al. Identification of RNA-binding Proteins in Macrophages by Interactome Capture. Molecular Cell Proteomics. 15, (8), 2699-2714 (2016).
  11. Conrad, T., et al. Serial interactome capture of the human cell nucleus. Nature Communications. 7, 11212 (2016).
  12. Matia-Gonzalez, A. M., Laing, E. E., Gerber, A. P. Conserved mRNA-binding proteomes in eukaryotic organisms. Nature Structural and Molecular Biology. 22, (12), 1027-1033 (2015).
  13. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nature Structural and Molecular Biology. 20, (1), 127-133 (2013).
  14. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nature Communications. 6, 10127 (2015).
  15. Wessels, H. H., et al. The mRNA-bound proteome of the early fly embryo. Genome Research. 26, (7), 1000-1009 (2016).
  16. Sysoev, V. O., et al. Global changes of the RNA-bound proteome during the maternal-to-zygotic transition in Drosophila. Nature Communications. 7, 12128 (2016).
  17. Despic, V., et al. Dynamic RNA-protein interactions underlie the zebrafish maternal-to-zygotic transition. Genome Research. 27, (7), 1184-1194 (2017).
  18. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, 42 (2016).
  19. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  20. Koster, T., Marondedze, C., Meyer, K., Staiger, D. RNA-Binding Proteins Revisited - The Emerging Arabidopsis mRNA Interactome. Trends Plant Sciences. 22, (6), 512-526 (2017).
  21. Hamasaki, K., Killian, J., Cho, J., Rando, R. R. Minimal RNA constructs that specifically bind aminoglycoside antibiotics with high affinities. Biochemistry. 37, (2), 656-663 (1998).
  22. Bachler, M., Schroeder, R., von Ahsen, U. StreptoTag: a novel method for the isolation of RNA-binding proteins. RNA. 5, (11), 1509-1516 (1999).
  23. Vazquez-Pianzola, P., Urlaub, H., Rivera-Pomar, R. Proteomic analysis of reaper 5' untranslated region-interacting factors isolated by tobramycin affinity-selection reveals a role for La antigen in reaper mRNA translation. Proteomics. 5, (6), 1645-1655 (2005).
  24. Hartmuth, K., Vornlocher, H. P., Luhrmann, R. Tobramycin affinity tag purification of spliceosomes. Methods Molecular Biology. 257, 47-64 (2004).
  25. Beach, D. L., Keene, J. D. Ribotrap : targeted purification of RNA-specific RNPs from cell lysates through immunoaffinity precipitation to identify regulatory proteins and RNAs. Methods Molecular Biology. 419, 69-91 (2008).
  26. Slobodin, B., Gerst, J. E. A novel mRNA affinity purification technique for the identification of interacting proteins and transcripts in ribonucleoprotein complexes. RNA. 16, (11), 2277-2290 (2010).
  27. Slobodin, B., Gerst, J. E. RaPID: an aptamer-based mRNA affinity purification technique for the identification of RNA and protein factors present in ribonucleoprotein complexes. Methods Molecular Biology. 714, 387-406 (2011).
  28. Yoon, J. H., Gorospe, M. Identification of mRNA-Interacting Factors by MS2-TRAP (MS2-Tagged RNA Affinity Purification). Methods Molecular Biology. 1421, 15-22 (2016).
  29. Leppek, K., Stoecklin, G. An optimized streptavidin-binding RNA aptamer for purification of ribonucleoprotein complexes identifies novel ARE-binding proteins. Nucleic Acids Research. 42, (2), 13 (2014).
  30. Blencowe, B. J., Sproat, B. S., Ryder, U., Barabino, S., Lamond, A. I. Antisense probing of the human U4/U6 snRNP with biotinylated 2'-OMe RNA oligonucleotides. Cell. 59, (3), 531-539 (1989).
  31. Lingner, J., Cech, T. R. Purification of telomerase from Euplotes aediculatus: requirement of a primer 3' overhang. Proceedings of the National Academy of Sciences U S A. 93, (20), 10712-10717 (1996).
  32. Upadhyay, A., Dixit, U., Manvar, D., Chaturvedi, N., Pandey, V. N. Affinity capture and identification of host cell factors associated with hepatitis C virus (+) strand subgenomic RNA. Molecular Cell Proteomics. 12, (6), 1539-1552 (2013).
  33. Imig, J., et al. miR-CLIP capture of a miRNA targetome uncovers a lincRNA H19-miR-106a interaction. Nature Chemical Biology. 11, (2), 107-114 (2015).
  34. Chu, C., et al. Systematic discovery of Xist RNA binding proteins. Cell. 161, (2), 404-416 (2015).
  35. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  36. Rogell, B., et al. Specific RNP capture with antisense LNA/DNA mixmers. RNA. 23, (8), 1290-1302 (2017).
  37. Matia-Gonzalez, A. M., Iadevaia, V., Gerber, A. P. A versatile tandem RNA isolation procedure to capture in vivo formed mRNA-protein complexes. Methods. 93-100 (2017).
  38. Gruber, A. R., Lorenz, R., Bernhart, S. H., Neubock, R., Hofacker, I. L. The Vienna RNA websuite. Nucleic Acids Research. 36, (Web Server issue), Available from: http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi W70-W74 (2008).
  39. Kalendar, R., Khassenov, B., Ramankulov, Y., Samuilova, O., Ivanov, K. I. FastPCR: An in silico tool for fast primer and probe design and advanced sequence analysis. Genomics. 109, (3-4), Available from: http://primerdigital.com/tools/PrimerAnalyser.html 312-319 (2017).
  40. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  41. Stiernagle, T. Maintenance of C. elegans. WormBook. 1-11 (2006).
  42. Kedde, M., et al. A Pumilio-induced RNA structure switch in p27-3' UTR controls miR-221 and miR-222 accessibility. Nature Cell Biology. 12, (10), 1014-1020 (2010).
  43. Schumacher, B., et al. Translational repression of C. elegans p53 by GLD-1 regulates DNA damage-induced apoptosis. Cell. 120, (3), 357-368 (2005).
  44. Ziegeler, G., et al. Embryonic lethal abnormal vision-like HuR-dependent mRNA stability regulates post-transcriptional expression of cyclin-dependent kinase inhibitor p27Kip1. Journal of Biological Chemistry. 285, (20), 15408-15419 (2010).
  45. Itri, F., et al. Femtosecond UV-laser pulses to unveil protein-protein interactions in living cells. Cellular and Molecular Life Sciences. 73, (3), 637-648 (2016).
  46. Zhang, L., Zhang, K., Prandl, R., Schoffl, F. Detecting DNA-binding of proteins in vivo by UV-crosslinking and immunoprecipitation. Biochemical and Biophysical Research Communications. 322, (3), 705-711 (2004).
En oligonukleotid-baserede Tandem RNA isolering Procedure at inddrive eukaryote mRNA-Protein komplekser
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Iadevaia, V., Matia-González, A. M., Gerber, A. P. An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes. J. Vis. Exp. (138), e58223, doi:10.3791/58223 (2018).More

Iadevaia, V., Matia-González, A. M., Gerber, A. P. An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes. J. Vis. Exp. (138), e58223, doi:10.3791/58223 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter