Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Процедура изоляции на основе олигонуклеотида тандем РНК для восстановления эукариотические мРНК белковых комплексов

doi: 10.3791/58223 Published: August 18, 2018
* These authors contributed equally

Summary

Описывается процедура изоляции тандем РНК (поездка) для восстановления эндогенно сформированных мРНК белковых комплексов. Конкретно комплексы РНК белок, сшитыми в естественных условиях, polyadenylated РНК, изолированы от выдержки с oligo(dT) бусы, и частности mRNAs фиксируются с модифицированных олигонуклеотидов Антисмысловые РНК. Белки, привязан к мРНК распознаются immunoblot анализа.

Abstract

RNA-связывая протеинов (ОДП) играют ключевую роль в элементе post-transcriptional экспрессии генов. Таким образом биохимическая характеристика мРНК белковых комплексов имеет важное значение для понимания регулирования мРНК, выводимый платформой взаимодействия белков или RNAs-кодирования. Здесь мы описываем процедура изоляции тандем РНК (поездки), которая позволяет очистки эндогенно сформированных мРНК белковых комплексов из клеточных экстрактов. Двухэтапный протокол включает изоляции polyadenylated мРНК с бисером антисмысловых oligo(dT) и последующего захвата мРНК интерес с 3'-биотинилированным 2'-O-метилированную Антисмысловые РНК олигонуклеотиды, которые затем могут быть изолированы с стрептавидина бисер. Поездка была использована для восстановления в vivo высокоструктурированные мРНК рибонуклеопротеида (mRNP) комплексы из дрожжей, нематод и человеческих клеток для дальнейшего анализа РНК и белка. Таким образом поездка является универсальный подход, который может быть адаптирован для всех видов polyadenylated РНК различных организмов для изучения динамических переоборудование mRNPs, введенных внутриклеточных или экологические сигналы.

Introduction

Регулирование POST-transcriptional гена управляется через взаимодействия RNA-связывая протеинов (ОДП), некодирующих РНК (ncRNAs) и мРНК, который прямой обработки, локализация, перевод и распад каждый Стенограмма внутри клетки1 , 2. выявление ОДП и ncRNA взаимодействия с конкретной мРНК, установления, что известно как рибонуклеопротеида комплексы/частиц (RNPs), поэтому является ключом к пониманию судьбы мРНК и ген выражение элемента управления. Взаимодополняющие подходы осуществляются для биохимических характеристик RNP комплексов3,4: в то время как «белка ориентированных» подход основан на очищения конкретных ОДП, «РНК ориентированных» подход предполагает изоляция субпопуляций или отдельных молекул РНК и последующего анализа взаимодействия белков и РНК. Недавно, РНК ориентированный подход для выявления ОДП репертуар, взаимодействующих с polyadenylated (poly(A)) РНК5 становится все более популярным, включив ультрафиолетового (УФ) света сшивки шаг для стабилизации белка РНК взаимодействие предварительного изоляции мРНК, который значительно расширенный каталог ОДП в клетки человека6,,78,9,10,11, Caenorhabditis elegans 12, saccharomyces cerevisiae12,13,14и другие организмы15,16,17,18, 19,20. Однако картирования белков и/или ncRNAs, собрал на конкретных протоколов по-прежнему большой проблемой. С этой целью в настоящее время используются два основных подхода: с одной стороны, РНК aptamer Теги сплавлены к РНК интерес для включения очищение сродства. Таким образом аптамеры РНК связываются с высоким сродством аминогликозидами антибиотики, включая тобрамицина и стрептомицина21,,2223,24, или белков, таких как протеин пальто из R17/MS2 бактериофага или бактериальной стрептавидина S125,26,27,,2829. Хотя этот подход был показан относительно надежный и универсальный, он требует клонирование дизайна РНК под следствием и таким образом не может использоваться для захвата природных мРНК. С другой стороны для восстановления на раннем этапе использовались антисмысловых олигонуклеотидов (ASOs) и характеристика высоко выразил родной RNPs30,31 и вирусной РНК32. Совсем недавно ASOs были применены для захвата долго не кодирования RNAs33,34,-35 и в пробирке образовали mRNPs36. Один из основных факторов, препятствующих с все РНК ориентированных подходов — это копия количество РНК интерес, делая восстановлению низкого выразил mRNAs более проблематичным. Это ограничение можно преодолеть путем масштабирования реакции; Однако это потенциально может привести к увеличению на фоне.

Здесь мы описываем наш недавно разработанных на основе Асо тандем процедуры изоляции РНК (поездка) изолировать родной мРНК белковых комплексов с высокой селективностью37 (рис. 1). Протокол включает два последовательных очистки на основе Асо шаги, а именно изоляции poly(A) мРНК с коммерчески доступных oligo(dT) сочетании бусы, следуют захвата конкретные мРНК, используя специально разработанные короткие биотинилированным 2'-метокси ASOs РНК. Эта двухэтапная процедура помогает, устраняя загрязняясь протеины и добавляет возможности для перестройки и оптимизации. В этом случае поездка была применена на выбранных мРНК из дрожжей, нематоды, и человеческие клетки для подтверждения в естественных условиях образуется мРНК белковых комплексов.

Protocol

1. дизайн антисмысловых олигонуклеотидов (ASOs)

  1. Анализ вторичной структуры мРНК или фрагмент их с использованием доступных онлайн инструменты38. Таким образом введите последовательность нуклеотидов (nt) в пустое поле. В поле Основные параметры выберите минимум свободной энергии (MFE) и функции секционирования и избежать изолированных пар оснований. В диалоговом окне Параметры вывода выберите участок вторичная структура интерактивного РНК и наконец нажмите на кнопку продолжить . Новое окно будет всплывающее окно, отображающее вторичную структуру mRNA интереса.
  2. Выберите по крайней мере три различных 21-24 НТС длинные последовательности внутри mRNA интереса, преимущественно в регионах, не хватает обнаружению вторичных структур (например., в неструктурированных петли) и в 3' untranslated регионов (утр).
    Примечание: Было отмечено, что ASOs, отжиг в последовательности в 3' untranslated регионах (утр) показала лучшие. Одним из возможных вариантов является, что рибосомы, обязан кодирующая последовательность (CDS) иногда могут препятствовать отжиг ASOs. ASOs отжига для 5' необычных, не были проверены.
    1. Выберите регионы с коэффициентом гуанидина/цитозин почти 50% и не хватает нуклеотидов тандем повторяет чтобы избежать потенциального формирования заколки или самостоятельно отжига.
  3. Вручную дизайн 2'-метокси изменения РНК олигонуклеотиды, принимая биотина группу на 3', полностью дополняют друг друга в отдельных регионах (шаг 1.2) в пределах желаемого целевых мРНК.
    Примечание: 2'-метокси изменения визуализации РНК устойчив к сотовой полиадениновый и увеличивает дуплекс температура плавления, который позволяет для строгих стирки. Для захвата ASOs с стрептавидина требуется остаток биотина.
    1. Отрегулируйте температуру плавления RNA гибридов до ~ 60-65 ° C и убедитесь, что она имеет высокие лингвистические последовательности сложность (> 60%) как определено с подходящим онлайн инструменты39.
    2. Используйте основные местные выравнивание инструмент поиска40 для поиска потенциальных Асо крест гибридизации с другими mRNAs в транскриптом. Выберите Нуклеотидов взрыва, вставить последовательности в пустое поле и выберите организм интерес. Сохранить оставшиеся параметры по умолчанию и нажмите кнопку взрыва.
      Примечание: Даже частичное непрерывное выравнивание 8-10 ночей может привести к крест гибридизации и восстановления этого мРНК.

2. клетки культуры, УФ-облучения и клеточной Lysis

Примечание: В следующих, процедура описана для многообещающий дрожжей S. cerevisiae, круглые черви нематоды Caenorhabditis elegansи человеческих эмбриональных почечных клеток (HEK293). Тем не менее она может быть адаптирована для других организмов, а также, хотя он не был протестирован явно еще.

  1. S. cerevisiae
    1. Расти дрожжевых клеток (например., штамм BY4743 деривата; MATa/α his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 LYS2/lys2Δ0 met15Δ0/MET15 ura3Δ0/ura3Δ0 PFK2:TAP / PFK2) в 500 мл YPD СМИ (экстракт дрожжей 1%, 2% Пептон, 2% D-глюкозы) при 30 ° C с постоянной тряски на 220 об/мин.
    2. Собирать клетки на этапе среднего журнала (оптическая плотность 600 Нм (OD)600 ~ 0,6) путем фильтрации с использованием 0,45 мкм нейлон фильтры или центрифугирования в 3000 × g на 2 мин при комнатной температуре (RT). Отказаться от потока через или супернатанта, соответственно.
    3. Вымыть клетки три раза с 25 мл буфер фосфатный (PBS), с помощью фильтра 0.45 мкм нейлон или собрать центрифугированием в 3000 × g на 2 мин в RT и удалить супернатант. Соберите клетки как можно скорее как навязанные стресс может иметь влияние на РНК белковых взаимодействий.
    4. Ресуспензируйте клетки в 25 мл PBS и затем вливают 15 см Петри подвеска. Поместите блюдо на льду, снимите крышку и разоблачить клетки три раза с 400 МДж см-2 254 Нм УФ излучения в УФ сшивателя с перерывами 2-мин на льду между каждой экспозиции цикла с нежным смешивания.
    5. Клетки перехода к 50 мл трубки и собирать клетки центрифугированием в 3000 × г за 3 мин при 4 ° C. Отменить супернатант и держать гранулы.
      Примечание: Клетки можно привязать заморожены в жидком азоте и хранятся при температуре-80 ° C.
    6. Ресуспензируйте клетки в 4 мл охлажденного литического буфера A (LB-A; 100 мм трис-HCl, pH 7.5, 500 мм LiCl, 10 ЭДТА, 1% тритон X-100, 5 мм DTT, 20 U мл-1 , 100 U мл-1 RNasin, завершить ЭДТА бесплатный коктейль ингибитор протеазы DNase).
    7. Перевести клетки на две трубы 2 мл. Добавьте Макс. ⅔ объемов охлажденной стеклянные бусы и нарушить клетки в ткани lyser на 30 Гц 10 мин при 4 ° C.
    8. Пробить отверстие в нижней части трубы с горячей иглой и передать свежие 1,5 мл lysate центрифугированием при 600 g × 30 s.
    9. Очистите lysate на три последовательных centrifugations на 4 ° C на 3000 × г за 3 мин, затем 5000 × g и 10 000 × g за 5 мин.
      Примечание: Экстракты могут быть заморожены оснастки в жидком азоте и хранятся при температуре-80 ° C.
  2. C. elegans
    1. Черви Бристоль N2 культуры при 20 ° C на средний рост нематода (НГМ) пластины (0,3% NaCl, агар 1,7%, 0,25% Пептон, 1 мм CaCl2, холестерин 5 мкг/мл, 1 мм MgSO4, 25 мм КПО4 буфера, pH 6.0) семенами с штамм кишечной палочки ОР50 41 .
    2. Добавить 5 мл M9 буфера41 (0,3% х2PO4, 0,6% Na2HPO4, 0,5% NaCl, 1 мм MgSO4) в каждой пластины, встряхнуть пластину Ресуспензируйте червей и передать 15 мл трубки червей. 2 мкл суспензии в слайд и рассчитывать червей в суспензии с помощью микроскопа. Затем примените коэффициент для вычисления числа червей на пластины.
    3. Собирать ~ 120 000 червей центрифугированием при комнатной температуре (400 × g, 2 мин, RT) и удалить супернатант.
    4. Моют червей в три раза. Таким образом добавить 10 мл буфера M9, mix инверсии и собирать червей центрифугированием при 400 g × 2 мин на RT.
    5. Добавить 15 мл M9 буфера для червей и место на вращательное колесо 15 мин на RT.
    6. Передать NGM пластины (~ 4000 червей в Латы) червей и подвергать УФ света (254 Нм) на 300 МДж см-2 в УФ сшивателя.
    7. Добавьте 5 мл M9 буфера непосредственно к пластине и встряхнуть пластину для Ресуспензируйте червей в буфере. Передача подвеска с пипеткой в 15 мл трубку и собирать червей центрифугированием при 400 g × 2 мин на RT.
    8. Ресуспензируйте червей в 2 мл буфера lysis B (LB-B; 100 мм трис-HCl, рН 8,0, 150 мм NaCl, 1 ЭДТА, 0,75% IGEPAL, 1 мм DTT, 20 U мл-1 , 100 U мл-1 RNasin, завершить ЭДТА бесплатный коктейль ингибитор протеазы DNase).
    9. Измельчить червей в ступке заполнены с жидким азотом. Собирать порошок в 50 мл трубки и оттепели на RT.
      Примечание: Жидкого азота должны быть обработаны согласно процедуры безопасности (например, дыма капот и безопасности перчатки)
    10. Очистить lysate включая толстый слой центрифугированием в 14.000 g × 10 мин и впоследствии передать осветленный lysate через фильтр 0,45 мкм с помощью шприца.
  3. Культивируемых клеток человека
    Примечание: Следующее описание основывается на временных transfection клеток HEK293 с pGL3-CDKN1B-3' УТР репортер плазмида, который выражает 3′UTR CDKN1B/27 по течению Светлячок Люцифераза гена42.
    1. Культура HEK293 клетки в Дульбекко изменение Eagle среднего (DMEM) содержащий 25 мм глюкозы и 1 мм пируват натрия, дополненные 100 мл пенициллин-1 U, 100 мкг мл-1 стрептомицина и 10% плода бычьим сывороточным (ФБС) и инкубировать при 37 ° C в увлажненные палата (инкубатор), содержащая 5% CO2.
    2. Семя ~ 3 × 106 HEK293 клеток в культуре ткани стандартной 10 см блюдо за день до transfection. Подсчет количества ячеек с Горяева.
    3. Смешайте 2 мкг гена репортера (например., pGL3-p27-3' УТР) с 20 мкл Реагента transfection и transfect клетки на 70% confluency (~ 7 × 106 клеток).
    4. Место клетки в инкубаторе при 37 ° C для дальнейшего 48 ч до сбора урожая.
    5. Удалите носитель с Серологические Пипетки и быстро вымыть клетки дважды с 10 мл PBS, предварительно нагревают при 37 ° C. Удаление PBS с Серологические Пипетки.
    6. Добавить 6 мл PBS на блюдо, место на льду и затем подвергать клетки к Ультрафиолетовому излучению (254 Нм) на 100 МДж см-2 в УФ сшивателя.
      Примечание: Пластины должны храниться на льду во время облучения УФ свете.
    7. Соскрести клетки (в целом7 ~ 10 клетках) в PBS и передачи в 15 мл.
    8. Спин вниз клетки на 250 g × 10 мин при температуре 4 ° C и затем удалить супернатант с пипеткой.
      Примечание: Пелле клеток может оснастки замороженные в жидком азоте и хранятся при температуре-80 ° C до использования.
    9. Ресуспензируйте клетки в 2 мл буфера lysis предварительно охлажденные (LB-A), закупорить вверх и вниз для 5 - 6 раз, сохраняя трубку на льду.
    10. Трансфер lysate с пипеткой в 5 мл трубки помещены на льду.
    11. Тема lysate трех раундов sonication, состоящий из 20 s очередей на 10 мкм амплитуды с 30 s охлаждения периодов на льду.
      Примечание: Sonication рекомендуется как он завершает лизис клеток и фрагменты ДНК.
    12. Lysate передать 2 мл пробирок и центрифуги на 15000 × g 10 мин при 4 ° C. Собирать супернатант (= извлечение) и передача новой трубки. Удаление аналитической пробы (5-10%), далее белка и РНК анализа.
      Примечание: Этот шаг имеет решающее значение, чтобы удалить любые оставшиеся ячейки мусора и может быть повторен.

3. первый шаг: Poly(A) РНК изоляции

  1. Сбалансировать 1 мг, oligo(dT)25-сочетании магнитные бусы в 500 мкл соответствующих литического буфера.
  2. Объединить 5 мг, 10 мг или 4 мг (белка), S. cerevisiae, C. elegans или экстракты HEK293, соответственно, с 1 мг, oligo(dT)25 -сочетании магнитных шариков. Смешайте образцы энергично для 10 мин при 25 ° C в миксере.
    Примечание: Концентрации белка экстрактов может быть определен с assay Брадфорд, используя бычьим сывороточным альбумином (БСА) в качестве эталона. Энергичные пожимая образцов предотвращает осаждение бусины. Чтобы оценить специфику мРНК изоляции, эксперимент управления могут выполняться параллельно, добавив избыток (20 мкг) polyadenylic кислоты (ПА).
  3. Место труб на магнитной подставкой для 10 s и удалить супернатант. Держите супернатант на льду для последующих раундов восстановления (шаг 3.7).
  4. Добавьте 500 мкл мыть буфера A (10 мм трис-HCl, pH 7.5, 600 мм LiCl, 1 ЭДТА, 0.1% тритон X-100) бисер и вихревые для 5 s.
    Примечание: Концентрация LiCl в мыть буферов может варьироваться. 600 мм LiCl рекомендуется, но более низкие концентрации были также проверены (500 мм для C. elegans, 300 мм для HEK293).
  5. Собирать шарики с магнитом и затем смывают бусины дважды с 500 мкл буфера мытья B (ВБ; 10 мм трис-HCl, pH 7.5, 600 мм LiCl, ЭДТА 1 мм).
  6. Элюировать РНК в 30 мкл 10 мм трис-HCl, pH 7.5 при 80 ° C на 2 мин с непрерывной тряски (1000 об/мин) в смесителе. Сразу же поместить трубку в магнитного стенд и собирать элюата после 10 s. Сохраните шарики для дополнительных раундов очистки.
    Примечание: Как можно предотвратить потенциальные подменой mRNAs бисером при более низких температурах быстрее Соберите элюата.
  7. Добавить бусы из предыдущего шага в надосадке, собранные на этапе 3.3 и повторите захвата, стирки и элюции мРНК дважды (шаги 3,3-3,6). Элюаты от неоднократные раунды затем объединяются и могут храниться при температуре-80 ° C.

4. Второй шаг: захват конкретные мРНК с 3'-биотинилированным 2'-метокси Антисмысловые РНК модифицированных олигонуклеотидов

Примечание: Чтобы проверить пригодность ASOs, ниже процедура может быть выполнена с общей РНК, изолированных от клеток.

  1. Сбалансировать 30 мкл стрептавидина в сочетании магнитных шариков в 1 мл привязки и мыть буфера (B & W буфер; 10 мм трис-HCl, pH 7.5, 150 мм NaCl, 0.5 мм ЭДТА, рН 8,0) содержащий 0,1 мг мл-1Escherichia coli транспортная РНК (тРНК) на вращателе за 1 ч в RT.
    1. Вымойте бусины три раза с 750 мкл буфера B & W.
    2. Ресуспензируйте бисер в 30 мкл буфера B & W и держать на льду до использования.
  2. Разбавить ~ 35 мкг общего белка от предыдущих poly(A) изоляции (см. 3) в 100 мкл буфера B & W в 1,5 мл.
    Примечание: Чтобы проверить специфика ASOs с общей РНК, добавить 600 нг очищенного всего РНК до 100 мкл буфера B & W.
  3. Добавить 200 пмоль соответствующих Асо и Инкубируйте на 70 ° C за 5 мин.
    Примечание: При повышенной температуре устраняет вторичных структур в РНК, содействие отжиг опа.
  4. Удалите весь тепло блок из устройства и поместите его на RT 10 минут остыть медленно.
  5. Мкл 30 уравновешенной сочетании стрептавидина магнитные бусы из шага 4.1 для образца.
  6. Инкубируйте смесь для 30 мин при температуре 25 ° C с постоянной тряски на 950 об/мин в миксере.
    Примечание: Рекомендуется для Флик трубы каждые 10 мин для предотвращения оседания из бусин.
  7. Место труб на магнитную подставку, удалить супернатант и мыть бусины три раза с 750 мкл подогретым B & W буфера при 55 ° C.
    Примечание: Оптимальную температуру может слегка отличаться/варьироваться между различными ASOs. Рекомендуется настроить это условие с не сшитый всего РНК предварительного выполнения эксперимента с клеточных экстрактов.
  8. Элюировать РНК в 20 мкл 10 мм трис-HCl, pH 7.5 при 90 ° C на 10 мин с постоянной тряски на 950 об/мин в смеситель. Место труб в магнитного стенд и немедленно собирать элюата.
    Примечание: Для анализа белка, 20 мкл 1 буфер Лэмли × корда и Инкубируйте на 95 ° C за 5 мин белки контролируются immunoblot анализа следующие стандартные лабораторные протоколы.

Representative Results

Мы разработали стратегию изоляции на основе Асо РНК, назвал поездку, чтобы захватить частности мРНК с их связанных белков из трех различных организмов37. По существу, сшитыми в естественных условиях были комплексы РНК белок, УФ излучение клеток на 254 Нм и poly(A) РНК были восстановлены с коммерчески доступных oligo (dT) сочетании магнитные бусы, то mRNA интереса был изолирован с 3'-биотинилированным 2-0'-метокси изменение антисмысловых олигонуклеотидов РНК (рис. 1). Поэтому мы призваны регионы в выбранной mRNAs несколько ASOs НТС изменена 21-24 с полной взаимодополняемости от дрожжей, C. elegans и человека и проверку их пригодности для восстановления mRNA интереса (список грунты и ASOs дается в таблице 1). эффективность и специфику отдельных ASOs впервые были оценены с не сшитый всего РНК, изолированный от соответствующих организма. В этих экспериментах РНК ASOs были сочетании конъюгированных стрептавидина парамагнитных бисером и инкубировали с общей РНК не сшитый из соответствующего организма. После освобождения захваченных мРНК из бисера, присутствие mRNA цели также отношения управления mRNAs контролируется обратной транскрипции (RT)-полимеразной цепной реакции (ПЦР)37. Мы заметили, что две переменные, концентрация соли и температуры стирки буферов, сыграл решающую роль в эффективности улавливания мРНК PFK2 из дрожжей, который был протестирован с тремя различными ASOs (рисунок 2A). Снижение концентрации соли (NaCl) до 25 мм сокращены восстановления негативных контролировать мРНК (PFK1) не поддающихся обнаружению уровней с всеми ASOs, но она также сократила восстановления нужной целевой мРНК PFK2 (10-15% от ввода). И наоборот, увеличение концентраций соли до физиологических уровней (150 мм NaCl) увеличение восстановления мРНК PFK2 до 75% с Асо PFK2-2, превышающей элемента управления PFK1 мРНК, по крайней мере 5 раз (рис. 2A). Далее следует отметить различные ASOs показал большие вариации мРНК узкоспециализированного захвата цели на физиологической соли концентрации, подчеркивая необходимость эмпирические проверки ASOs. Зависимость температуры стирки буфера мРНК восстановления является примером C. elegans ВИС-1 и дрожжи RPS20 мРНК, используя соответствующие ASOs (Таблица 1). Мы наблюдали, что оптимальной температуры от 50 ° C до 55 ° C, как видно из низких фон с несвязанными мРНК и эффективного восстановления целевой mRNAs (Рисунок 2Б). На данный момент мы хотели бы подчеркнуть возможность крест гибридизации ASOs с другими мРНК. К примеру DNM1 Асо является полностью дополняет последовательность в DNM1 последовательности кодирования, но он также частично anneals с 1 акт мРНК. DNM1 ASOs восстановить оба mRNAs независимо от температуры стирки, показаны сильную склонность к крест гибридизации (рис. 2 c). Наконец мы использовали выше описанных испытаний и оптимизации для выбора трех ASOs, которые были пригодны для восстановления соответствующих целевых mRNAs от всего РНК, изолированный от S. cerevisiae, C. elegans и человеческих клеток (2D фигура ).

После первоначального отбора подходящих ASOs в пробирке, мы провели поездки с клеточных экстрактов, полученные от УФ сшитый организмов/клеток (рис. 1). В частности, мы протестировали восстановления трех различных мРНК из трех различных организмов: мРНК PFK2 из дрожжей S. cerevisiae, ВИС-1 от нематод C. elegans и репортер мРНК (pGL3-CDKN1B-3' УТР) подшипник 3' УТР последовательность мРНК человека CDKN1B/p27 сливается с репортером Люцифераза (Люк) для переходных выражение в клетках человека HEK293. Для управления специфика РНК изоляции, мы мониторинг восстановления нескольких несвязанных мРНК, и мы провели эксперименты конкуренции путем добавления избыток ПА клеточных экстрактов, которая конкурирует с привязкой сотовой мРНК oligo(dT)25 бусы на первом этапе шаг очистки. Как ранее увидено с не сшитый всего образцов РНК (рис. 2), RT-PCR подтвердил обогащения соответствующих mRNAs целевых мРНК во время поездки, в то время как несколько не связанных с управления мРНК не обогатились (рис. 3A). Кроме того ни mRNAs были обнаружены на четках без ASOs, указав соответствующие блокировки процедур, которые избежать неспецифических привязки. На этой линии несвязанные/яичница ASOs может также использоваться как элемент управления, хотя потенциал для крест гибридизации с определенным мРНК и выводимые захват связанных белков затем приниматься во внимание. Так как белки в заключительном элюата может едва ли визуализацию на серебро окрашенных полиакриламидных гелей (данные не показаны), наличие ранее известных мРНК взаимодействия белков Далее оценивали immunoblot анализа. Это включает в себя Pfk2p от S. cerevisiae, которые избирательно связывается с PFK2 мРНК рибосомы независимым образом12; C. elegans GLD-1, каноническое ОДП, которая связывает 3' УТР последовательности ВИС - 1 мРНК для трансляционного правила43; и ГУР, ОДП, которая регулирует стабильность мРНК и перевод p27/CDKN1B мРНК44. Как и ожидалось, все из этих белков были определены в поездку элюаты соответствующих mRNAs западной помарке анализа (рис. 3B).

Figure 1
Рисунок 1. Схематическое представление поездки. Белки являются высокоструктурированные РНК в естественных условиях , УФ облучение. На первом шаге (светло зеленый флажок) poly(A) РНК белковых комплексов восстанавливаются с бисером25 oligo(dT), применяя жесткие Стиральная условия для удаления unbound протеины. На втором этапе (розовый ящик) целевой mRNP это потянул вне с биотинилированным антисмысловых олигонуклеотидов РНК и стрептавидина бусины. Очищенный mRNPs затем анализируются RT-PCR и immunoblot/масс спектрометрия (МС) для определения РНК и белков, взаимодействующих с mRNA интереса, соответственно. Рисунок был изменен с предыдущей публикации37 с разрешения. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2. Изоляция отдельных mRNAs от общего РНК не сшитый клеток/организмов с помощью изменения antisense РНК захвата зонды. (А) влияние концентраций соли на эффективности улавливания дрожжей PFK2 мРНК с ASOs. Всего РНК от дрожжевых клеток в сочетании с указанных ASOs и промывают буфер, содержащий указанный концентрация соли (NaCl) при температуре 55 ° C. Зеленый, синий и оранжевый линии представляют PFK2 мРНК восстановления с различными ASOs как определяется ПЦР-37: PFK2-1 и PFK2 -2 отжиг в 3' УТР, PFK2-4 компакт-дисков. PFK1 это отрицательный контроль мРНК. ПЦР была выполнена с 32 усиления циклов и количественно как описано37. (B) часть C. eleganscep-1 и дрожжи RPS20 Асо неизбежно мРНК при температурах различных мыть, представлены в черной и красной линиями, соответственно. C. eleganspgk-1 и дрожжи 1 акт являются mRNAs непромысловых (контроль). 30 и 32 циклов PCR были применены для обнаружения дрожжей и C. elegans мРНК, соответственно. Схематическое представление гибридизации DNM1 Асо (красный) с последовательностями мРНК DNM1 , а также потенциальных крест гибридизации с 1 акт мРНК (C) отображается слева. Гель агарозы, показаны товары из ПЦР-реакции (30 циклов) для обнаружения дрожжей DNM1 и 1 акт мРНК этого eluted из бисера показано справа. Вход, всего РНК; SN, надосадке после инкубации с ASOs; E, элюаты из бисера, промывают в указано предварительного Элюирование температур (40 ° C, 50 ° C и 60 ° C). Управления эксперимент (Ctrl) была выполнена параллельно без добавления Асо. (D) агарозы гель, показывая продукты-ПЦР для выявления mRNAs (справа) захватил от всего РНК дрожжей S. cerevisiae, C. elegansи HEK293 клетки человека (H. sapiens). Вход, всего РНК; SN, супернатанта; E, элюаты из бисера. ПЦР была исполнена 30 циклов усилители для дрожжей мРНК, 32 циклы для C. elegans мРНК, а 28 и 30 циклов для человека тубулин и p27 мРНК, соответственно. Рисунок был изменен с предыдущей публикации37 с разрешения. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3. Захват конкретные мРНК белковых комплексов из экстрактов производным от УФ высокоструктурированные клеток с поездкой. Гели агарозы (A) для обнаружения mRNAs (справа) с RT-PCR после захвата с oligo(dT) и указано ASOs от S. cerevisiae, C. elegans и выдержек клетки человека (H. sapiens). Вход, всего РНК из сшитого клеток/организмов; CTRL, управления без опа. Poly(A), конкуренция с poly(A). RT-PCR была выполнена как описано37 с 35 циклов амплификации Люк, 32 циклов для p27, и 29 циклов для тубулина. (B) анализ Immunoblot мРНК прыгните белков с указанных антител (справа). Загружен фракции являются следующие: 0.1%, 2,5% и 1% для дрожжей, нематод и людских ресурсов; 10%, 10% и 5% для дрожжей, нематод и человека oligo(dT) полос; и 66% для всех полос ASOs. Молекулярный вес (МВт), указаны в кДа (кДа). Рисунок, опубликована с разрешения37. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Грунтовка имя Последовательность Цель Размер
Pfk2_Fwd GTGTTAAGGGTTCACATGTCG PFK2 S. cerevisiae 133 bp
Pfk2_Rev CTTCCAACCAAATGGTCAGC PFK2 S. cerevisiae 133 bp
Pfk1_Fwd GGTGATTCTCCAGGTATGAATG PFK1 S. cerevisiae 97 ВР
Pfk1_Rev CTTCGTAACCTTCGTAAACAGC PFK1 S. cerevisiae 97 ВР
Act1_Fwd GTCTGGATTGGTGGTTCTATC 1 акт S. cerevisiae 85 bp
Act1_Rev GGACCACTTTCGTCGTATTC 1 акт S. cerevisiae 85 bp
Dnm1_Fwd CTGTGTTCGATGCATCAGAC DNM1 S. cerevisiae 156 bp
Dnm1_Rev CGCACTCCAATTCTTCTCTC DNM1 S. cerevisiae 156 bp
Rps20_Fwd CGCTGAACAACACAACTTGG RPS20 S. cerevisiae 228 bp
Rps20_Rev GGAAGCAACAACAACTTCGAC RPS20 S. cerevisiae 228 bp
Cep1_Fwd CGATGAAGAGAAGTCGCTGT ВИС-1 C. elegans 110 bp
Cep1_Rev ATCTGGGAACTTTTGCTTCG ВИС-1 C. elegans 110 bp
Pgk1_Fwd GCGATATTTATGTCAATGATGCTTTC ПГК-1 C. elegans 74 bp
Pgk1_Rev TGAGTGCTCGACTCCAACCA ПГК-1 C. elegans 74 bp
Mpk1_Fwd TGCTCAGTAATCGGCCATTG МПК-1 C. elegans 74 bp
Mpk1_Rev TCCAACAACTGCCAAAATCAAA МПК-1 C. elegans 74 bp
p27_Fwd TTTAAAAATACATATCGCTGACTTCATGG P27 H. sapiens 212 bp
p27_Rev CAAAGTTTATGTGCTACATAAAAGGTAAAAA P27 H. sapiens 212 bp
Luc_Fwd AATGGCTCATATCGCTCCTGGAT Люцифераза P. pγralis 117 bp
Luc_Rev TGGACGATGGCCTTGATCTTGTCT Люцифераза P. pγralis 117 bp
Β-TUBULIN_Fwd CTGAACCACCTTGTCTCAGC Β-ТУБУЛИНА H. sapiens 136 bp
Β-TUBULIN_Rev AGCCAGGCATAAAGAAATGG Β-ТУБУЛИНА H. sapiens 136 bp
PFK2-1 Асо AAUAGAAAGUGUAAUAAAAGGUCAU 3' УТР PFK2 S. cerevisiae -
PFK2-2 Асо GUUUCAUGGGGUAGUACUUGU 3' УТР PFK2 S. cerevisiae -
PFK2-4 Асо CUUGAAGAGGAGCGUUCAUA ORF PFK2 S. cerevisiae -
DNM1 АСО UCGGUCAGUGGAGGUUCAGCGUUU ORF DNM1 S. cerevisiae -
RPS20 АСО GUCGGUAAUAGCCUUCUCAUUCUUG ORF RPS20 S. cerevisiae -
ВИС-1 АСО GUGAGAAAUGCGGUGCUUUGAAA 3' УТР C. elegans ВИС-1 -
p27 АСО UCAUACCCCGCUCCACGUCAGUU 3' УТР p27 H. sapiens -

Таблицы 1. Последовательности олигонуклеотида. Список праймеры PCR и ASOs, используемые в этой работе, последовательность праймера, целевых генов и размер ожидаемых фрагментов после усиления.

Discussion

Путешествие позволяет анализ белков, привязан к конкретные мРНК в vivo с биохимическими средствами. Хотя мы использовали этот метод для проверки взаимодействия конкретной ОДП с мРНК-мишеней, из разных организмов/клетки, поездки также может быть применимым для изучения других видов poly(A) РНК, например цитоплазматических длинные ncRNAs. Кроме того систематический анализ связанных белков и/или РНК с MS или РНК последовательности может быть достигнуто путем масштабирования вверх процедуры. В этой связи наши предварительные данные показывает, что 1 Л дрожжевых культур и по меньшей мере 100 миллионов клеток человека HEK293 может обеспечить достаточную исходным материалом для получения надежных данных MS для хорошо выраженной mRNAs (неопубликованные результаты).

Описано путешествие протокол включает облучения клеток с УФ света в 254 Нм до crosslink РНК белковых взаимодействий. Это позволяет осуществление строгих мыть условий во время очистки. Тем не менее хотя явно не проверял, мы хотим отметить что сшивки является необязательным и активного RNPs также могут быть взысканы с физиологической буферов. Однако в этом случае, потенциал переоборудование белков и РНК на целевом РНК в лизатов должны приниматься во внимание. И наоборот если УФ или других процедур сшивки прикладной (например, формальдегид), целостность РНК должно оцениваться как РНК деградация может привести к снижению восстановления mRNPs. Кроме того УФ сшивки является довольно неэффективной (~ 5%), и даже меньше, так для белков, взаимодействующих с двуцепочечной РНК, которая могла бы ввести смещения для обнаружения определенных классов ОДП12. Наконец УФ-облучение также может вызвать протеин протеина и протеин дна сшивки, которые должны быть рассмотрены для интерпретации данных45,46. Таким образом процедуры альтернативной сшивки, например с формальдегидом, также может быть особый интерес захватить больше белка сборок на мРНК.

Одной из ключевых особенностей поездки является двухэтапную процедуру очищения, на основе Асо восстановить особое РНК, тем самым увеличивая избирательности и уменьшается вероятность совместного очистки загрязняющих веществ. Например одна озабоченность касается добавления биотинилированным ASOs непосредственно в клеточных экстрактов, которые могут привести к совместно очистки биотин связывающих белков. Это обойти в ПОЕЗДКЕ путем реализации первый раунд очистки poly(A) РНК с помощью ковалентно спаренных oligo-(dT)25 магнитные бусы, который позволяет для очистки жестких условий, как это сделано для захвата interactome РНК белок. Кроме того выбор РНК poly(A) удаляет очень обильные ncRNAs, таких как рибосомная РНК и tRNAs и таким образом уменьшает сложность образца и потенциальных источников загрязнения и крест гибридизации. На втором этапе особенно mRNAs восстанавливаются с биотинилированным и изменение ASOs, которые отжига с регионами на мРНК-мишеней. Кроме того изменение ASOs может быть непосредственно ковалентно придает также магнитные шарики через Амин компоновщик, уменьшение склонности к захватить биотина связывания белков. Однако наш опыт показывает, инкубационный poly(A) РНК дробью ASOs перед добавлением бисера стрептавидина восстановлены mRNPs более эффективно, чем прямое добавление Асо сочетании бисера. Возможно свободный oligos кинетически благоприятствования лучший доступ к последовательности в структурированных РНК по сравнению с иммобилизованными oligos. Следовательно ковалентного соединения ASOs бисером до инкубации с образцом может быть пагубным для восстановления целевого РНК и должен быть проверены эмпирически.

Один недостаток с методами на основе Асо является неэффективным восстановление некоторых целевых мРНК. Поэтому мы рекомендуем оценки нескольких ASOs, которые отжига различных регионов стенограммы. В частности мы предлагаем дизайн ASOs 2-3, которые отжига с последовательностями в 3'-UTR или компакт-диски mRNA интереса. Каждый Асо могут демонстрировать различные эффективности для восстановления соответствующих целевых мРНК и должно быть эпирически испытания (Рисунок 2а, Б, данные не показаны). В конце мы обнаружили, что ASOs отжига для необычных 3' выполняются лучше по сравнению с теми, отжиг на компакт-диски. Это может быть из-за увеличения доступности привязки сайтов в необычных из-за отсутствия перевода рибосомы, тогда как рибосомы может препятствовать эффективной гибридизации в компакт-дисков. Мы также пережили, что сочетание нескольких ASOs может привести к увеличению загрязнения от обильные непромысловых мРНК и снизить эффективность тянуть вниз. В любом случае, избирательность выбранной oligos могут контролироваться конкурс экспериментов (например., добавлением конкурирующих oligos).

Еще озабоченность касается потенциальных крест гибридизации с несвязанными РНК, как мы наблюдали, что даже частичное гибридизации с другими мРНК может привести к восстановления этого мРНК (рис. 2 c). Для оценки пригодности разработанных ASOs, поэтому рекомендуется выполнять первоначальные в vitro тестирования с общей РНК для оптимизации соли концентрации и температуры стирки буферов. В наших руках Стиральная стрептавидина в сочетании магнитных шариков в буферы, содержащие 150 мм NaCl при 55 ° C выполняется лучше, но мы рекомендуем независимые тесты условий для каждого разработан Асо. Примечательно, мы обнаружили, что все ASOs, отобранных из экспериментов в пробирке (Рисунок 2D) были соотвествующими для захвата соответствующей целевой мРНК из сшитого клеточных экстрактов (рис. 3), далее подтверждающей действительность в in vitro тестирования. Помимо разработки подходящих ASOs для захвата мРНК, дополнительные факторы могут повлиять на избирательности. Таким образом всеобъемлющий блокировки процедуры с BSA и/или tRNA согласно спецификации типа шарик может предотвратить неспецифических привязки к бисеру. Чтобы дополнительно уменьшить поглощение неспецифических белков, также рекомендуется использовать Lo свяжите трубок, особенно при работе с низким количеством образцов.

Как правило путешествие может дополнять ранее разработанных подходов для захвата РНК с ASOs. Например, РНК-кодирования Xist был изолирован с привязанного белки от ядерных экстракты, полученные из 200-800 миллионов УФ высокоструктурированные клеток с помощью массива долго олигонуклеотиды ДНК (90-mer) биотинилированным, которые охватывают весь Стенограмма 34,35. Однако, выбранной плитки подход может стать проблематичным с учетом большой потенциал для крест гибридизации с несвязанными РНК, и он не может использоваться для выбора конкретных стенограмма, например., альтернативно сращивания формы. Недавно, специально заблокирован нуклеиновой кислоты (LNA) или mixmers ДНК Асо ковалентно были прикреплены к магнитной смолы для восстановления в vitro транскрипт или сильно выраженным рибосомной РНК из экстрактов клетки бесплатно; Однако он не был протестирован для восстановления в vivo сформировали мРНК белковых комплексов36. Учитывая растущее признание post-transcriptional гена контроля за ОДП и ncRNA мы считаем, что поездка является полезным методом для изучения состава и динамики RNP комплексов в ячейках на внутриклеточную и экологические сигналы и его влияние в здоровье и болезни.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Мы благодарны д-р Джонатан холл и Мауро Циммерман (ETH Zurich) для синтеза PFK2 и ВИС-1 ASOs, доктор Maikel Ваутерс для проектирования p27/CDKN1B ASOs и доктор Рафал Ciosk (Фридрихом Мишером институт биомедицинских исследований, Базель) для антител анти GLD-1. Эта работа была поддержана биотехнологии и биологических наук научно-исследовательский совет (BB/K009303/1) и Королевского общества Вольфсон исследований заслуги (WM170036) для A.P.G.

Materials

Name Company Catalog Number Comments
MaxQ 5000 Large Incubated and Refrigerated Orbital Shaker Thermo Fisher Scientific SHKE5000-8CE Floor shaker to grow yeast cells
BBD 6220 Thermo Fisher Scientific CO2 incubator to grow human cells
Sonicator Soniprep150 MSE MSS150.CX4.5 Sonicator/cell disruptor. Used to shear DNA in human cell lysates
Stratalinker 1800 Stratagene Stratalinker to expose cells to UV light at 254 nm
Tissue Lyser Qiagen RETSCH MM200 Device to mechanically disrupt yeast cells
Refrigerated Centrifuge Eppendorf 5810R Centrifuge to spin down cells, lysates
Shaking incubator, Thriller Peqlab Thermoshaker for 1.5 mL tubes
Glass beads 0.5mm Stratech Scientific Limited 11079105 Lysis of yeast cells
Nylon Filter, 0.41 μm Millipore NY4104700 Collection of yeast cells
Millex-HA Filter, 0.45 µm EMD Millipore SLHA02510 Filter to clear nematode lysate
Eppendorf LoBind microcentrifuge tubes Protein 1.5 mL Sigma-Aldrich 22431081 Minimise protein loss
2 mL microfuge tube Ambion AM12425 Yeast extract preparation and other applications
5 mL tube Thermo Fisher Scientific 129A Collection of HEK293 cell lysate
15 mL tube Sarstedt 62.547.254 Collection C. elegans
50 mL plastic tube Sarstedt 62.554.502 Collection yeast cells
DMEM, high glucose, pyruvate Thermo Fisher Scientific 41966 Media for culturing HEK293 cells
Penicillin-Streptomycin Sigma-Aldrich P4333 Used to supplement cell culture media to control bacterial contamination
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 Used to supplement cell culture media
Lipofectamine 2000 Thermo Fisher Scientific 11668027 Transfection reagent
RQ1 RNase-Free DNase Promega M6101 DNAse I to degrade DNA from cell lysate
RNasin Plus RNase Inhibitor Promega N2611 RNase inhibitor to avoid RNA degradation
cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail Roche 11836170001 Protease inhibitor cocktail to avoid protein degradation
Dynabeads Oligo (dT)25 Thermo Fisher Scientific 61011 Magnetic beads required for the first step of mRNA-protein complex purification
Dynabeads M-280 Streptavidin Thermo Fisher Scientific 11205D Magnetic beads required for the second step of mRNA-protein complex purification
E. coli tRNA Sigma-Aldrich 10109550001 transfer RNA from E. coli used for blocking streptavidin beads and avoid unsepecific interactions
Quick Start Bradford 1x Dye Reagent BioRad 5000205 To determine protein concentration within lysates, using BSA as reference
Bovine Serum Albumin Sigma A7906-100G Used to perform the standard curve that will be used as reference for protein concentration determination
mouse anti-Act1 MP Biomedicals 869100 Antibody for detection of yeast actin in Western blot (1:2,500)
mouse anti-Act1 Sigma A1978 Antibody for detection of human actin in Western blot (1:2,000)
mouse anti-HuR Santa Cruz sc-5261 Antibody for detection of HuR in Western blot (1:500)
mouse anti–CYC-1 Invitrogen 456100 Antibody for detection of Cyc-1 in Western blot (1:1,000)
peroxidase anti-peroxidase soluble complex Sigma P1291 Detection of Pfk2:TAP in Western blot (1:5,000)
HRP-conjugated sheep anti-mouse IgG Amersham NXA931 HRP-coupled secondary antibody

DOWNLOAD MATERIALS LIST

References

  1. Mitchell, S. F., Parker, R. Principles and properties of eukaryotic mRNPs. Molecular Cell. 54, (4), 547-558 (2014).
  2. Iadevaia, V., Gerber, A. P. Combinatorial Control of mRNA Fates by RNA-Binding Proteins and Non-Coding RNAs. Biomolecules. 5, (4), 2207-2222 (2015).
  3. McHugh, C. A., Russell, P., Guttman, M. Methods for comprehensive experimental identification of RNA-protein interactions. Genome Biology. 15, (1), 203 (2014).
  4. Matia-González, A. M., Gerber, A. P. Ch. 14. Fungal RNA Biology. Sesma, A., von der Haar, T. Springer. 347-370 (2014).
  5. Tsvetanova, N. G., Klass, D. M., Salzman, J., Brown, P. O. Proteome-wide search reveals unexpected RNA-binding proteins in Saccharomyces cerevisiae. PLoS One. 5, (9), (2010).
  6. Castello, A., et al. Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell. 149, (6), 1393-1406 (2012).
  7. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Molecular Cell. 46, (5), 674-690 (2012).
  8. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nature Protocols. 8, (3), 491-500 (2013).
  9. Liao, Y., et al. The Cardiomyocyte RNA-Binding Proteome: Links to Intermediary Metabolism and Heart Disease. Cell Reports. 16, (5), 1456-1469 (2016).
  10. Liepelt, A., et al. Identification of RNA-binding Proteins in Macrophages by Interactome Capture. Molecular Cell Proteomics. 15, (8), 2699-2714 (2016).
  11. Conrad, T., et al. Serial interactome capture of the human cell nucleus. Nature Communications. 7, 11212 (2016).
  12. Matia-Gonzalez, A. M., Laing, E. E., Gerber, A. P. Conserved mRNA-binding proteomes in eukaryotic organisms. Nature Structural and Molecular Biology. 22, (12), 1027-1033 (2015).
  13. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nature Structural and Molecular Biology. 20, (1), 127-133 (2013).
  14. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nature Communications. 6, 10127 (2015).
  15. Wessels, H. H., et al. The mRNA-bound proteome of the early fly embryo. Genome Research. 26, (7), 1000-1009 (2016).
  16. Sysoev, V. O., et al. Global changes of the RNA-bound proteome during the maternal-to-zygotic transition in Drosophila. Nature Communications. 7, 12128 (2016).
  17. Despic, V., et al. Dynamic RNA-protein interactions underlie the zebrafish maternal-to-zygotic transition. Genome Research. 27, (7), 1184-1194 (2017).
  18. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, 42 (2016).
  19. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  20. Koster, T., Marondedze, C., Meyer, K., Staiger, D. RNA-Binding Proteins Revisited - The Emerging Arabidopsis mRNA Interactome. Trends Plant Sciences. 22, (6), 512-526 (2017).
  21. Hamasaki, K., Killian, J., Cho, J., Rando, R. R. Minimal RNA constructs that specifically bind aminoglycoside antibiotics with high affinities. Biochemistry. 37, (2), 656-663 (1998).
  22. Bachler, M., Schroeder, R., von Ahsen, U. StreptoTag: a novel method for the isolation of RNA-binding proteins. RNA. 5, (11), 1509-1516 (1999).
  23. Vazquez-Pianzola, P., Urlaub, H., Rivera-Pomar, R. Proteomic analysis of reaper 5' untranslated region-interacting factors isolated by tobramycin affinity-selection reveals a role for La antigen in reaper mRNA translation. Proteomics. 5, (6), 1645-1655 (2005).
  24. Hartmuth, K., Vornlocher, H. P., Luhrmann, R. Tobramycin affinity tag purification of spliceosomes. Methods Molecular Biology. 257, 47-64 (2004).
  25. Beach, D. L., Keene, J. D. Ribotrap : targeted purification of RNA-specific RNPs from cell lysates through immunoaffinity precipitation to identify regulatory proteins and RNAs. Methods Molecular Biology. 419, 69-91 (2008).
  26. Slobodin, B., Gerst, J. E. A novel mRNA affinity purification technique for the identification of interacting proteins and transcripts in ribonucleoprotein complexes. RNA. 16, (11), 2277-2290 (2010).
  27. Slobodin, B., Gerst, J. E. RaPID: an aptamer-based mRNA affinity purification technique for the identification of RNA and protein factors present in ribonucleoprotein complexes. Methods Molecular Biology. 714, 387-406 (2011).
  28. Yoon, J. H., Gorospe, M. Identification of mRNA-Interacting Factors by MS2-TRAP (MS2-Tagged RNA Affinity Purification). Methods Molecular Biology. 1421, 15-22 (2016).
  29. Leppek, K., Stoecklin, G. An optimized streptavidin-binding RNA aptamer for purification of ribonucleoprotein complexes identifies novel ARE-binding proteins. Nucleic Acids Research. 42, (2), 13 (2014).
  30. Blencowe, B. J., Sproat, B. S., Ryder, U., Barabino, S., Lamond, A. I. Antisense probing of the human U4/U6 snRNP with biotinylated 2'-OMe RNA oligonucleotides. Cell. 59, (3), 531-539 (1989).
  31. Lingner, J., Cech, T. R. Purification of telomerase from Euplotes aediculatus: requirement of a primer 3' overhang. Proceedings of the National Academy of Sciences U S A. 93, (20), 10712-10717 (1996).
  32. Upadhyay, A., Dixit, U., Manvar, D., Chaturvedi, N., Pandey, V. N. Affinity capture and identification of host cell factors associated with hepatitis C virus (+) strand subgenomic RNA. Molecular Cell Proteomics. 12, (6), 1539-1552 (2013).
  33. Imig, J., et al. miR-CLIP capture of a miRNA targetome uncovers a lincRNA H19-miR-106a interaction. Nature Chemical Biology. 11, (2), 107-114 (2015).
  34. Chu, C., et al. Systematic discovery of Xist RNA binding proteins. Cell. 161, (2), 404-416 (2015).
  35. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  36. Rogell, B., et al. Specific RNP capture with antisense LNA/DNA mixmers. RNA. 23, (8), 1290-1302 (2017).
  37. Matia-Gonzalez, A. M., Iadevaia, V., Gerber, A. P. A versatile tandem RNA isolation procedure to capture in vivo formed mRNA-protein complexes. Methods. 93-100 (2017).
  38. Gruber, A. R., Lorenz, R., Bernhart, S. H., Neubock, R., Hofacker, I. L. The Vienna RNA websuite. Nucleic Acids Research. 36, (Web Server issue), Available from: http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi W70-W74 (2008).
  39. Kalendar, R., Khassenov, B., Ramankulov, Y., Samuilova, O., Ivanov, K. I. FastPCR: An in silico tool for fast primer and probe design and advanced sequence analysis. Genomics. 109, (3-4), Available from: http://primerdigital.com/tools/PrimerAnalyser.html 312-319 (2017).
  40. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  41. Stiernagle, T. Maintenance of C. elegans. WormBook. 1-11 (2006).
  42. Kedde, M., et al. A Pumilio-induced RNA structure switch in p27-3' UTR controls miR-221 and miR-222 accessibility. Nature Cell Biology. 12, (10), 1014-1020 (2010).
  43. Schumacher, B., et al. Translational repression of C. elegans p53 by GLD-1 regulates DNA damage-induced apoptosis. Cell. 120, (3), 357-368 (2005).
  44. Ziegeler, G., et al. Embryonic lethal abnormal vision-like HuR-dependent mRNA stability regulates post-transcriptional expression of cyclin-dependent kinase inhibitor p27Kip1. Journal of Biological Chemistry. 285, (20), 15408-15419 (2010).
  45. Itri, F., et al. Femtosecond UV-laser pulses to unveil protein-protein interactions in living cells. Cellular and Molecular Life Sciences. 73, (3), 637-648 (2016).
  46. Zhang, L., Zhang, K., Prandl, R., Schoffl, F. Detecting DNA-binding of proteins in vivo by UV-crosslinking and immunoprecipitation. Biochemical and Biophysical Research Communications. 322, (3), 705-711 (2004).
Процедура изоляции на основе олигонуклеотида тандем РНК для восстановления эукариотические мРНК белковых комплексов
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Iadevaia, V., Matia-González, A. M., Gerber, A. P. An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes. J. Vis. Exp. (138), e58223, doi:10.3791/58223 (2018).More

Iadevaia, V., Matia-González, A. M., Gerber, A. P. An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes. J. Vis. Exp. (138), e58223, doi:10.3791/58223 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter