Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Arbovirus infektioner som Screening-værktøjer for identifikation af Viral hæmmende og vært Antiviral faktorer

doi: 10.3791/58244 Published: September 13, 2018

Summary

Vi præsenterer her, protokoller for at identificere 1) virus-kodet hæmmende, der fremmer arbovirus replikering og 2) eukaryote vært faktorer, der begrænser arbovirus replikation. Disse fluorescens - og luminescens-baserede metoder giver forskere hurtigt få kvantitative udlæsninger af arbovirus replikering i forsimplede assays med lavt signal-støj-forhold.

Abstract

RNA interferens- og genom redigering-baseret screening platforme har været meget anvendt til at identificere vært celle faktorer, der begrænser virus replikering. Disse skærme foregår typisk i celler, der er naturligt eftergivende til viral patogenet under undersøgelsen. Derfor, den robuste replikering af virus i kontrol betingelser kan begrænse det dynamiske område af disse skærme. Desuden kan disse skærme kunne nemt identificere cellulære forsvar veje, der begrænser virus replikering, hvis virus er veltilpasset til værten og i stand til at imødegå antiviral forsvar. I denne artikel vil beskrive vi et nyt paradigme for at udforske virus-værtssammenspil ved hjælp af skærme, at centrum på naturligt mislykkede infektioner af arboviruses såsom vesikulær stomatitis-virus (VSV). Trods VSV evne til at formere sig i en bred vifte af tovingede insekter og pattedyr værter gennemgår VSV en post post, mislykkede infektion i en række cellelinier stammer fra Lepidoptera insekter, som sigøjner møl (Lymantria dispar). Men disse forfejlede VSV infektioner kan blive "reddet" når værten celle antiviral forsvar er kompromitteret. Vi beskriver, hvordan VSV stammer kodning praktisk reporter gener og restriktive L. dispar cellelinjer kan parres set-up skærme til at identificere vært faktorer involveret i arbovirus begrænsning. Derudover viser vi også nytte af disse værktøjer, screening i identifikation af viralt kodede faktorer, der redde VSV replikering under coinfection eller gennem Ektopisk udtryk, herunder kodet af pattedyr vira. Den naturlige begrænsning af VSV replikering i L. dispar celler giver et højt signal / støj-forhold ved screening for de betingelser, der fremmer VSV redning, således at brugen af forenklede luminescence - og fluorescens-baseret assays til at overvåge ændringer i VSV replikering. Disse metoder er værdifulde for at forstå samspillet mellem vært antiviral svar og viral immun unddragelse faktorer.

Introduction

Mulighed for en virus at produktivt replikere i en bestemt host er delvis omfattet af tilgængeligheden af vært celle faktorer, der understøtter viral entry og replikering1. Virus-værtsspektrum kan også være dikteret af kapacitet af en virus til counter cellulære antiviral forsvar, der ville ellers hæmmer viral replikation2,3. Det er resultatet af disse komplekse virus-værtssammenspil, der i sidste ende beslutte om en virus vil være i stand til at fuldføre sin livscyklus i en bestemt host. Givet de potentielt patogene konsekvenser for værten, hvis virusreplikation ensues, er det afgørende at udvikle eksperimenterende strategier til at fremme vores forståelse af de centrale virus-værtssammenspil, der kan tip balancen mellem forfejlede og produktive infektioner. Belyse de molekylære funktioner for virus-værts samspil vil være medvirkende til udviklingen af nye og alternative antiviral terapeutiske strategier.

Med fremkomsten af RNA interferens (RNAi)4,5 og genom-redigering værktøj (fx., CRISPR-Cas9, zink finger nukleaser, TALENs)6,7, det er blevet eksperimentelt muligt at ændre den udtryk for cellulære faktorer på genome-wide skalaer og udforske virkningerne af disse ændringer på virus replikering. Faktisk, mange RNAi og genom-redigering-baserede skærme er blevet ført i hvirvelløse og hvirveldyr vært celletyper, der har afsløret nye facetter af virus-vært interaktioner8,9,10, 11 , 12. disse skærme anvender typisk virus kodning reportere, såsom firefly luciferase (LUC) eller fluorescerende proteiner (fx., normal god landbrugspraksis, DsRed), der giver bekvem måde kvantitativt vurdere viral genekspression som en udlæsning for viral replikation9,12. Denne strategi gør det muligt for forskerne at identificere vært faktorer, som enten fremme eller irritere viral replikation, som det fremgår af stigninger eller fald, henholdsvis, i viral reporter signaler9,12. Men i langt de fleste tilfælde, disse skærme er blevet gennemført ved hjælp af vira, der er tilpasset den vært celletype, hvor de er ved at blive undersøgt. Denne strategi kan være vigtigt for at forstå coevolutionary relationer mellem virale patogener og deres naturlige værter, udgør det grundlæggende bekymringer med hensyn til deres anvendelse i afsløring vært antiviral faktorer. I disse tilfælde, en forbedring i virus reporter signal på RNAi knockdown betragtes for eller inaktivering af et cellulære faktor, der normalt hindrer viral replikation. Først, hvis en virus er allerede håndfast replicere i cellen vært undersøges under kontrol betingelser, det dynamiske område af skærmen (dvs, evne til at skelne mellem baggrund og øget viral reporter signaler) kan være begrænset. For det andet, dette spørgsmål er yderligere forværret af de situationer, hvor virus er veltilpasset til cellen vært og effektiv til bekæmpelse vært forsvar veje, der er at være målrettet i skærmen.

På grund af de ovennævnte betænkeligheder vedrørende traditionelle virus-vært interaktion screening-metoder, udviklet vi et nyt paradigme for at studere virus-værtssammenspil, der udnytter naturligt mislykkede arbovirus infektioner i Lepidoptera insekt celler. Denne strategi stammer fra en observation, at den velundersøgte menneskelige arbovirus, VSV, gennemgår en mislykkede infektion i celler, der stammer fra sigøjner møl (L. dispar)13. VSV er naturligvis overføres af tovingede insekter (dvs, sand fluer) til pattedyr værter, og har været vist eksperimentelt at inficere en bred vifte af hvirvelløse og hvirveldyr værter i celle kultur og i vivo14. 11-kb negative-følelse enkeltstrenget RNA genom af VSV koder fem subgenomic mRNAs, der hver oversat til de proteiner, der udgør den indhyllede virion. VSV omvendt genetiske systemer har tilladt for oprettelsen af replikationskompetente stammer kodning LUC eller fluorescerende proteiner, ud over de fem naturlige VSV gen produkter15,16,17. Fordi disse reporter proteiner ikke indgår i VSV virion, giver de en bekvem udlæsning til VSV genekspression, der opstår efter indrejse. Ved hjælp af VSV stammer kodning normal god landbrugspraksis eller LUC, har vi tidligere vist at VSV genekspression er alvorligt begrænset træder i LD652 celler og at VSV titers ikke øger af 72 timer efter infektionen (hpi). Derimod fører coinfection LD652 celler med VSV og pattedyr poxvirus, vaccinia virus (VACV), til logaritmisk stigninger i både VSV genekspression og titers fra dette tidspunkt. VACV gennemgår tidlige genekspression, DNA-replikation og sen Gen-ekspression i LD652 celler infektioner, men VACV replikering cyklus er i sidste ende forfejlede på grund af ufuldstændige virion morfogenese18. Den store ~ 192 kb DNA genom af VACV koder > 200 proteiner, hvoraf mange vise immunmodulerende egenskaber, der fremmer virusreplikation gennem undertrykkelse af vært immunrespons19. Derfor, vi hypotese at "redning" af VSV replikation i LD652 celler ved VACV coinfection var sandsynligvis medieret af VACV hæmmende, der hæmmede L. dispar svar normalt begrænser VSV replikering. Til støtte for dette redder behandling af LD652 celler med værten RNA polymerase II hæmmer actinomycin D også VSV replikation i LD652 celler, der angiver, at transskription-afhængige vært svar blokere VSV replikering efter posten13.

De ovenstående bemærkninger foreslår, at den naturligvis restriktive karakter af LD652 celler til VSV infektion kan give en relativt lav baggrunden når screening for de betingelser, der forbedrer VSV-kodet reporter signaler (dvs., dem der hæmmer vært antiviral forsvar). Her, leverer vi metoder til brug af fluorescens eller LUC-baserede assays til skærmen for forhold, der lindre VSV begrænsning i Lepidoptera celler. Først, viser vi, hvordan disse assays kan bruges til at identificere viralt kodede immunmodulerende faktorer, der bryder VSV begrænsning under enten coinfection eksperimenter eller gennem Ektopisk udtryk for kandidat viral faktorer. Som et eksempel illustrerer vi, hvordan vi brugt disse screening teknikker til at identificere poxvirus-kodet A51R proteiner som en ny familie af immunmodulerende faktorer, der redde VSV replikering i mangel af andre poxvirus faktorer13. For det andet, vi illustrere, hvordan RNAi screening i restriktive VSV-LD652 celle infektioner kan bruges til direkte identificere eukaryote vært faktorer involveret i arbovirus begrænsning13.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. generel Lymantria dispar (LD652) celle og Virus kultur

  1. LD652 celle dyrkning og plating
    1. Kultur L. dispar-afledte LD652 celler, opretholde en éncellelag af celler i en vækstmediet (Table of Materials) inkuberes ved 27 ° C under normal atmosfære. Opretholde cellerne i 10 cm væv-kultur-behandlede retter og passage celler ved at nå 80% confluency.
    2. Plade, løsne vedhængende LD652 celler fra pladen af pipettering medierne gentagne gange på éncellelag (disse celler ikke kræver trypsinization at løsne) og fortyndes prøven i vækst medier til en omtrentlig tæthed af 1 x 105 celler/mL. Der afpipetteres 1 mL fortyndet kultur/brønd af en 24-godt plade. Seed et minimum af tre Repliker brønde/behandling type for hvert tidspunkt (højst otte behandlinger/plade).
    3. Tillad cellerne til at nøjes med et minimum af 1 h.
  2. Vaccinia virus forberedelse
    1. At forberede lagre af VACV, forstærke virus i HeLa celler20 eller afrikansk Green Monkey nyre celler (BSC-1 eller BSC-40 celler)20,21,22.
      Bemærk: VACV stamme Western Reserve (VACV-WR) fungerer godt i assays beskrevet her.
    2. Titreres VACV stamme via plaque assay på BSC-1 eller BSC-40 celler20,22.
      Bemærk: Alle angivet VACV mangfoldighed af infektion (MOI) beskrevet her for LD652 celle infektioner er baseret på titers fremstillet af BSC-40 plaque assays.
  3. Vesikulær stomatitis-virus forberedelse
    1. For at forberede VSV bestande, forstærke virus i BHK celler23.
    2. Titreres VSV af plaque assay på BSC-40 eller BHK celle encellelag13,23.
      Bemærk: Alle VSV MOIs beskrevet her for LD652 celle infektioner er baseret på titers fremstillet af BSC-40 plaque assays.

2. fluorescens-baserede VSV Rescue analyse ved hjælp af co-infektion og Live-celle Imaging

  1. Såning og infektion af LD652 celler
    1. Plade 40.000 LD652 celler/brønd af en 8-godt kammer.
    2. Fluorescens-baseret live-celle imaging, bruge VSV stammer kodning fluorescerende proteiner. Eksperimenterne præsenteret her bruge VSV-DsRed17, en rekombinant VSV stamme, der udtrykker gratis DsRed protein, der ikke er sammenvokset til nogen andre VSV protein.
      Bemærk: VSV infektion af LD652 celler er ikke cytopatisk af 96 hpi, og således, at celledød er ikke en forstyrrende faktor ved vurderingen af VSV replikering inden for denne tidsramme.
    3. Forberede VSV-DsRed og VACV-FL-normal god landbrugspraksis i en serum-gratis medier (SFM; Tabel over materialer) på en MOI 1 og 25, henholdsvis.
      Bemærk: VACV-FL-normal god landbrugspraksis er en rekombinante VACV stamme, der udtrykker en fusion mellem LUC og normal god landbrugspraksis24. Ved hjælp af en MOI 25 eller større for VACV stammer sikrer, at alle LD652 celler er inficerede13. Hvis du bruger en anderledes coinfecting virus, vil MOI skulle fastlægges empirisk af brugeren. Hver infektion behandling skal sættes op i dubletter wells og omfatter mock-inficerede behandlinger, kun SFM er tilføjet til cellerne.
    4. Inkuber celler i 0,2 mL af inokulum i 2 timer ved 27 ° C.
    5. Vaske cellerne med 0,5 mL/godt af væksten medier.
    6. Inkuber celler i 25 μM af celle levedygtighed farvestof (Table of Materials) i vækst medier til 45 min på 27 ° C.
    7. Opsug mediet og vaske wells 1 x med 0,5 mL/godt til at fjerne overskydende farvestof.
    8. Vedligeholde celler i 0,3 mL/godt af vækst-medier.
  2. Live celle billedcapture
    1. Tænd en Konfokal mikroskop 30 min i forvejen og indlæse en 8-godt kammer parabol.
      Bemærk: LD652 celler kan være afbildet på værelse temperaturer fra 20-25 ° C, men for optimale betingelser, temperaturen i lokalet bør justeres til 27 ° C.
    2. Oprette passende excitation/emission indstillingerne for hver fluorescerende markør protein til afbildning, som fase kontrast billedindstillinger.
    3. Justere laser intensiteten for hver kanal.
      Bemærk: Dette kan kræve kører et pilotprojekt for at bestemme området med fluorescerende signal intensiteter observeret under hele tiden skal bruges i den endelige eksperiment.
    4. Ved hjælp af de 10 X mål, capture fase kontrast og fluorescens billeder af hver godt hver 1-5 h for varigheden af infektion op til en ønsket tidspunkt (fx., 48-72 hpi).
      Bemærk: Det er vigtigt at fange flere felter i visningen i hver brønd til at præcist skøn smittespredningen i hele kulturen.
  3. Billedanalyse
    1. Brug billede analyse software til automatisk billedanalyse af passende fluorescerende kanaler (fx., 405 nm, 488 nm, 568 nm).
    2. For at beregne procentdelen af celler, der er inficeret, opdele antallet af fluorescerende celler med angivelse af VSV infektion (fx., DsRed-positive celler for VSV-DsRed infektioner) af det samlede antal levedygtige celler mærket af celle levedygtighed farvestof til hver synsfelt på tværs af alle behandlinger.

3. generelle virusinfektion protokol for Luminescence-baserede VSV Rescue Assays i LD652 celler

  1. Forberedelse af inokulum
    1. 30 min før infektionen, tø lagre af VSV-LUC16 (en rekombinant VSV stamme at udtrykker gratis firefly luciferase protein ikke smeltet til nogen andre VSV protein). Hvis kørsler for VSV-LUC redning under VACV coinfection, også optø VACV-WR virus på is.
      Bemærk: Andre vira (udover VACV-WR) kan redde VSV-LUC under coinfection, men dette vil skulle fastlægges empirisk af hver bruger.
    2. Forberede inokulat ved fortynding VSV-LUC i tilstedeværelse eller fravær af VACV-WR i SFM, således der opnås henholdsvis en MOI 10 og 25, når du tilføjer en total inokulum volumen af 0,2 mL/godt.
  2. Infektion i cellerne
    1. Opsug modne LD652 media omhyggeligt for at undgå at forstyrre éncellelag og podes med 0,2 mL af virus/godt. Denne gang er defineret som 0 hpi. Tilføje sterile SFM yderligere brønde til at tjene som "mock-inficerede" negativ kontrol behandlinger.
    2. Inkuber celler i inokulum i 2 timer ved 27 ° C.
    3. På 2 hpi, fjerne inokulum ved aspiration og erstatte med 1 mL/godt LD652 vækst medier.
    4. Tillad infektion at fortsætte 24-72 hpi.

4. luciferase Assay

  1. Forberedelse af cellelysater
    1. Omhyggeligt Aspirér supernatanten og tilsættes 1 mL af Dulbeccos fosfatbufferet saltopløsning (DPBS) / godt.
    2. Bruge stemplet en 1 mL sprøjte, skrabe cellerne i DPBS.
    3. Overfør celler til et microcentrifuge rør, og der centrifugeres ved 400 x g i 20 min. ved 4 ° C.
    4. I mellemtiden Forbered 1 x fortynding af 5 x reporter lysisbuffer (RLB) i sterilt H2O.
    5. Efter centrifugering, Opsug DPBS uden at forstyrre den celle pellet.
    6. Resuspend hver pellet i 150 µL af 1 x RLB.
    7. Fryse-tø prøver 1 x ved hjælp af en 5-minutters inkubation i et-80 ° C fryser efterfulgt af en hurtig optøning i vandbad stuetemperatur. Gemme lysates på-80 ° C indtil klar til at analysere.
  2. Luciferase assay
    1. Optø lysates på is.
    2. Tilsæt 20 μl af lysate i en brønd med en solid sort eller hvid 96-brønd mikrotiterplade.
    3. Tilsæt 100 μL af luciferase assay reagens til hver brønd.
    4. Straks måle lysstyrken ved hjælp af en luminometrisk (passende indstillinger for specifikke luminometers skal bestemmes empirisk af brugeren).
  3. Luciferase assay analyse
    1. Normalisere LU signaler til hver behandling til LU aflæsninger fra kontrol behandlinger (Repræsentant resultater). Efter mindst tre uafhængige eksperimenter er blevet udført, kan betyde LU fremstillet af hver behandling/kontrol gruppe analyseres af passende statistiske test.

5. immunblot

  1. Bruge lysates udvindes for LUC assays for SDS-PAGE og efterfølgende immunoblotting, ved hjælp af passende reagenser og instrumentation.

6. titer af VSV fra LD652 cellekulturer

  1. Plade LD652 celler efter trin 1.1.
  2. Viral inficere celler efter trin 3.
  3. På ønskede tidspunkter, indsamle analysere i sterile microcentrifuge rør.
  4. Sammenpresse cellerne bruger 1.000 x g i 10 min. ved 4 ° C og overføre analysere nye rør.
  5. Gemme analysere ved-80 ° C eller fortsætte med titrering af plaque assay på BSC-40 celler.
    Bemærk: Hvis tilsætningen VSV fra LD652 cellekulturer, der indeholdt VACV, det er tilrådeligt at tilføje 100 μg/mL cytosin arabinoside (AraC) til BSC-40 kultur medier inden for 2 hpi, at forhindre resterende VACV partikler fra danner plaques på BSC-40 encellelag13. AraC er en viral DNA polymerase-hæmmer, som blokerer VACV DNA replikation25 men påvirker ikke VSV replikering.

7. variationer af Luminescence-baserede VSV redde Assays i LD652 celler: RNAi og Plasmid Transfektion eksperimenter

  1. Udarbejdelse af dsRNA for RNAi-medieret knockdown af viral eller vært udskrifter
    1. Design gen-specifikke primere tailed på 5' enden med T7 promotor sekvens (TAATACGACTCACTATAGGG) at målrette enten den coinfecting virus (f.eks.VACV) eller L. dispar mRNA udskrifter af interesse. Disse primere skal producere en PCR produkt af 400-600 bp for effektiv RNAi-medieret knockdown. Se Gammon et al. 13 for primer sekvenser anvendes under knockdown VACV eller L. dispar afskrifter af dsRNA-medieret RNAi i LD652 celler.
      Bemærk: L. dispar mRNA udskrifter kan identificeres fra offentliggjort L. dispar transkriptom databaser26,27,28.
    2. Generere en DNA-skabelon via RT-PCR (cDNA syntese: 1 cyklus på 50 ° C i 30 min; PCR: 40 cyklusser af 94 ° C til 15 s, 50 ° C til 30 s og 68 ° C til 45 s hver).
    3. Rense PCR produkt ved hjælp af en PCR rensning kit.
    4. Brug af renset PCR produktet som en skabelon, in vitro transskribere og rense dsRNA ved hjælp af en in vitro- transskription og rensning kit.
  2. Transfektion af dsRNA eller plasmid DNA i LD652 celler
    1. Frø 1 x 105 celler/brønd af en 24-godt plade og lad cellerne nøjes med mindst 1 h.
    2. For hver godt til at være transfekteret, fortyndes 4 μL Transfektion reagens i 100 μL af bæredygtig skovforvaltning. Der inkuberes i op til 15 min ved stuetemperatur. Dette kan skaleres til at gøre en master mix for alle transfections skal udføres.
    3. Fortyndes op til 1 μg dsRNA eller samlede plasmid DNA med 100 μL af SFM for hver brønd til at være transfekteret. Der inkuberes i op til 15 min ved stuetemperatur.
      Bemærk: Vi har tidligere fundet en Transfektion af 1 μg af dsRNA/105 LD652 celler er tilstrækkelig for > 80% knockdown enten viral eller vært udskrifter13, men dsRNA doser nødvendigt for modificerede eksperimentelle bliver set pop-ups/betingelser har til bestemmes empirisk.
    4. Kombinere Transfektion reagens og dsRNA/plasmid DNA fortyndinger med forholdet 1:1 (f.eks.100 μl fortyndede dsRNA er blandet med 100 μL fortyndet Transfektion reagens) og Ruger i 20 min. ved stuetemperatur.
    5. I mellemtiden, vaske brønde med 1 mL/godt af SFM, og derefter tilsættes 500 μl SFM til hver brønd.
    6. Langsomt tilføje Transfektion reagens dsRNA (eller plasmid DNA) blanding dråbevis i hver brønd.
    7. Inkuber Transfektion reagens med cellerne for 5 h.
      1. For RNAi eksperimenter, der involverer knockdown af udskrifter kodet af et coinfecting virus (f.eks.VACV), erstatte Transfektion reagens efter 5-h Transfektion inkubationstiden med virus inokulum indeholdende VSV-LUC (med eller uden VACV eller en anden coinfecting virus) (trin 3). Efterfølgende, erstatte den virus inokulum indeholdende VSV-LUC med komplet vækst medier 2 hpi. LUC assays (trin 4) kan derefter udføres på udpakkede lysates på forskellige tidspunkter til at bestemme, hvis knockdown af coinfecting virus udskrifter fører til et tab af VSV-LUC redning.
      2. For RNAi eksperimenter, der involverer RNAi af L. dispar udskrifter, erstatte Transfektion mix med komplet vækst medier og tillade knockdown at opstå i 24 timer forud for infektion med VSV-LUC (trin 4). LUC assays (trin 4) kan derefter udføres på udpakkede lysates på forskellige tidspunkter til at bestemme, hvis knockdown af L. dispar udskrifter fremmer VSV-LUC redning.
      3. For eksperimenter, der involverer transfections plasmid udtryk vektorer udtrykker kandidat hæmmende, erstatte Transfektion reagens og mulighed for protein udtryk i 24 timer forud for infektion med VSV-LUC (trin 4). LUC assays (trin 4) kan derefter udføres på udpakkede lysates på forskellige tidspunkter at afgøre, om udtryk for kandidat immunmodulerende proteiner fremmer VSV-LUC redning.
        Bemærk: De Transfektion betingelser beskrevet her ved hjælp af 1 μg/brønd af plasmid DNA resultat i Transfektion effektivitetsgevinster af 40 – 60%13.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Som et eksempel på live-celle tænkelig andragender at overvåge VSV rescue ved VACV coinfection, LD652 celler blev forgyldt i en 8-godt chambered parabol og derefter mock-smittet eller inficeret med VSV-DsRed (MOI = 1) i tilstedeværelse eller fravær af VACV-FL-normal god landbrugspraksis (MOI = 25). Fordi VSV-DsRed udtrykker DsRed som en gratis protein og er ikke sammenvokset til strukturelle VSV proteiner (figur 1A), er det kun registreres efter VSV løsning og gen expression indleder. Alle celler blev derefter mærket med celle levedygtighed farvestof, der frit passerer gennem plasmamembran i celler, hvor det omdannes til en membran-impermeant produkt, som fremmer bevarelsen af det fluorescerende signal i mærket celler. Billeder blev erhvervet hver 5 h op til 65 hpi, ved hjælp af 405 nm, 488 nm, 568 nm, og hvidt lys filtre for at fange celle levedygtighed farvestof, VACV-FL-normal god landbrugspraksis, VSV-DsRed og fase kontrast (PC) kanaler, henholdsvis. Betingelser, enkelt infektion begrænse LD652 celler VSV-DsRed replikering; Derfor udviser kun et lille antal celler et DsRed signal. Men coinfection af VSV-DsRed med VACV-FL-NGL resultater i de fleste celler vises DsRed signaler ved udgangen af tidsforløb (figur 1B). Billeder taget på hvert tidspunkt blev udsat for billede analyse software, hvor 405 nm og 568 nm kanal billeder blev brugt til automatisk at bestemme alt og DsRed-positive celle numre, henholdsvis. Procentdelen af celler viser et DsRed signal til hver behandling beregnes ved at dividere objekter (celler) med et positivt signal i 568-nm-kanal med antallet objekter, der er identificeret i 405 nm kanal for hvert tidspunkt, efterfulgt af multiplikation af 100% . Som vist i figur 1 c, var ~ 2% af celler fra VSV-DsRed enkelt infektioner DsRed-positive af 65 hpi. Derimod var ~ 77% af cellerne i VSV-DsRed + VACV-FL-NGL coinfections DsRed-positive på dette tidspunkt. Film S1 og S2 viser progressionen af VSV-DsRed infektion i hele 65-h tid løbet i enkelt infektion og coinfection tilstande, henholdsvis. Det er vigtigt at bemærke, at normal god landbrugspraksis udtryk af VACV-FL-NGL blev påviselig ved 10 hpi, før det DsRed signal, hvilket viser, at tilstrækkelig VACV genekspression før VSV-DsRed redning (ikke vist). Kollektivt, viser disse resultater tydeligt en redning af VSV-DsRed replikering af VACV coinfection. Hvis et coinfecting virus ikke kunne redde VSV-DsRed, ville vi forvente lige store procentdele af DsRed-positive celler mellem enkelt infektion og coinfection behandlinger.

VSV replikation i LD652 celler kan alternativt kvantificeres ved hjælp af luminescence-baserede assays, når du bruger VSV-LUC stammer (figur 2A). Som et eksempel, figur 2B viser resultaterne af en LUC analyse ved hjælp af lysates udarbejdet en 72 h tid løbet fra mock-inficerede celler eller celler inficeret med VSV-LUC (MOI = 10) i tilstedeværelse eller fravær af VACV-WR (MOI = 25). En positiv redning af VSV-LUC replikering er angivet med den logaritmiske stigning i vilkårlige LU registreres med lysates fremstillet af coinfected celler, i forhold til lysates fra enkelt VSV-LUC infektioner. Et negativt resultat ville angives i denne analyse af fejl i en coinfection at ændre LU aflæsninger fra de observerede i enkelt VSV-LUC infektion behandlinger. Hvis det ønskes, kan rede lysates også bruges til immunoblotting, til at bekræfte forbedret VSV genekspression i coinfection behandlinger. For eksempel, viser figur 2 c en typisk immunblot resultat for VSV-kodet LUC og matrix (M) proteiner i lysates fremstillet af mock-, VSV-LUC, og VSV-LUC + VACV-WR behandlinger 72 hpi. Immunoblotting for VACV I3L protein fungerede som en markør for VACV infektion, og immunoblotting for cellulære actin blev brugt som en loading kontrol. En klar forbedring af VSV-kodet LUC og M proteiner i coinfection lysates yderligere bekræfte VSV redning af VACV. Endelig, produktive VSV replikering kan bekræftes ved at indsamle analysere fra disse LD652 cellekulturer og tilsætningen en smitsom virus på BSC-40 encellelag (figur 2D). Dette resultat illustrerer, at coinfection kun under VACV gør VSV produktivt Repliker.

Når et coinfecting virus er vist i stand til at redde VSV replikation i LD652 celler, kan RNAi screening bruges til at identificere faktorer kodet af den coinfecting virus, der bidrager til VSV redning. I dette eksperiment, skærm for et RNAi-tilstand, der fører til en "tab af rescue" fænotype under VSV-LUC coinfection med en redder virus. Vi har tidligere identificerede VACV A51R protein som en VSV rescue faktor gennem et RNAi screening af snesevis af VACV-kodet udskrifter13. Som et eksempel, har vi sammenfattet en mindre skala version af denne skærm (figur 3). RNAi er medieret af Transfektion af in vitro transskriberet dsRNAs, der er målrettet udskrifter kodet af den coinfecting virus. I de data, der vises her, var viral udskrifter kodning VACV A50R, A51R og A52R proteiner indskyde nemlig RNAi knockdown. Som en negativ kontrol for tab af redning, var celler også transfekteret med dsRNAs rettet mod normal god landbrugspraksis-kodning udskrifter. Som positiv kontrol for et tab af rednings fænotype, blev celler transfekteret med dsRNAs mod LUC-kodning udskrifter. Denne behandling producerer en stærk tab af LU signal under coinfection og hjælper forskere bekræfter at Transfektion/RNAi protokoller arbejder. Efter 5 h af dsRNA Transfektion celler blev coinfected med VSV-LUC (MOI = 10) og VACV-WR (MOI = 25). Separat infektioner med kun VSV-LUC var også udføres for at oprette en baggrundsniveau af LU signal. Lysates blev derefter høstet 72 hpi og bruges i en LUC assay. Sammenligner niveauet af VSV redning på tværs af dsRNA behandlinger til normal god landbrugspraksis dsRNA kontrol behandling, indikerer resultaterne, at knockdown af VACV A51R producerer en stærk tab af rednings fænotype, hvorimod knockdown af A50R og A52R giver et negativt resultat (uden tab af redning i forhold til normal god landbrugspraksis dsRNA).

Som et alternativ til RNAi screening for at identificere viral faktorer, der bidrager til VSV redning, overexpress kandidat viral faktorer i LD652 celler og derefter assay for VSV-LUC redning. Dette kan ske ved kloning kandidat gener af interesse i passende udtryk vektorer som p16629 og transfecting disse plasmider i LD652 celler før VSV-LUC udfordring. Som et eksempel, figur 4A viser en redning eksperiment i hvilke FLAG-tagged normal god landbrugspraksis (FGFP) eller FLAG-markeret A51R (FA51R) p166 vektorer var transfekteret i LD652 celler ved forskellige koncentrationer, efterfulgt af VSV-LUC infektion (MO = 10) 24 timer senere. Som en negativ kontrol for VSV redning, yderligere kulturer var mock-transfekteret og modtog ikke plasmid DNA. Lysates blev indsamlet fra kulturer 72 hpi og blev udsat for LUC assays. FA51R behandlinger produceret VSV rescue positivt, som det fremgår af forbedrede LU signaler over mock-transfekteret behandlinger på flere doser. I modsætning var FGFP behandlinger negativ for VSV redning til enhver dosis, der testes. Immunoblotting af lysates fra figur 4A bekræftet en lignende udtryk af FGFP og FA51R proteiner (figur 4B).

Bruger et RNAi screening af kandidat L. dispar faktorer, vi har vist, at begrænsning af VSV i LD652 celler er medieret af forskellige cellulære faktorer tilhører antiviral RNAi veje (f.eks. AGO2 og Dicer-2), den Nuclear Factor kappa B (NF-κB)-relaterede IMD pathway (f.eks. Relish), og ordningen ubiquitin-proteasom (fx., polyubiquitin)13. Som et eksempel, har vi gentaget en mindre skala version af disse RNAi eksperimenter med dsRNAs målretning L. dispar udskrifter, at øget VSV-LUC replikering på knockdown (fx., AGO2, Dicer-2, Relish, polyubiquitin) eller havde ingen effekt (AGO1 )13. Efter 24 h af dsRNA Transfektion blev celler udfordret med VSV-LUC i 72 timer til at bestemme, hvis RNAi behandlinger forbedret LU signaler over negativ kontrol normal god landbrugspraksis dsRNA behandlinger. RNAi behandlinger, som forbedrer LU signaler indikerer, at den faktor, der er kodet af den målrettede udskrift begrænser VSV replikering. Som positiv kontrol for RNAi knockdown, blev dsRNAs målretning LUC-kodning afskrifter også transfekteret i parallelle behandlinger. På grund af lav baggrunden LU-signaler fundet i normal god landbrugspraksis dsRNA kontrol behandlinger, det var relativt let at identificere vært-kodet begrænsning faktorer ved hjælp af RNAi screening, fordi deres knockdown producerer ~ 10-1.000-fold stigninger i LU signaler ( Figur 5). Det er således muligt at drage fordel af den relativt lave baggrunden niveau af VSV Gen-ekspression i LD652 celler til at screene for værten RNAi knockdown betingelser, der lindre VSV begrænsning.

Figure 1
Figur 1: identifikation af VSV redning af virus coinfection LD652 celler ved hjælp af fluorescens-baseret live-celle imaging. (A) dette panel viser en skematisk af en VSV-DsRed genom med angivelse af DsRed (dR) gen placering. (B) disse repræsentant 10 X konfokalmikroskopi billeder er fanget 60 hpi. 405 nm kanalen angiver en plet for levedygtige celler, 488 nm kanal viser VACV-FL-NGL infektion, og 568 nm kanalen viser VSV-DsRed infektion. Fase kontrast (PC) billeder vises også. Skalere barer = 100 µm. (C) dette panel viser procentdelen af DsRed-positive LD652 celler over hele 65 h infektion tidsforløb. Den gennemsnitlige (SD) procentdel af cellerne viser et DsRed signal for hvert tidspunkt er vist. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: vurdering af VSV redning i LD652 celler ved hjælp af LUC assays. (A) dette panel viser en skematisk af en VSV-LUC genom. (B) dette panel viser vilkårlige lys enheder (LUC) assays af lysates fra mock-inficerede celler eller celler inficeret med VSV-LUC, i fravær eller tilstedeværelse af VACV-WR. (C) dette panel viser en immunblot LUC, VSV M, VACV I3L, og cellulære actin proteiner i lysates fra panelet A indsamlet 72 hpi. (D) dette panel viser VSV-LUC titers i kultur analysere opnået fra panelet B. De kvantitative data i paneler B og D repræsenterer midler (± SD) fra eksperimenter udført i tre eksemplarer. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: identifikation af et viralt kodede VSV rescue faktor gennem RNAi screening under coinfection af LD652 celler. Dette panel viser fold ændringer i LU registreret i lysates fra celler 72 hpi med VSV-LUC og VACV-WR efter den angivne RNAi-behandling i forhold til LU registreret i lysates fra celler enkeltvis inficeret med VSV-LUC. Data repræsenterer midler (± SD) fra eksperimenter udført i tre eksemplarer. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: redning af VSV ved overekspression af en viral Immunmodulator i LD652 celler. (A) dette panel viser en LUC assay fra VSV-LUC-inficerede celler 72 hpi, blev mock-transfekteret (mock) eller transfekteret med enten FGFP eller FA51R p166 udtryk plasmider. LU signaler fra hver behandling var normaliseret til signaler registreret i mock-transfekteret kontrol behandlinger. Data repræsenterer midler (± SD) fra eksperimenter udført i tre eksemplarer. (B) dette panel viser lysates fra panelet A, immunoblotted med FLAG og aktin antistoffer. Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5: identifikation af vært faktorer begrænser VSV replikation i LD652 celler gennem RNAi screening. Dette panel viser folden ændre i LU signaler i angivne RNAi behandlinger i forhold til normal god landbrugspraksis dsRNA kontrol behandlinger 72 hpi med VSV-LUC. Data repræsenterer midler (± SD) fra eksperimenter udført i tre eksemplarer. Venligst klik her for at se en større version af dette tal.

Film S1: repræsentative 405-nm (celle levedygtighed farvestof) og 568 nm (DsRed) kanal billeder taget over en 65 h tidsforløb (hver ramme = 5 h interval) efter VSV-DsRed infektion af LD652 celler. Venligst klik her for at downloade denne fil.

Film S2: repræsentative 405-nm (celle levedygtighed farvestof) og 568 nm (DsRed) kanal billeder taget over en 65 h tidsforløb (hver ramme = 5 h interval) efter coinfection af LD652 celler med VSV-DsRed og VACV-FL-NGL. Venligst klik her for at downloade denne fil.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Her har vi beskrevet simpel fluorescens - og luminescens-baserede assays til at screene for forhold, der redde VSV replikering i restriktive Lepidoptera cellekulturer. Den forfejlede infektion af VSV i Lepidoptera celler skaber en fremragende signal / støj-forhold når kørsler for VSV genekspression. For eksempel, LU signaler registreret i lysates fra enkelt VSV-LUC infektioner var ~ 1.000-fold højere end i mock-inficeret lysates, men disse signaler kun ændret ca dobbelt over en 72-h tidsforløb. Derimod coinfection af VSV-LUC med VACV forbedret LU signaler ~ 300-fold over enkelt VSV-LUC infektioner af 72 hpi. Således vise VSV rescue assays en fremragende dynamikområde, som omfatter flere størrelsesordener.

En af de kritiske trin i oprettelsen af disse assays indebærer beslutning til assay for VSV redning ved hjælp af fluorescens - eller luminescence-baserede tilgange. Vi har vist eksempler på hvordan VSV-kodet DsRed signaler kan analyseres kvantitativt ved hjælp af live-celle Billeddannende teknikker og software-pakker, der letter automatiserede kvantificering af DsRed-positive celler i fravær eller tilstedeværelse af en redning coinfection. Hvis forskere har adgang til live-celle billedbehandling kapaciteter, er disse assays billig at oprette og tillade dem at fange en bred vifte af tidspunkter, der kan støtte i påvisning af forskelle i VSV replikation kinetik er kun observerbare i smalle tid Windows. Derimod luminescence-baserede tilgange er hovedsagelig end-point assays, der kræver forberedelse af cellelysater på forud fastsatte tidspunkter, og lysate forberedelse kan være tidskrævende. På den anden side de luminescence-baserede assays kræver ikke avancerede mikroskopi udstyr — kun en Pladelæser til læsning luminescence signaler. Derudover har luminescence-baserede assays en større dynamikområde end mikroskopi-baserede assays, at beregner procentdelen af celler inficeret. For eksempel i mikroskopi assays, DsRed-positive celler (der angiver VSV-DsRed infektion) kan kun spænder fra 0 – 100% af analyseret celler i et synsfelt. Derimod kan LU signaler mellem enkelt VSV-LUC og coinfection betingelser (eller andre rednings betingelser) spænde over flere størrelsesordener.

En vigtig fordel ved at bruge ordningen VSV -L. dispar celle præsenteres her til at screene for pattedyr virus-kodet hæmmende er, at det i sagens natur vælger til identifikation af viral faktorer, der undertrykker hvad er tilbøjelige til at blive bevaret og gamle antiviral svar, der driver rov hvirveldyr-specifikke interferon svar. Faktisk, foreløbige observationer tyder på at A51R proteiner hæmmer bevarede antiviral ubiquitin-proteasom-relaterede cellulære svar (Se Gammon et al. 13 og ikke-offentliggjorte data). Opdagelsen af VACV A51R redning af VSV var det første eksempel på en heterolog virus redning af en hvirveldyr virus i en hvirvelløse vært13, og det er sandsynligt, at disse screening systemer vil afdække yderligere hvirveldyr virus-kodet hæmmende . Det er vigtigt at bemærke, at nøglen til at bruge VSV redning som en udlæsning for forhold, der hæmmer vært immunitet er at VSV replikering skal være stærkt begrænset (eller mislykkede) i celletype, der VSV replikering behandles i. Derfor ville mest pattedyr celletyper sandsynligvis være uegnede for disse typer af assays, da VSV replikater godt i pattedyrsceller. Dette er grunden til, at L. dispar celler blev brugt her som et naturligt restriktive vært celletype for VSV.

En forudgående undersøgelse i Drosophila celler viste at viral undertrykkere af antivirale RNAi svar kunne identificeres ved cotransfection af udtryk plasmider kodning kandidat RNAi undertrykkere og en selvreplikerende flok hus virus genomisk RNA, koder normal god landbrugspraksis i stedet for B2, sin naturlige RNAi suppressor30. Replikering af flokken hus genomisk RNA og produktion af normal god landbrugspraksis var afhængig af undertrykkelse af RNAi af cotransfected kandidat faktoren, og dermed, redning af normal god landbrugspraksis udtryk antydede RNAi undertrykkelse30. Vores ikke-offentliggjorte arbejde viser, at overekspression af virus-kodet RNAi-hæmmere også redder VSV-LUC genekspression i L. dispar celler, hvilket tyder på, at dette system kan også bruges til at identificere undertrykkere af RNAi svar i forbindelse med infektion af en Bonafide viral patogen i modsætning til en replikon. Faktisk tyder konstateres, at RNAi-, IMD- og ubiquitin-proteasom-relaterede veje bidrager til begrænsning af VSV replikering i L. dispar celler13 på, at viral antagonister af flere antivirale veje kan identificeres ved VSV Rescue assays præsenteres her.

En potentiel begrænsning af disse screeningsmetoder til identifikation af vært antivirale proteiner er, at L. dispar genomet sekvens ikke endnu er tilgængelige. Der er imidlertid offentligt tilgængelige L. dispar transcriptomes, der kan bruges til at identificere kandidat vært mål for RNAi knockdown26,27,28. Derudover har vi tidligere har vist, at VSV er begrænset i cellelinjer udvundet fra andre lepidopterans13 , der nu har en offentligt tilgængelig genom (fx Manduca sexta)31. Derfor, cellelinjer, der stammer fra andre lepidopterans med sekventeret genomer kan erstatte L. dispar celler beskrevet i protokol her.

I betragtning af den voksende økonomiske og trussel mod folkesundheden i arboviruses32, kan screening-assays præsenteres her give nye strategier til at identificere nye funktioner i arbovirus-værtssammenspil, der kan have værdi i udformningen af nye antiviral Therapeutics. Desuden, på grund af vores forholdsvis begrænset forståelse af Lepidoptera mekanismer for at begrænse RNA-virus, replikering, værktøjer præsenteres her giver nye muligheder for at sonde vært forsvarsmekanismer kodet af dette økonomisk vigtige rækkefølgen af insekter.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

D.G. blev støttet af midler fra University of Texas Southwestern Medical Centers begavet lærde Program. Forfatterne takke Michael Whitt (The University of Tennessee Health Science Center) og Sean Whelan (Harvard Medical School) for levering af VSV-DsRed og VSV-LUC. Forfatterne også takke Gary Luker (University of Michigan medicinsk skole) for den slags gave af VACV-FL-NGL stamme.

Materials

Name Company Catalog Number Comments
6-well tissue culture plates CELLTREAT 229106
24-well tissue culture plates CELLTREAT 229124
10 cm tissue culture dishes Corning C430167
Grace’s Insect Medium Sigma G8142
EX-CELL 420 Sigma 14420C
Fetal Bovine Serum - Optima Atlanta Biologicals S12450
Growth medium 1:1 mixture of Grace's Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1% antibiotic-antimycotic solution and 10% Fetal bovine serum
Antibiotic-Antimycotic Solution (100×) Sigma A5955
Dulbecco’s Phosphate Buffered Saline (DPBS) Sigma D8662
Serum Free Media (SFM) Thermo Fisher 10902096
Cytosine arabinoside Sigma C1768
Transfection reagent Thermo Fisher 10362100
Corning cellgro DMSO (Dimethyl Sulfoxide) Corning 25950CQC
Reporter lysis buffer 5x Promega E3971
Luciferase Assay Reagent Promega E1483
96-Well Microplates Corning 3915
Mouse anti-FLAG antibody Wako 014-22383
Rabbit anti-firefly luciferase antibody Abcam ab21176
Mouse anti-actin antibody Sigma A2066
Mouse anti-VSV M N/A N/A Dr. John Connor (Boston University)
Mouse anti-VACV I3L N/A N/A Dr. David Evans (University of Alberta)
8-well Chambered dish Lab-Tek II 155409
Cell viability dye Thermo Fisher C12881
FLUOstar microplate reader BMG Labtech FLUOstar
Confocal microscope Olympus FV10i-LIV
Image analysis software Olympus v1.18 cellSens software
Eppendorf 5702 ventilated centrifuge Eppendorf 22628102
Odyssey Fc Infrared Imaging System Li-COR Biosciences Odyssey Fc
LD652 cells N/A N/A Dr. Basil Arif (Natural Resources Canada)
BSC-40 cells ATCC CRL-2761
BHK cells ATCC CCL-10
HeLa cells ATCC CCL-2
BSC-1 cells ATCC CCL-26
in vitro transcription and purification kit Thermo Fisher AM1626
PCR purification kit Qiagen 28104

DOWNLOAD MATERIALS LIST

References

  1. Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. Viral tropism. Frontiers in Microbiology. 3, 281 (2012).
  2. Werden, S. J., McFadden, G. The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus. Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784, (1), 228-237 (2008).
  3. McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. Cytokine determinants of viral tropism. Nature Reviews: Immunology. 9, (9), 645-655 (2009).
  4. Silva, J. M., et al. Second-generation shRNA libraries covering the mouse and human genomes. Nature Genetics. 37, (11), 1281-1288 (2005).
  5. Moffat, J., et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell. 124, (6), 1283-1298 (2006).
  6. Ma, D., Liu, F. Genome Editing and Its Applications in Model Organisms. Genomics Proteomics Bioinformatics. 13, (6), 336-344 (2015).
  7. Yin, H., Kauffman, K. J., Anderson, D. G. Delivery technologies for genome editing. Nature Reviews: Drug Discovery. 16, (6), 387-399 (2017).
  8. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, (7206), 890-893 (2008).
  9. Houzet, L., Jeang, K. T. Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis. Experimental Biology and Medicine. 236, (8), Maywood, NJ. 962-967 (2011).
  10. Marceau, C. D., et al. Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens. Nature. 535, (7610), 159-163 (2016).
  11. Savidis, G., et al. Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics. Cell Reports. 16, (1), 232-246 (2016).
  12. Panda, D., Cherry, S. Cell-based genomic screening: elucidating virus-host interactions. Current Opinion in Virology. 2, (6), 784-792 (2012).
  13. Gammon, D. B., et al. A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection. Elife. 3, (2014).
  14. Letchworth, G. J., Rodriguez, L. L., Del cbarrera,, J, Vesicular stomatitis. Veterinary Journal. 157, (3), 239-260 (1999).
  15. Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones. Proceedings of the National Academy of Sciences of the United States of America. 92, (18), 8388-8392 (1995).
  16. Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization. PLoS Pathogens. 5, (4), e1000394 (2009).
  17. Duntsch, C. D., et al. Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model. Journal of Neurosurgery. 100, (6), 1049-1059 (2004).
  18. Li, Y., Yuan, S., Moyer, R. W. The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus. Virology. 248, (1), 74-82 (1998).
  19. Seet, B. T., et al. Poxviruses and immune evasion. Annual Review of Immunology. 21, 377-423 (2003).
  20. Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. Preparation of Cell Cultures and Vaccinia Virus Stocks. Current Protocols in Microbiology. 39, 11-18 (2015).
  21. Andrei, G., et al. Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice. Journal of Virology. 80, (19), 9391-9401 (2006).
  22. Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. Preparation of recombinant vaccinia virus for expression of small GTPases. Methods in Enzymology. 174-188 (1995).
  23. Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection. Bio-Protocol. 7, (22), (2017).
  24. Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread. Virology. 341, (2), 284-300 (2005).
  25. Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. Vaccinia reporter viruses for quantifying viral function at all stages of gene expression. Journal of Visualizes Experiments. (87), e51522 (2014).
  26. Cao, C., et al. Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance. Pesticide Biochemistry and Physiology. 119, 54-61 (2015).
  27. Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis. PloS One. 8, (5), e61190 (2013).
  28. Sparks, M. E., Gundersen-Rindal, D. E. The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts. Viruses. 3, (11), 2339-2350 (2011).
  29. Lin, G., Li, G., Granados, R. R., Blissard, G. W. Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion. In Vitro Cellular & Developmental Biology - Animal. 37, (5), 293-302 (2001).
  30. Li, W. X., et al. Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing. Proceedings of the National Academy of Sciences of the United States of America. 101, (5), 1350-1355 (2004).
  31. Kanost, M. R., et al. Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta. Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).
  32. Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases. BMJ Global Health. 3, (2018).
Arbovirus infektioner som Screening-værktøjer for identifikation af Viral hæmmende og vært Antiviral faktorer
Play Video
PDF DOI

Cite this Article

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).More

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter