Lymantria dispar, scientific video journal" />


Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Arbovirus infecties als Screening van hulpmiddelen voor de identificatie van de virale Immunomodulators en Host antivirale factoren

doi: 10.3791/58244 Published: September 13, 2018

Summary

Hier presenteren we de protocollen om te identificeren 1) virus-gecodeerde immunomodulators ter bevordering van arbovirus replicatie en 2) eukaryotische gastheer factoren die arbovirus replicatie beperken. Deze fluorescentie - en luminescentie gebaseerde methoden toestaan onderzoekers snel verkrijgen van kwantitatieve uitlezingen van arbovirus replicatie in simplistische testen met lage signaal-ruis verhouding.

Abstract

RNA-interferentie- en genoom bewerken gebaseerde screening platformen hebben wijd gebruikt factoren te identificeren host cel die replicatie van het virus te beperken. Deze schermen worden echter meestal uitgevoerd in cellen die natuurlijk vrijblijvend naar de virale pathogen bestudeerde zijn. Dus, de robuuste replicatie van virussen in controlevoorwaarden kan het beperken van het dynamisch bereik van deze schermen. Bovendien, deze schermen kunnen zijn niet gemakkelijk identificeren Cellulaire verdediging trajecten die virus replicatie te beperken als het virus is goed aangepast aan de host en staat voor het tegengaan van antivirale verdedigingen. In dit artikel beschrijven we een nieuw paradigma voor het verkennen van virus-gastheer interacties door het gebruik van schermen die midden op natuurlijk mislukte infecties door arboviruses zoals vesiculaire stomatitis-virus (VSV). Ondanks de mogelijkheid van VSV te repliceren in een brede waaier van dipteran insecten en zoogdieren hosts, ondergaat VSV een infectie na binnenkomst, mislukte in een verscheidenheid van cellijnen afgeleid van Lepidoptera insecten, zoals de plakker (Lymantria dispar). Echter, deze mislukte VSV-infecties kunnen worden "gered" toen host cel antivirale verdediging in het gedrang komt. We beschrijven hoe VSV stammen coderen handige reporter genen en beperkende L. dispar cellijnen kunnen worden gekoppeld aan set-up schermen gastheer factoren die betrokken zijn bij arbovirus beperking te identificeren. Bovendien laten we ook zien het nut van deze screening-programma's in de identificatie van viraal gecodeerde factoren die VSV replicatie tijdens wordt of via ectopische expressie redden, met inbegrip van die gecodeerd door zoogdieren virussen. De natuurlijke beperking van VSV replicatie in L. dispar cellen biedt een hoge signaal-/ ruisverhouding wanneer screening voor de voorwaarden ter bevordering van de VSV redding, waardoor het gebruik van simplistische luminescentie en fluorescentie-gebaseerde testen om te controleren de veranderingen in de VSV replicatie. Deze methoden zijn waardevol voor het begrijpen van de interactie tussen gastheer antivirale reacties en virale immuun belastingontduiking factoren.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Het vermogen van een virus om productief te repliceren in een bepaalde host wordt gedeeltelijk beheerst door de beschikbaarheid van de ontvangende cel factoren die ondersteuning bieden voor virale ingang en replicatie1. Het virus-gastheer bereik kan ook worden bepaald door de capaciteit van een virus aan teller cellulaire antivirale verdediging die virale replicatie2,3anders zouden hinderen. Het is het resultaat van deze complexe virus-gastheer interacties die uiteindelijk beslissen of een virus zal zitten kundig voor voltooien hun levenscyclus in een bepaalde host. Gezien de potentieel pathogene gevolgen voor de host als volgt van de virale replicatie, is het cruciaal voor de experimentele strategieën ter bevordering van ons begrip van de belangrijkste virus-gastheer interacties die het evenwicht tussen mislukte en productieve kan tip infecties. Het ophelderen van de moleculaire eigenschappen van virus-gastheer interactie zullen bijdragen aan de ontwikkeling van nieuwe en alternatieve antivirale therapeutische strategieën.

Met de komst van RNA interferentie (RNAi)4,5 en genoom-bewerkingsgereedschap (bv., CRISPR-Cas9, zink vinger nucleasen, TALENs)6,7, is het geworden experimenteel haalbaar is om te veranderen de expressie van cellulaire factoren op de genoom-brede schalen en verken de impact van deze veranderingen over de replicatie van het virus. Inderdaad, talrijke RNAi en genoom bewerken-gebaseerde schermen hebben plaatsgevonden in ongewervelde en gewervelde gastheer celtypen die hebben onthuld nieuwe facetten van virus-gastheer interacties8,9,10, 11 , 12. deze schermen gebruiken meestal virussen codering verslaggevers, zoals firefly luciferase (LUC) of fluorescerende eiwitten (bv., GFP, DsRed), die voorzien in handige middelen kwantitatief beoordeling van virale genexpressie als een uitlezing voor virale replicatie9,12. Deze strategie kan onderzoekers gastheer factoren die ofwel bevorderen of virale replicatie jent blijkens stijgingen of dalingen, respectievelijk, in virale verslaggever9,12 signalente identificeren. Echter in de overgrote meerderheid van de gevallen, zijn deze schermen uitgevoerd met behulp van virussen die goed aangepast zijn aan de gastheer celtype waarin ze worden bestudeerd. Terwijl deze strategie kunnen van belang zijn voor het begrijpen van coevolutionary relaties tussen virale pathogenen en hun natuurlijke gastheren, vormt het fundamentele bezorgdheid met betrekking tot hun gebruik in blootleggen host antivirale factoren. In deze gevallen een verbetering in virus verslaggever signaal op RNAi knockdown is worden gezocht, of de inactivering van een cellulaire factor die normaal virale replicatie belemmert. Ten eerste, als een virus nog kan krachtig repliceren in de gastheercel bestudeerd onder omstandigheden van de controle, het dynamisch bereik van het scherm (dat wil zeggen, het vermogen om te onderscheiden tussen achtergrond en verbeterde virale verslaggever signalen) kan worden beperkt. Ten tweede, deze kwestie wordt verder verergerd door de situaties waarin het virus is goed aangepast aan de gastheercel en effectief in het tegengaan van host defense trajecten die worden gericht in het scherm.

Als gevolg van de bovengenoemde problemen met betrekking tot de traditionele virus-gastheer interactie screeningmethoden, ontwikkelden we een nieuw paradigma voor de studie van virus-gastheer interacties die misbruik maken van natuurlijk mislukte arbovirus infecties in Lepidoptera insect cellen. Deze strategie is afgeleid van een opmerking dat het goed bestudeerde menselijke arbovirus, VSV, een mislukte infectie in cellen die zijn afgeleid van de plakker (L. dispar)13 ondergaat. VSV Natuurlijk wordt overgebracht door dipteran insecten (d.w.z., zand vliegt) naar zoogdieren hosts en experimenteel is aangetoond dat het infecteren van een breed scala van ongewervelden en gewervelde gastheren, beide in cel cultuur en in vivo14. De 11-kb negatieve-zin single-stranded RNA genoom van VSV codeert vijf subgenomic mRNAs die zijn elk vertaald in de eiwitten waaruit de omhuld virion. VSV omgekeerde genetische systemen hebben echter toegestaan voor de oprichting van replicatie-bevoegde stammen codering LUC of fluorescerende eiwitten, naast de vijf natuurlijke VSV gene producten15,16,17. Omdat deze verslaggever proteïnen niet in de VSV virion opgenomen zijn, bieden ze een gemakkelijke uitlezing voor VSV genexpressie dat zich na binnenkomst voordoet. Met behulp van VSV stammen codering GFP of LUC, hebben wij eerder getoond dat VSV genexpressie beperkt bij de binnenkomst van LD652 cellen is en dat VSV titers niet door 72 uur na infectie (hpi verhogen). In tegenstelling, leidt het wordt LD652 cellen met VSV en de zoogdieren poxvirus, vacciniavirus (VACV), tot logaritmische stijgingen van zowel de VSV genexpressie en de titers door dit punt van tijd. VACV ondergaat vroege expressie van genen, DNA-replicatie en laat genexpressie in LD652 cel infecties, maar de VACV-replicatiecyclus is uiteindelijk mislukte als gevolg van onvolledige virion morfogenese18. Het grote ~ 192-kb DNA-genoom van VACV codeert > 200 eiwitten, waarvan vele immunomodulerende eigenschappen ter bevordering van de virale replicatie via de onderdrukking van de host immuunrespons19weergeven. Dus veronderstelde we dat de "redding" van VSV replicatie in LD652 cellen door VACV wordt was waarschijnlijk gemedieerd door VACV immunomodulators die geremd L. dispar reacties normaal beperken VSV replicatie. Ter ondersteuning van dit redt de behandelingvan LD652 cellen met de host RNA polymerase II remmer actinomycin D ook replicatie van de VSV in LD652 cellen, die aangeeft dat de reacties van de transcriptie-afhankelijke host na binnenkomst13van de replicatie van de VSV blokkeren.

De bovenstaande opmerkingen suggereren dat de natuurlijk beperkende aard van LD652 cellen aan VSV-infectie een relatief lage achtergrond voorschrijven kan wanneer screening voor de voorwaarden die verbeteren verslaggever VSV-gecodeerde signalen (dat wil zeggen, degenen die een remmende werking van host antivirale verdediging). Wij bieden hier, de methoden voor het gebruik van fluorescentie- of LUC gebaseerde testen naar scherm voorwaarden die VSV beperking in Lepidoptera cellen verlichten. Ten eerste, laten we zien hoe deze gehaltebepalingen factoren te identificeren viraal gecodeerde immunomodulerende die VSV beperking tijdens beide experimenten wordt of via ectopische expressie van kandidaat-virale factoren breken kunnen worden gebruikt. Als voorbeeld illustreren we hoe we deze screening technieken gebruikt om te identificeren poxvirus-gecodeerde A51R eiwitten als een nieuwe familie van immunomodulerende factoren die VSV replicatie in het ontbreken van andere factoren poxvirus13te redden. Ten tweede, we illustreren hoe RNAi screening in beperkende VSV-LD652 cel infecties kan worden gebruikt voor direct identificatie eukaryotische gastheer factoren die betrokken zijn bij arbovirus beperking13.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. algemene Lymantria dispar (LD652) cel en Virus cultuur

  1. LD652 cel kweken en plating
    1. Aan cultuur L. dispar-afgeleide cellen van de LD652, een monolayer van cellen in een groeimedium (Tabel of Materials) geïncubeerd bij 27 ° C onder normale sfeer behouden. Handhaven van de cellen in 10 cm weefsel-cultuur-testgroep gerechten en passage van de cellen bij het 80% confluentie bereiken.
    2. Plaat, verjagen Adherente cellen van de LD652 van de plaat door de media herhaaldelijk op de enkelgelaagde (deze cellen hoeven niet trypsinebehandeling te verjagen) pipetteren en het monster in groei media naar een geschatte bevolkingsdichtheid van 1 x 105 cellen/mL verdund. Pipetteer 1 mL verdunde cultuur per putje van de plaat van een 24-well. Zaad van een minimum van drie repliceren putten/behandeling type voor elk punt van de tijd (maximaal acht behandelingen/plaat).
    3. De cellen te regelen voor een minimum van 1 h toestaan.
  2. Vaccinia virus voorbereiding
    1. Om te bereiden de voorraden van de VACV, het versterken van het virus in HeLa cellen20 of Afrikaanse groene aap nier cellen (cellen zijn BSC-1 of BSC-40)20,21,22.
      Opmerking: VACV stam Western Reserve (VACV-WR) werkt goed in de hier beschreven testen.
    2. Titreer de VACV stam via plaque assay op BSC-1 of BSC-40 cellen20,22.
      Opmerking: Alle aangegeven VACV veelheid van infectie (MOI) hier beschreven voor LD652 cel infecties zijn gebaseerd op titers BSC-40 plaque tests verkregen.
  3. Vesiculaire stomatitis virus voorbereiding
    1. Ter voorbereiding VSV voorraden, versterken het virus in het BHK cellen23.
    2. Titreer VSV door plaque assay op BSC-40 of BHK cel monolayers13,23.
      Opmerking: Alle VSV MOIs hier beschreven voor LD652 cel infecties zijn gebaseerd op titers BSC-40 plaque tests verkregen.

2. een door de fluorescentie gebaseerde VSV Rescue Assay met behulp van co-infectie en Live-cel Imaging

  1. Zaaien en infectie van de LD652 cellen
    1. Plaat 40.000 LD652 cellen per putje van een 8-well-kamer.
    2. Gebruik voor fluorescentie gebaseerde live-cel imaging, VSV stammen codering van fluorescente proteïnen. De experimenten die hier gepresenteerd gebruiken VSV-DsRed17, een recombinant VSV-stam, die uitdrukt gratis DsRed eiwit dat niet aan een andere VSV-proteïne is gesmolten.
      Opmerking: VSV infectie van LD652 cellen niet cytopathogeen door 96 hpi en, dus, de dood van de cel is niet een storende factor bij de beoordeling van de VSV replicatie binnen dit tijdsbestek.
    3. VSV-DsRed en VACV-FL-GFP bereiden in een serumvrij media (SFM; Tabel van materialen) bij een MOI 1 en 25, respectievelijk.
      Opmerking: VACV-FL-GFP is een recombinant VACV stam die een fusie tussen LUC en GFP24uitdrukt. Met behulp van een MOI van 25 of hoger voor stammen van de VACV zorgt ervoor dat alle LD652 cellen besmette13. Als met behulp van een ander coinfecting virus, zal de MOI moet empirisch worden bepaald door de gebruiker. Elke infectie behandeling moet worden ingesteld in dubbele wells en mock-geïnfecteerde behandelingen waarin alleen SFM wordt toegevoegd aan de cellen bevatten.
    4. Incubeer de cellen in 0,2 mL van entmateriaal gedurende 2 uur bij 27 ° C.
    5. Wassen van de cellen met 0,5 mL/goed voor groei media.
    6. Incubeer de cellen in 25 μM van cel levensvatbaarheid kleurstof (Tabel van materialen) in groei media voor 45 min bij 27 ° C.
    7. De media gecombineerd en was de putjes goed 1 x met 0,5 mL/goed te verwijderen van de overtollige kleurstof.
    8. De cellen in 0.3 mL/goed van de media van de groei te handhaven.
  2. Leven met het vastleggen van het beeld van de cel
    1. Zet een confocal microscoop 30 min vooraf en laden van een 8-well kamer schotel.
      Opmerking: LD652 cellen kunnen worden beeld bij kamertemperatuur variërend van 20-25 ° C, maar voor optimale omstandigheden, de temperatuur van de kamer moet worden aangepast aan de 27 ° C.
    2. Instellen van de juiste excitatie/emissie instellingen voor elke proteïne fluorescerende marker naar zijn beeld, evenals de fase contrast-beeldinstellingen.
    3. Pas de intensiteit van de laser voor elk kanaal.
      Let op: Hiervoor kunnen uitvoeren van een proefproject om het bereik van fluorescent signaal intensiteit waargenomen in de tijdsverloop om te worden gebruikt in de laatste experiment bepalen.
    4. Met behulp van de 10 X doelstelling, de fase contrast- en fluorescentie foto's vastleggen van elk goed elke 1 – 5 h voor de duur van de infectie tot een gewenste tijdstip (bv., 48 / 72 hpi).
      Opmerking: Het is belangrijk om vast te leggen van meerdere gezichtsveld in elk putje te nauwkeurig schatten de infectieniveaus in de cultuur.
  3. Beeldanalyse
    1. Gebruik beeld analysesoftware voor geautomatiseerde beeldanalyse van passende fluorescerende kanalen (bv., 405 nm, 488 nm, 568 nm).
    2. Voor de berekening van het percentage cellen die geïnfecteerd zijn, het verdelen van het totale aantal fluorescerende cellen met vermelding van de VSV infectie (bv., DsRed-positieve cellen voor VSV-DsRed infecties) door het totale aantal levensvatbare cellen gelabeld door cel levensvatbaarheid kleurstof voor elke gezichtsveld over alle behandelingen.

3. algemene virale infectie Protocol voor VSV luminescentie gebaseerde Rescue testen in LD652 cellen

  1. Voorbereiding van entmateriaal
    1. 30 min voordat de infectie, Ontdooi de voorraden van VSV-LUC16 (een recombinant VSV stam die spreekt gratis firefly luciferase eiwit niet gesmolten aan elke andere VSV-eiwit). Als keuring voor VSV-LUC redding tijdens VACV wordt, ook de VACV-WR virus op ijs te ontdooien.
      Opmerking: Andere virussen (naast VACV-WR) kunnen redden VSV-LUC tijdens de wordt, maar dit zal moeten worden empirisch bepaald door elke gebruiker.
    2. Voorbereiden van het entmateriaal door verdunning van VSV-LUC in de aanwezigheid of afwezigheid van VACV-WR in SFM, zodanig dat een MOI van 10 en 25, respectievelijk wordt bereikt bij het toevoegen van een volume van de totale entmateriaal van 0,2 mL/goed.
  2. Infectie van de cellen
    1. Volwassen LD652 media zorgvuldig en voorkom verstoring van de enkelgelaagde gecombineerd en inoculeren met 0,2 mL virus per putje. Ditmaal is gedefinieerd als 0 hpi. Steriele SFM aan extra putten om te dienen als "mock-besmet" negatieve controle behandelingen toevoegen.
    2. Incubeer de cellen in de entmateriaal gedurende 2 uur bij 27 ° C.
    3. 2 hpi, entmateriaal door aspiratie verwijderen en vervangen door 1 mL/goed LD652 groei media.
    4. De infectie te gaan 24-72 hpi toestaan.

4. luciferase Assay

  1. Voorbereiding van cel lysates
    1. Zorgvuldig de bovendrijvende substantie gecombineerd en voeg 1 mL Dulbecco van fosfaat gebufferde zoutoplossing (DPBS) / goed.
    2. Met behulp van de zuiger van een injectiespuit 1 mL, schraap de cellen in de DPBS.
    3. De cellen overbrengen in een microcentrifuge buis, en centrifuge op 400 x g gedurende 20 minuten bij 4 ° C.
    4. Ondertussen bereiden 1 x verdunning van 5 x verslaggever lysis-buffermengsel (RLB) in steriele H2O.
    5. Na het centrifugeren, gecombineerd de DPBS zonder verstoring van de cel-pellet.
    6. Resuspendeer elke pellet in 150 µL van 1 x RLB.
    7. Bevriezen-ontdooien de monsters 1 x met behulp van een 5-min-incubatie in een vriezer van-80 ° C gevolgd door een snelle dooi in een waterbad kamertemperatuur. Bewaren de lysates bij-80 ° C tot klaar om te analyseren.
  2. Luciferase assay
    1. Ontdooi de lysates op ijs.
    2. Pipetteer 20 μL van lysate in een putje van een effen zwart of wit 96-Wells-microplate.
    3. Voeg 100 μl van luciferase assay reagens toe aan elk putje.
    4. Direct meten van de lichtintensiteit met behulp van een luminometer (juiste instellingen voor specifieke luminometers zal moeten worden empirisch bepaald door de gebruiker).
  3. Luciferase assay analyse
    1. Normaliseren LU signalen voor elke behandeling LU lezingen verkregen controle behandelingen (Vertegenwoordiger resultaten). Nadat ten minste drie onafhankelijke experimenten zijn uitgevoerd, kan het gemiddelde dat Lu uit elke behandeling/controlegroep verkregen door passende statistische tests worden geanalyseerd.

5. Immunoblot

  1. Gebruik lysates gewonnen voor het testen van LUC voor SDS-pagina en latere immunoblotting, met behulp van passende reagentia en instrumentatie.

6. de titer van VSV van celculturen LD652

  1. Plaat LD652 cellen volgens stap 1.1.
  2. Viral infecteren de cellen volgens stap 3.
  3. Op gewenste tijdstippen, het supernatant in steriele microcentrifuge buizen te verzamelen.
  4. Pellet de cellen met behulp van 1.000 x g gedurende 10 minuten bij 4 ° C en breng het supernatant naar nieuwe buizen.
  5. Bewaar het supernatant bij-80 ° C of ga verder met de titratie door plaque assay op BSC-40 cellen.
    Opmerking: Als titrating VSV van celculturen van LD652 die VACV, is het raadzaam 100 μg/mL cytosine arabinoside (AraC) toevoegen aan de BSC-40 voedingsbodems binnen 2 hpi, om te voorkomen dat residuele VACV deeltjes vorming van plaques op BSC-40 monolayers13. AraC is een virale DNA polymerase-remmer die blokken VACV DNA replicatie25 , maar heeft geen invloed op de replicatie van de VSV.

7. variaties van luminescentie gebaseerde VSV redden testen in LD652 cellen: RNAi en plasmide transfectie experimenten

  1. Voorbereiding van dsRNA RNAi-gemedieerde knockdown van virale of hosten van afschriften
    1. Ontwerp gen-specifieke primers tailed eind 5' met de T7 promotor opeenvolging (TAATACGACTCACTATAGGG) te richten hetzij het coinfecting virus (bijvoorbeeldVACV) of L. dispar mRNA afschriften van belang. Deze inleidingen moeten een PCR-product van 400-600 bp voor effectieve RNAi-gemedieerde knockdown produceren. Zie Gammon et al. 13 voor primer sequenties gebruikt onder vechtpartij VACV of L. dispar transcripties door dsRNA-gemedieerde RNAi in LD652 cellen.
      Opmerking: L. dispar mRNA afschriften kunnen worden geïdentificeerd van gepubliceerd L. dispar transcriptome databases26,27,28.
    2. Genereren een DNA sjabloon via RT-PCR (cDNA synthese: 1 cyclus van 50 ° C gedurende 30 minuten; PCR: 40 cycli 94 ° c voor 15 s, 50 ° C gedurende 30 s, en 68 ° C gedurende 45 s elk).
    3. Het zuiveren van het PCR-product met behulp van een PCR zuivering kit.
    4. Het gezuiverde PCR product als een sjabloon gebruikt, in vitro transcriberen en zuiveren met behulp van een in vitro transcriptie en zuivering kit dsRNA.
  2. Transfectie dsRNA of plasmide DNA in cellen van de LD652
    1. Zaad 1 x 105 cellen/putje van een 24-well-plaat en laat de cellen regelen voor ten minste 1 uur.
    2. Voor elk putje om te zijn transfected, Verdun 4 μL van transfectiereagens in 100 μl van SFM. Incubeer gedurende maximaal 15 minuten bij kamertemperatuur. Dit kan worden aangepast om een master mix voor alle transfections moet worden uitgevoerd.
    3. Verdunnen tot 1 μg dsRNA of totale plasmide DNA met 100 μl van SFM voor elk putje om te zijn transfected. Incubeer gedurende maximaal 15 minuten bij kamertemperatuur.
      Opmerking: We hebben eerder ontdekt dat een transfectie van 1 μg dsRNA/105 LD652 cellen voldoende voor > 80% knockdown van een virale of hosten afschriften13, maar dsRNA doses nodig voor gemodificeerde experimentele troep-ups/voorwaarden zal moeten empirisch bepaald worden.
    4. Combineren van transfectie reagens en dsRNA/plasmide DNA verdunningen met een 1:1 verhouding (bv100 μl van verdunde dsRNA is gemengd met 100 μl van verdunde transfectiereagens) en incubeer gedurende 20 minuten bij kamertemperatuur.
    5. Ondertussen was de putjes met 1 mL/goed voor SFM, en voegt 500 μL van SFM aan elk putje.
    6. Voeg langzaam de transfectie reagens dsRNA (of plasmide DNA) mengsel dropwise in elk putje.
    7. Incubeer de transfectiereagens met de cellen gedurende 5 uur.
      1. Voor RNAi experimenten met het knockdown van afschriften gecodeerd door een coinfecting virus (bijvoorbeeldVACV), vervangen door de transfectiereagens na de incubatieperiode 5-h transfectie virus entmateriaal met VSV-LUC (met of zonder VACV of een ander coinfecting virus) (stap 3). Vervang vervolgens de virus entmateriaal met VSV-LUC met volledige groei media 2 hpi. LUC assays (stap 4) kunnen vervolgens worden uitgevoerd op de uitgepakte lysates op verschillende tijdstippen om te bepalen als het knockdown van coinfecting virus afschriften tot een verlies van VSV-LUC redding leidt.
      2. Voor het RNAi uittesten van RNAi van L. dispar afschriften, vervangen van de transfectie mix met volledige groei media en laat knockdown ondervinden gedurende 24 uur voorafgaand aan de infectie met VSV-LUC (stap 4). LUC assays (stap 4) kunnen vervolgens worden uitgevoerd op de uitgepakte lysates op verschillende tijdstippen om te bepalen als het knockdown van L. dispar afschriften VSV-LUC redding bevordert.
      3. Voor het uittesten van transfections van plasmide expressievectoren kandidaat immunomodulators uitdrukken, vervangen de transfectiereagens en zorgen voor eiwit expressie gedurende 24 uur voorafgaand aan de infectie met VSV-LUC (stap 4). LUC assays (stap 4) kunnen vervolgens worden uitgevoerd op de uitgepakte lysates op verschillende tijdstippen om te bepalen of de expressie van kandidaat-immunomodulerende eiwitten VSV-LUC redding bevordert.
        Opmerking: De transfectie voorwaarden hier beschreven met behulp van 1 μg per putje van plasmide DNA resultaat in Transfectie efficiëntie van 40-60%13.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Als een voorbeeld van live-cel weergavetoepassingen om te controleren van VSV redding op VACV wordt, LD652 cellen werden verguld in een 8-well chambered schotel en vervolgens mock-besmet of besmet met VSV-DsRed (MOI = 1) in de aanwezigheid of afwezigheid van VACV-FL-GFP (MOI = 25). Omdat VSV-DsRed DsRed als een vrije eiwit spreekt en niet aan VSV-structurele eiwitten (figuur 1A) is gesmolten, is het alleen gedetecteerd nadat VSV ingang en gen-expressie start. Alle cellen waren dan gelabeld met cel levensvatbaarheid kleurstof die vrij het plasma-membraan van cellen passeert, waar het wordt omgezet in een membraan-impermeant product, dat het behoud van het fluorescerende signaal in gelabelde cellen bevordert. Beelden werden verkregen elke 5 h tot 65 hpi, met behulp van de 405 nm, 488 nm, 568 nm en wit licht filters vangen cel levensvatbaarheid kleurstof, VACV-FL-GFP VSV-DsRed en fase contrast (PC) kanalen, respectievelijk. Onder één infectie voorwaarden beperken LD652 cellen VSV-DsRed replicatie; Daarom vertonen slechts een klein aantal cellen een DsRed signaal. Wordt van VSV-DsRed met VACV-FL-GFP resulteert echter in de meeste cellen weergeven DsRed signalen door het einde van het tijdsverloop (figuur 1B). Afbeeldingen die zijn vastgelegd op elk tijdstip werden onderworpen aan de software van de analyse van de afbeelding, waar 405 nm en 568 nm kanaal afbeeldingen werden gebruikt om automatisch te bepalen totale en DsRed-positieve cel nummers, respectievelijk. Het percentage cellen weer te geven van een signaal van de DsRed voor elke behandeling wordt berekend door objecten (cellen) met een positief signaal in de 568-nm kanaal door het aantal objecten geïdentificeerd in de 405 nm kanaal voor elk punt van tijd, gevolgd door vermenigvuldiging van 100% . Zoals blijkt uit Figuur 1 c, werden ~ 2% van de cellen van VSV-DsRed interne infecties DsRed-positieve door 65 hpi. Daarentegen waren ~ 77% van de cellen in de VSV-DsRed + VACV-FL-GFP coinfections DsRed-positief op dit punt van de tijd. Films S1 en S2 weergeven de progressie van de infectie van de VSV-DsRed in de loop van de hele tijd van 65-h in één infectie en wordt, respectievelijk Het is belangrijk op te merken dat het GFP-expressie door VACV-FL-GFP detecteerbare werd door 10 hpi, voorafgaand aan het signaal van de DsRed, die aangeeft dat voldoende VACV genexpressie vereist voorafgaand aan VSV-DsRed redding (niet afgebeeld). Collectief, duidelijk deze resultaten een redding van VSV-DsRed replicatie door VACV wordt. Als een coinfecting virus kon redden van VSV-DsRed, verwachten wij gelijke percentages van DsRed-positieve cellen tussen enkele infectie en wordt behandelingen.

VSV replicatie in LD652 cellen kan als alternatief worden gekwantificeerd aan de hand luminescentie gebaseerde testen bij het gebruik van VSV-LUC stammen (figuur 2A). Als voorbeeld, figuur 2B toont de resultaten van een bepaling van de LUC met behulp van lysates bereid in een 72 h tijdsverloop van mock-geïnfecteerde cellen of cellen besmet met VSV-LUC (MOI = 10) in de aanwezigheid of afwezigheid van VACV-WR (MOI = 25). Een positieve redding van VSV-LUC replicatie wordt aangegeven door de logaritmische toename van willekeurige LU met lysates bereid uit infectie cellen, in vergelijking met lysates van één VSV-LUC infecties ontdekt. Een negatief resultaat zou in deze test worden aangegeven door het falen van een wordt te wijzigen van LU lezingen van die waargenomen in één VSV-LUC infectie behandelingen. Indien gewenst, kan bereid lysates ook worden gebruikt voor immunoblotting, te bevestigen verbeterde VSV genexpressie in wordt behandelingen. Bijvoorbeeld, toont figuur 2C een typische immunoblot resultaat voor VSV-gecodeerde LUC en matrix (M)-proteïnen in lysates bereid uit mock-, VSV-LUC, en VSV-LUC + VACV-WR behandelingen 72 hpi. Immunoblotting voor VACV I3L eiwit diende als een marker van VACV infectie en immunoblotting voor cellulaire actine werd gebruikt als een besturingselement laden. De duidelijke verhoging van de VSV-gecodeerde LUC en M eiwitten in de wordt lysates verder bevestigen VSV redding door VACV. Ten slotte, productieve VSV replicatie kan worden bevestigd door het verzamelen van supernatant van deze LD652 celculturen en titrating een besmettelijke virus op BSC-40 monolayers (figuur 2D). Dit resultaat illustreert dat alleen tijdens VACV wordt doet VSV productief repliceren.

Zodra een coinfecting virus is getoond kunnen redden van VSV replicatie in LD652 cellen, kan RNAi screening dienen gecodeerd door het coinfecting virus factoren die aan VSV redding bijdragen te identificeren. In dit experiment, scherm voor een RNAi aandoening die tot een "verlies van redding" fenotype tijdens de VSV-LUC wordt met een redden virus leidt. Wij eerder het eiwit VACV A51R geïdentificeerd als een factor van VSV redding door een RNAi screening van tientallen VACV-gecodeerd afschriften13. Als voorbeeld hebben wij een kleinere versie van de schaal van dit scherm (Figuur 3) gerecapituleerd. RNAi wordt gemedieerd door transfectie van in vitro transcriptie van dsRNAs die gericht zijn op transcripten gecodeerd door het coinfecting virus. In de hier getoonde gegevens, waren virale afschriften codering van VACV A50R, A51R en A52R eiwitten gericht voor RNAi knockdown. Als een negatieve controle voor verlies van redding, werden ook cellen transfected met dsRNAs dat targeting GFP-encoding afschriften. Als positieve controle voor een verlies van redding fenotype, werden cellen transfected met dsRNAs tegen LUC-encoding afschriften. Deze behandeling een sterk verlies van LU signaal produceert tijdens wordt en helpt onderzoekers bevestigen dat transfectie/RNAi protocollen werken. Na 5 uur van dsRNA transfectie cellen werden infectie met VSV-LUC (MOI = 10) en VACV-WR (MOI = 25). Aparte infecties met alleen VSV-LUC werden ook uitgevoerd om vast te stellen een achtergrondwaarde van LU signaal. Lysates waren dan 72 hpi geoogst en gebruikt in een test van LUC. Waarbij het niveau van de VSV redding over dsRNA behandelingen aan de GFP dsRNA controle behandeling wordt vergeleken, blijkt uit de resultaten dat de knockdown van VACV A51R een sterk verlies van redding fenotype produceert, overwegende dat het knockdown van A50R en A52R een negatief resultaat (geen verlies van produceert Rescue t.o.v. GFP dsRNA).

Als alternatief voor RNAi screening ter identificatie van de virale factoren die aan VSV redding bijdragen, overexpress van de kandidaat-virale factoren in de LD652 cellen en vervolgens assay voor VSV-LUC redding. Dit kan worden bereikt door klonen kandidaat-genen van belang in passende expressievectoren zoals p16629 en transfecting deze plasmiden in LD652 cellen voorafgaand aan de uitdaging van de VSV-LUC. Als voorbeeld, figuur 4A een redding experiment toont in welke vlag-gelabeld GFP (FGFP) of de vlag-gelabeld A51R (FA51R) p166 vectoren zijn transfected in LD652 cellen in verschillende concentraties, gevolgd door VSV-LUC infectie (MO = 10) 24 h later. Als een negatieve controle voor VSV redding, extra culturen waren mock-transfected en ontving geen plasmide DNA. Lysates werden verzameld uit culturen 72 hpi en werden onderworpen aan LUC testen. FA51R behandelingen geproduceerd een positief resultaat van de VSV redding, zoals blijkt uit de verbeterde LU signalen over mock-transfected behandelingen bij meerdere doses. In tegenstelling, waren FGFP behandelingen negatief voor VSV redding bij elke dosis getest. Immunoblotting van de lysates uit figuur 4A bevestigd een soortgelijke uitdrukking van FGFP en FA51R eiwitten (figuur 4B).

Met behulp van een RNAi screening van de kandidaat- L. dispar factoren, hebben wij aangetoond dat de beperking van de VSV in LD652 cellen wordt gemedieerd door verschillende cellulaire factoren die behoren tot antivirale RNAi trajecten (bijvoorbeeld, AGO2 en Dicer-2), de nucleaire Factor Kappa B (NF-recombination)-verwante IMD traject (b.v. Relish), en de ubiquitin-proteasoom-systeem (bv., polyubiquitin)13. Als voorbeeld hebben wij een kleinere versie van de schaal van deze experimenten RNAi herhaald met dsRNAs dat targeting L. dispar afschriften die verbeterd VSV-LUC replicatie op knockdown (bv., AGO2, Dicer-2, Relish, polyubiquitin) of had geen effect (AGO1 )13. Na 24u van dsRNA transfectie, werden cellen uitgedaagd met VSV-LUC gedurende 72 uur om te bepalen als RNAi behandelingen verbeterd LU signalen over negatieve controle GFP dsRNA behandelingen. RNAi behandelingen die verbetering van LU signalen geven aan dat de factor gecodeerd door de gerichte transcript VSV replicatie beperkt. Als positieve controle voor RNAi knockdown, werden ook dsRNAs dat targeting LUC-encoding afschriften transfected in parallelle behandelingen. Als gevolg van de laag achtergrond LU signalen gedetecteerd in GFP dsRNA controle behandelingen, het was relatief eenvoudig te identificeren factoren van de host-gecodeerde beperking met behulp van RNAi screening omdat hun knockdown ~ 10 produceert-tot 1,000-fold stijgingen van LU signalen ( Figuur 5). Het is dus mogelijk om te profiteren van de relatief lage achtergrond niveau van VSV genexpressie in cellen van de LD652 om het scherm voorwaarden host RNAi vechtpartij die VSV beperking verlichten.

Figure 1
Figuur 1: identificatie van VSV redding door virus wordt LD652 cellen met behulp van fluorescentie gebaseerde live-cel imaging. (A) dit paneel toont een schematische voorstelling van een genoom van de VSV-DsRed met vermelding van de locatie van de gene DsRed (dR). (B) deze vertegenwoordiger 10 X confocale microscopie beelden zijn gevangen 60 hpi. De 405 nm kanaal duidt een vlek voor levensvatbare cellen, de 488-nm kanaal geeft aan VACV-FL-GFP infectie en het 568 nm kanaal duidt VSV-DsRed infectie. Fase contrast (PC) afbeeldingen worden ook weergegeven. Schaal bars = 100 µm. (C) dit paneel toont het percentage van de LD652 van de DsRed-positieve cellen in de hele 65 h loop voor de tijd van de infectie. Het gemiddelde percentage (SD) van de cellen waaruit een signaal van de DsRed voor elk punt van de tijd wordt weergegeven. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: beoordeling van VSV redding in LD652 cellen met behulp van LUC testen. (A) dit paneel toont een schematische voorstelling van een VSV-LUC genoom. (B) dit paneel toont willekeurige licht eenheden (LUC) testen van lysates van mock-geïnfecteerde cellen of cellen besmet met VSV-LUC, in de afwezigheid of de aanwezigheid van VACV-WR. (C) dit paneel toont een immunoblot VSV M, LUC, VACV I3L, en cellulaire actine eiwitten in de lysates van paneel A 72 hpi verzameld. (D) dit paneel toont VSV-LUC titers in cultuur supernatant verkregen van paneel B. De kwantitatieve gegevens in panelen B en D vertegenwoordigen de middelen (± SD) uit experimenten uitgevoerd in drievoud. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: identificatie van een viraal-gecodeerde VSV redding factor door RNAi screening tijdens de wordt LD652 cellen. Dit paneel toont vouw wijzigingen in LU gedetecteerd in lysates uit cellen 72 hpi met VSV-LUC en VACV-WR na de behandeling aangegeven RNAi, ten opzichte van LU gedetecteerd in lysates uit cellen afzonderlijk besmet met VSV-LUC. De gegevens vertegenwoordigen de middelen (± SD) uit experimenten uitgevoerd in drievoud. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: redding van VSV door de overexpressie van een virale immunomodulator in LD652 cellen. (A) dit paneel toont een LUC assay van VSV-LUC-geïnfecteerde cellen 72 hpi die mock-transfected (mock) of met FGFP of FA51R p166 expressie plasmiden transfected. LU signalen van elke behandeling waren genormaliseerd naar signalen gedetecteerd in mock-transfected controle behandelingen. De gegevens vertegenwoordigen de middelen (± SD) uit experimenten uitgevoerd in drievoud. (B) dit paneel toont lysates van paneel A, immunoblotted met vlag en actine antilichamen. Klik hier voor een grotere versie van dit cijfer.

Figure 5
Figuur 5: identificatie van gastheer factoren beperken VSV replicatie in LD652 cellen door RNAi screening. Dit paneel toont dat de vouw wijzigen in LU signalen in aangegeven RNAi behandelingen ten opzichte van het GFP dsRNA controle behandelingen 72 hpi met VSV-LUC. De gegevens vertegenwoordigen de middelen (± SD) uit experimenten uitgevoerd in drievoud. Klik hier voor een grotere versie van dit cijfer.

Film S1: vertegenwoordiger 405-nm (kleurstof van de levensvatbaarheid van de cel) en 568 nm (DsRed) kanaal beelden in een loop van de tijd 65 h (elk frame = 5 h interval) na infectie van de VSV-DsRed van LD652 cellen. Klik hier om dit bestand te downloaden.

Film S2: vertegenwoordiger 405-nm (kleurstof van de levensvatbaarheid van de cel) en 568 nm (DsRed) kanaal beelden in een loop van de tijd 65 h (elk frame = 5 h interval) na wordt LD652 cellen met VSV-DsRed en VACV-FL-GFP. Klik hier om dit bestand te downloaden.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Wij hebben hier eenvoudige fluorescentie - en luminescentie gebaseerde testen te screenen op omstandigheden die VSV replicatie in beperkende Lepidoptera celculturen redden beschreven. De mislukte infectie van VSV in Lepidoptera cellen maakt een uitstekende signal-to-noise verhouding als keuring voor VSV genexpressie. Bijvoorbeeld, de LU-signalen gedetecteerd in lysates uit één VSV-LUC infecties waren ~ 1,000-fold hoger dan in mock-geïnfecteerde lysates, maar deze signalen ongeveer tweeledig alleen gewijzigd in de tijdsverloop van een 72-uur. Daarentegen wordt van VSV-LUC met VACV LU signalen versterkt ~ 300-fold over single VSV-LUC infecties van 72 hpi. Dus, VSV redding testen een uitstekend dynamisch bereik, omvat verschillende ordes van grootte weergeven

Een van de kritische stappen bij het opzetten van deze testen gaat het besluit om te assay voor VSV redding met behulp van fluorescentie of luminescentie gebaseerde benaderingen. We hebben laten zien van voorbeelden van hoe VSV-gecodeerde DsRed signalen kunnen worden vehiculumcontrolegroep kwantitatief met behulp van live-cel beeldvormingstechnieken en softwarepakketten die de geautomatiseerde kwantificering van DsRed-positieve cellen in de afwezigheid of de aanwezigheid van een redding vergemakkelijken wordt. Als onderzoekers toegang tot live-cel beeldvormende mogelijkheden hebben, zijn deze tests goedkoop te zetten en laten vastleggen van een breed scala van tijdstippen die in de detectie van verschillen in VSV replicatie kinetiek die enige waarneembare smalle tijdig kan helpen Windows. Daarentegen luminescentie gebaseerde benaderingen zijn in wezen eindpunt testen waarvoor de voorbereiding van cel lysates op vooraf bepaalde tijdstippen en lysate voorbereiding kan tijdrovend zijn. Aan de andere kant, de luminescentie gebaseerde tests vereisen geen geavanceerde microscopie apparatuur — alleen een afleesapparaat kunnen lezen van luminescentie signalen. Bovendien hebben luminescentie gebaseerde testen een groter dynamisch bereik dan microscopie gebaseerde testen waarmee het percentage cellen besmet worden berekend. Bijvoorbeeld, in microscopie testen, DsRed-positieve cellen (met vermelding van de VSV-DsRed infectie) alleen variëren van 0-100% van de geanalyseerde cellen in een gezichtsveld. LU signalen tussen één VSV-LUC en wordt (of andere redding toestand) kunnen daarentegen variëren over verschillende ordes van grootte.

Een belangrijk voordeel van het gebruik van de VSV -L. dispar cel systeem hier gepresenteerd aan het scherm voor zoogdieren virus-gecodeerde immunomodulators is dat het inherent selecteert voor de identificatie van virale factoren die onderdrukken wat zijn waarschijnlijk worden behouden en oude antivirale reacties die ouder zijn dan de gewervelde-specifieke interferon-reactie. Inderdaad, voorlopige opmerkingen suggereren dat A51R eiwitten geconserveerde antivirale ubiquitin-proteasoom-gerelateerde cellulaire reacties remmen (Zie Gammon et al. 13 en niet-gepubliceerde gegevens). De ontdekking van VACV A51R redding van VSV was het eerste voorbeeld van een redding van heterologe virus door een gewervelde virus in een ongewervelde gastheer13, en het is waarschijnlijk dat deze screening systemen extra gewervelde virus-gecodeerde immunomodulators zult ontdekken . Het is belangrijk op te merken dat de sleutel tot het gebruik van VSV redding als een uitlezing voor voorwaarden die een remmende werking van de immuniteit van de gastheer dat VSV-replicatie is moet sterk beperkt (of mislukte) in het celtype dat VSV replicatie wordt onderzocht in. Meest zoogdieren celtypes zou waarschijnlijk dus niet geschikt voor dit soort tests, gezien het feit dat VSV goed in zoogdiercellen repliceert. Dit is de reden waarom L. dispar cellen werden gebruikt als een natuurlijk beperkende host celtype voor VSV.

Een voorafgaande studie in Drosophila cellen toonde aan dat virale suppressors voor antivirale RNAi reacties kon worden geïdentificeerd door cotransfection van expressie plasmiden codering kandidaat RNAi suppressors en een zelfreplicerende Flock huis virus genomic RNA dat GFP in plaats van de B2, haar natuurlijke RNAi suppressor30codeert. De replicatie van de kudde huis genomic RNA en productie van GFP was afhankelijk van de onderdrukking van RNAi door de factor cotransfected kandidaat- en, dus, de redding van GFP expressie aangegeven RNAi onderdrukking30. Onze onuitgegeven werk geeft aan dat de overexpressie van virus-gecodeerde RNAi remmers ook VSV-LUC genexpressie in cellen L. dispar suggereren redt dat dit systeem ook kan worden gebruikt ter identificatie van suppressors van RNAi reacties in het kader van besmetting door een bona fide virale pathogen in tegenstelling tot een replicon. Inderdaad, de vaststelling dat RNAi - IMD- en ubiquitin-proteasoom-gerelateerde trajecten aan de beperking van de VSV replicatie in L. dispar cellen13 bijdragen suggereert dat virale antagonisten van verschillende antivirale trajecten kunnen worden geïdentificeerd door de VSV redding testen hier gepresenteerd.

Een mogelijke beperking van deze screeningmethoden met betrekking tot de identificatie van de host antivirale eiwitten is dat het genoom L. dispar nog niet beschikbaar is. Er zijn echter openbaar L. dispar transcriptomes die kunnen worden gebruikt voor identificatie van kandidaat-host dedoelenvoorde RNAi vechtpartij26,27,28. Bovendien hebben wij aangetoond eerder dat VSV is beperkt in afgeleid van andere Lepidoptera13 cellijnen die nu een openbaar genoom (bijvoorbeeld Manduca sexta hebben)31. Daarom, vervangende cellijnen afgeleid van andere Lepidoptera met gesequenceerd genomen de cellen van de L. dispar beschreven in het protocol hier.

Gezien de groeiende economische en gevaar voor de volksgezondheid van arboviruses32, kunnen de screening tests gepresenteerde nieuwe strategieën ter identificatie van de nieuwe functies van arbovirus-gastheer interacties die waarde in het ontwerp van nieuwe antiviral hebben kunnen Therapeutics. Anderzijds vanwege onze relatief beperkte begrip van Lepidoptera mechanismen voor het beperken van RNA-virus replicatie, de tools hier gepresenteerd bieden nieuwe mogelijkheden om de sonde van de afweermechanismen van de host gecodeerd door dit economisch belangrijke orde van insecten.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

D.G. werd gesteund door financiële middelen van het programma van de Universiteit van Texas Southwestern Medical Center van geleerden begiftigd. De auteurs bedanken Michael Whitt (de Universiteit van Tennessee Health Science Center) en Sean Whelan (Harvard Medical School) voor het aanbieden van VSV-DsRed en VSV-LUC. Gary Luker (medische faculteit van de Universiteit van Michigan) bedanken de auteurs ook voor de vriendelijke gift van de VACV-FL-GFP-stam.

Materials

Name Company Catalog Number Comments
6-well tissue culture plates CELLTREAT 229106
24-well tissue culture plates CELLTREAT 229124
10 cm tissue culture dishes Corning C430167
Grace’s Insect Medium Sigma G8142
EX-CELL 420 Sigma 14420C
Fetal Bovine Serum - Optima Atlanta Biologicals S12450
Growth medium 1:1 mixture of Grace's Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1% antibiotic-antimycotic solution and 10% Fetal bovine serum
Antibiotic-Antimycotic Solution (100×) Sigma A5955
Dulbecco’s Phosphate Buffered Saline (DPBS) Sigma D8662
Serum Free Media (SFM) Thermo Fisher 10902096
Cytosine arabinoside Sigma C1768
Transfection reagent Thermo Fisher 10362100
Corning cellgro DMSO (Dimethyl Sulfoxide) Corning 25950CQC
Reporter lysis buffer 5x Promega E3971
Luciferase Assay Reagent Promega E1483
96-Well Microplates Corning 3915
Mouse anti-FLAG antibody Wako 014-22383
Rabbit anti-firefly luciferase antibody Abcam ab21176
Mouse anti-actin antibody Sigma A2066
Mouse anti-VSV M N/A N/A Dr. John Connor (Boston University)
Mouse anti-VACV I3L N/A N/A Dr. David Evans (University of Alberta)
8-well Chambered dish Lab-Tek II 155409
Cell viability dye Thermo Fisher C12881
FLUOstar microplate reader BMG Labtech FLUOstar
Confocal microscope Olympus FV10i-LIV
Image analysis software Olympus v1.18 cellSens software
Eppendorf 5702 ventilated centrifuge Eppendorf 22628102
Odyssey Fc Infrared Imaging System Li-COR Biosciences Odyssey Fc
LD652 cells N/A N/A Dr. Basil Arif (Natural Resources Canada)
BSC-40 cells ATCC CRL-2761
BHK cells ATCC CCL-10
HeLa cells ATCC CCL-2
BSC-1 cells ATCC CCL-26
in vitro transcription and purification kit Thermo Fisher AM1626
PCR purification kit Qiagen 28104

DOWNLOAD MATERIALS LIST

References

  1. Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. Viral tropism. Frontiers in Microbiology. 3, 281 (2012).
  2. Werden, S. J., McFadden, G. The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus. Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784, (1), 228-237 (2008).
  3. McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. Cytokine determinants of viral tropism. Nature Reviews: Immunology. 9, (9), 645-655 (2009).
  4. Silva, J. M., et al. Second-generation shRNA libraries covering the mouse and human genomes. Nature Genetics. 37, (11), 1281-1288 (2005).
  5. Moffat, J., et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell. 124, (6), 1283-1298 (2006).
  6. Ma, D., Liu, F. Genome Editing and Its Applications in Model Organisms. Genomics Proteomics Bioinformatics. 13, (6), 336-344 (2015).
  7. Yin, H., Kauffman, K. J., Anderson, D. G. Delivery technologies for genome editing. Nature Reviews: Drug Discovery. 16, (6), 387-399 (2017).
  8. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, (7206), 890-893 (2008).
  9. Houzet, L., Jeang, K. T. Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis. Experimental Biology and Medicine. 236, (8), Maywood, NJ. 962-967 (2011).
  10. Marceau, C. D., et al. Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens. Nature. 535, (7610), 159-163 (2016).
  11. Savidis, G., et al. Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics. Cell Reports. 16, (1), 232-246 (2016).
  12. Panda, D., Cherry, S. Cell-based genomic screening: elucidating virus-host interactions. Current Opinion in Virology. 2, (6), 784-792 (2012).
  13. Gammon, D. B., et al. A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection. Elife. 3, (2014).
  14. Letchworth, G. J., Rodriguez, L. L., Del cbarrera,, J, Vesicular stomatitis. Veterinary Journal. 157, (3), 239-260 (1999).
  15. Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones. Proceedings of the National Academy of Sciences of the United States of America. 92, (18), 8388-8392 (1995).
  16. Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization. PLoS Pathogens. 5, (4), e1000394 (2009).
  17. Duntsch, C. D., et al. Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model. Journal of Neurosurgery. 100, (6), 1049-1059 (2004).
  18. Li, Y., Yuan, S., Moyer, R. W. The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus. Virology. 248, (1), 74-82 (1998).
  19. Seet, B. T., et al. Poxviruses and immune evasion. Annual Review of Immunology. 21, 377-423 (2003).
  20. Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. Preparation of Cell Cultures and Vaccinia Virus Stocks. Current Protocols in Microbiology. 39, 11-18 (2015).
  21. Andrei, G., et al. Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice. Journal of Virology. 80, (19), 9391-9401 (2006).
  22. Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. Preparation of recombinant vaccinia virus for expression of small GTPases. Methods in Enzymology. 174-188 (1995).
  23. Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection. Bio-Protocol. 7, (22), (2017).
  24. Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread. Virology. 341, (2), 284-300 (2005).
  25. Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. Vaccinia reporter viruses for quantifying viral function at all stages of gene expression. Journal of Visualizes Experiments. (87), e51522 (2014).
  26. Cao, C., et al. Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance. Pesticide Biochemistry and Physiology. 119, 54-61 (2015).
  27. Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis. PloS One. 8, (5), e61190 (2013).
  28. Sparks, M. E., Gundersen-Rindal, D. E. The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts. Viruses. 3, (11), 2339-2350 (2011).
  29. Lin, G., Li, G., Granados, R. R., Blissard, G. W. Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion. In Vitro Cellular & Developmental Biology - Animal. 37, (5), 293-302 (2001).
  30. Li, W. X., et al. Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing. Proceedings of the National Academy of Sciences of the United States of America. 101, (5), 1350-1355 (2004).
  31. Kanost, M. R., et al. Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta. Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).
  32. Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases. BMJ Global Health. 3, (2018).
Arbovirus infecties als Screening van hulpmiddelen voor de identificatie van de virale Immunomodulators en Host antivirale factoren
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).More

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter