Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

वायरल Immunomodulators और मेजबान एंटीवायरल कारकों की पहचान के लिए स्क्रीनिंग उपकरण के रूप में Arbovirus संक्रमण

doi: 10.3791/58244 Published: September 13, 2018

Summary

यहाँ, हम प्रोटोकॉल arbovirus प्रतिकृति और 2) eukaryotic होस्ट कारक arbovirus प्रतिकृति को प्रतिबंधित करें जो का प्रचार 1) वायरस एन्कोडेड immunomodulators की पहचान करने के लिए प्रस्तुत है । इन प्रतिदीप्ति-और luminescence आधारित तरीकों शोधकर्ताओं तेजी से कम संकेत करने के लिए शोर अनुपात के साथ सरलीकृत परख में arbovirus प्रतिकृति के मात्रात्मक readouts प्राप्त करने के लिए अनुमति देते हैं ।

Abstract

आरएनए हस्तक्षेप-और जीनोम संपादन-आधारित स्क्रीनिंग प्लेटफॉर्म व्यापक रूप से वायरस प्रतिकृति प्रतिबंधित होस्ट सेल कारकों की पहचान करने के लिए उपयोग किया गया है । हालांकि, इन स्क्रीन आमतौर पर अध्ययन के तहत वायरल रोगज़नक़ के लिए स्वाभाविक रूप से स्वतंत्र हैं कि कोशिकाओं में आयोजित की जाती हैं । इसलिए, संतुलित प्रतिकृति वायरस नियंत्रण स्थितियों में इन स्क्रीन की डायनेमिक श्रेणी सीमित हो सकता है । इसके अलावा, इन स्क्रीन आसानी से सेलुलर रक्षा रास्ते है कि वायरस प्रतिकृति प्रतिबंधित अगर वायरस अच्छी तरह से मेजबान के लिए अनुकूलित और एंटीवायरल गढ़ का मुकाबला करने में सक्षम है की पहचान करने में असमर्थ हो सकता है । इस अनुच्छेद में, हम स्क्रीन के उपयोग के माध्यम से वायरस मेजबान बातचीत की खोज के लिए एक नए प्रतिमान का वर्णन है कि arboviruses जैसे vesicular stomatitis वायरस (VSV) द्वारा स्वाभाविक रूप से सत्तासीन संक्रमण पर केंद्र । dipteran कीट और स्तनधारी मेजबान की एक विस्तृत श्रृंखला में दोहराने के लिए VSV की क्षमता के बावजूद, VSV इस तरह के जिप्सी कीट (lepidopteran असमानता) के रूप में Lymantria कीड़ों से व्युत्पंन सेल लाइनों की एक किस्म में एक के बाद प्रवेश, गर्भपात का एक प्रकार है । हालांकि, इन सत्तासीन VSV संक्रमण हो सकता है "बचाया" जब मेजबान सेल एंटीवायरल गढ़ से छेड़छाड़ कर रहे हैं । हम का वर्णन कैसे VSV उपभेदों सुविधाजनक रिपोर्टर जीन एंकोडिंग और प्रतिबंधक एल असमानता सेल लाइनों को स्थापित किया जा सकता है सेट अप स्क्रीन arbovirus प्रतिबंध में शामिल मेजबान कारकों की पहचान । इसके अलावा, हम भी वायरल इनकोडिंग कारकों की पहचान में इन स्क्रीनिंग उपकरण की उपयोगिता दिखाने के coinfection के दौरान या अस्थानिक अभिव्यक्ति के माध्यम से बचाव VSV प्रतिकृति, स्तनधारी वायरस द्वारा इनकोडिंग उन सहित । VSV प्रतिकृति के प्राकृतिक प्रतिबंध में L. असमानता कोशिकाओं एक उच्च संकेत करने के लिए शोर अनुपात प्रदान करता है जब शर्तों है कि VSV बचाव को बढ़ावा देने के लिए स्क्रीनिंग, इस प्रकार सरलीकृत luminescence के उपयोग को सक्षम करने और प्रतिदीप्ति-परख पर नजर रखने के आधार VSV प्रतिकृति में परिवर्तन । इन तरीकों में मेजबान एंटीवायरल प्रतिक्रियाओं और वायरल प्रतिरक्षा चोरी कारकों के बीच एक साथ खेलना समझने के लिए मूल्यवान हैं ।

Introduction

एक वायरस की क्षमता उत्पादक किसी विशेष होस्ट में दोहराने के लिए वायरल प्रविष्टि और प्रतिकृति1का समर्थन होस्ट सेल कारकों की उपलब्धता के द्वारा नियंत्रित भाग में है । वायरस-मेजबान रेंज भी एक वायरस की क्षमता से तय किया जा सकता है सेलुलर एंटीवायरल गढ़ है कि अंयथा वायरल प्रतिकृति2,3बाधा होगी काउंटर । यह इन जटिल वायरस-मेजबान बातचीत का परिणाम है कि अंततः तय है कि एक वायरस एक विशेष रूप से मेजबान में अपने जीवन चक्र को पूरा करने में सक्षम हो जाएगा है । होस्ट के लिए संभावित रोगजनक परिणामों को देखते हुए यदि वायरल प्रतिकृति मग्न है, यह महत्वपूर्ण है प्रयोगात्मक रणनीतियों को विकसित करने के लिए महत्वपूर्ण वायरस-मेजबान बातचीत है कि सत्तासीन और उत्पादक के बीच संतुलन टिप सकता है की हमारी समझ संक्रमण. Elucidating वायरस की आणविक सुविधाओं-मेजबान पुनरावृत्ति नए और वैकल्पिक एंटीवायरल चिकित्सकीय रणनीतियों के विकास में महत्वपूर्ण भूमिका निभाई होगी ।

आरएनए हस्तक्षेप (RNAi)4,5 और जीनोम-संपादन उपकरण के आगमन के साथ (जैसे, CRISPR-Cas9, जस्ता फिंगर nucleases, TALENs)6,7, यह परिवर्तन करने के लिए संभव हो गया है जीनोम-वाइड तराजू पर सेलुलर कारकों की अभिव्यक्ति और वायरस प्रतिकृति पर इन परिवर्तन के प्रभाव का पता लगाने । दरअसल, कई RNAi और जीनोम-संपादन आधारित स्क्रीन invertebrate और हड्डीवाला मेजबान सेल प्रकार है कि वायरस के नए पहलुओं का अनावरण किया है में आयोजित किया गया है-मेजबान बातचीत8,9,10, 11 , 12. इन स्क्रीन आमतौर पर ऐसे फायर फ्लाई luciferase (ल्यूक) या फ्लोरोसेंट प्रोटीन (जैसे, GFP, DsRed), कि मात्रात्मक एक readout के रूप में वायरल जीन अभिव्यक्ति का आकलन करने का सुविधाजनक साधन प्रदान करने के रूप में रिपोर्टर एंकोडिंग वायरस को रोजगार वायरल प्रतिकृति के लिए9,12। इस रणनीति के शोधकर्ताओं मेजबान कारकों की पहचान करने के लिए अनुमति देता है कि या तो को बढ़ावा देने या बढ़ जाती है या घट जाती है, क्रमशः, वायरल रिपोर्टर संकेत9,12द्वारा सबूत के रूप में वायरल प्रतिकृति antagonize । हालांकि, मामलों की विशाल बहुमत में, इन स्क्रीन वायरस है कि मेजबान सेल प्रकार है जिसमें वे अध्ययन किया जा रहा है के लिए अच्छी तरह से अनुकूलित कर रहे है का उपयोग कर आयोजित किया गया है । हालांकि इस रणनीति वायरल रोगजनकों और उनके प्राकृतिक मेजबानों के बीच coevolutionary रिश्तों को समझने के लिए महत्वपूर्ण हो सकता है, यह मौलिक मेजबान एंटीवायरल कारकों में उनके उपयोग के बारे में चिंताओं मुद्रा करता है । इन मामलों में, RNAi पछाड़ना पर वायरस रिपोर्टर संकेत में एक वृद्धि के लिए देखा जा रहा है, या एक सेलुलर कारक है कि आम तौर पर वायरल प्रतिकृति बाधा उत्पंन की निष्क्रियता । पहले, अगर एक वायरस पहले से ही मजबूती से मेजबान सेल में दोहराने में सक्षम है नियंत्रण शर्तों के तहत जांच की जा रही है, स्क्रीन के गतिशील रेंज (यानी, पृष्ठभूमि और बढ़ाया वायरल रिपोर्टर संकेतों के बीच अंतर करने की क्षमता) सीमित हो सकता है । दूसरा, इस मुद्दे को और अधिक परिस्थितियों में वायरस मेजबान सेल के लिए अच्छी तरह से अनुकूलित है और मेजबान रक्षा रास्ते है कि स्क्रीन में लक्षित किया जा रहा है काउंटर पर प्रभावी द्वारा जटिल है ।

पारंपरिक वायरस-मेजबान संपर्क स्क्रीनिंग तरीकों के बारे में उपरोक्त चिंताओं के कारण, हम वायरस मेजबान बातचीत का अध्ययन है कि lepidopteran कीट कोशिकाओं में स्वाभाविक रूप से सत्तासीन arbovirus संक्रमण का दोहन करने के लिए एक नए प्रतिमान विकसित की है । इस रणनीति के एक अवलोकन से निकला है कि अच्छी तरह से अध्ययन मानव arbovirus, VSV, जिप्सी कीट (एल. असमानता)13से व्युत्पंन कोशिकाओं में एक सत्तासीन संक्रमण से गुजरता है । VSV स्वाभाविक रूप से स्तनधारी मेजबान के लिए dipteran कीड़ों (यानी, रेत मक्खियों) द्वारा फैलता है, और invertebrate और हड्डीवाला दोनों सेल संस्कृति में और vivo14में मेजबान की एक विस्तृत श्रृंखला को संक्रमित करने के लिए प्रयोग किया गया है दिखाया गया है । 11 केबी नकारात्मक भावना एकल-असहाय आरएनए जीनोम VSV encodes के पांच subgenomic mRNAs है कि प्रत्येक में अनुवाद कर रहे है प्रोटीन है कि ऊपर ढंक विरिअन बनाते हैं । हालांकि, VSV रिवर्स आनुवंशिक प्रणालियों प्रतिकृति सक्षम उपभेदों ल्यूक या फ्लोरोसेंट प्रोटीन के निर्माण के लिए अनुमति दी है, पांच प्राकृतिक VSV जीन उत्पादों के अलावा15,16,17। क्योंकि इन रिपोर्टर प्रोटीन VSV विरिअन में शामिल नहीं हैं, वे VSV जीन अभिव्यक्ति के लिए एक सुविधाजनक readout है कि पोस्ट-एंट्री होती है प्रदान करते हैं । GFP या ल्यूक कूटबंधन VSV उपभेदों का उपयोग करना, हम पहले से पता चला है कि VSV जीन अभिव्यक्ति गंभीर LD652 कोशिकाओं के प्रवेश पर प्रतिबंधित है और कि VSV titers ७२ घंटे के बाद संक्रमण (hpi) से वृद्धि नहीं है । इसके विपरीत, VSV के साथ LD652 कोशिकाओं के coinfection और स्तनधारी poxvirus, vaccinia वायरस (VACV), इस समय बिंदु द्वारा दोनों VSV जीन अभिव्यक्ति और titers में लघुगणकीय वृद्धि की ओर जाता है. VACV जल्दी जीन अभिव्यक्ति, डीएनए प्रतिकृति, और LD652 कोशिका संक्रमण में देर जीन अभिव्यक्ति है, लेकिन VACV प्रतिकृति चक्र अंत में अपूर्ण विरिअन morphogenesis18के कारण सत्तासीन है । बड़े ~ १९२-केबी VACV encodes के डीएनए जीनोम > २०० प्रोटीन, जिनमें से कई इम्यूनोमॉड्यूलेटरी गुण है कि मेजबान प्रतिरक्षा प्रतिक्रियाओं19के दमन के माध्यम से वायरल प्रतिकृति को बढ़ावा देने के प्रदर्शन । इसलिए, हम की कल्पना की है कि "बचाव" VACV coinfection द्वारा LD652 कोशिकाओं में VSV प्रतिकृति की संभावना VACV immunomodulators है कि बाधा एल द्वारा मध्यस्थता था कि आम तौर पर VSV प्रतिकृति सीमित प्रतिक्रियाओं इस के समर्थन में, मेजबान आरएनए पोलीमरेज़ द्वितीय अवरोधक actinomycin डी के साथ LD652 कोशिकाओं का उपचार भी VSV प्रतिकृति LD652 कोशिकाओं में बचाता है, यह दर्शाता है कि प्रतिलेखन-निर्भर मेजबान प्रतिक्रियाओं ब्लॉक VSV प्रतिकृति पोस्ट-प्रविष्टि13.

उपरोक्त टिप्पणियों का सुझाव है कि स्वाभाविक रूप से प्रतिबंधात्मक प्रकृति LD652 कोशिकाओं VSV संक्रमण के लिए एक अपेक्षाकृत कम पृष्ठभूमि प्रदान कर सकता है जब शर्तों कि VSV-इनकोडिंग रिपोर्टर संकेतों को बढ़ाने के लिए स्क्रीनिंग (यानी, उन है कि मेजबान को बाधित एंटीवायरल ठोंकी). यहां, हम प्रतिदीप्ति या ल्यूक-आधारित परख का उपयोग करने के लिए शर्तों के लिए स्क्रीन है कि lepidopteran कोशिकाओं में VSV प्रतिबंध से राहत देने के लिए तरीके प्रदान करते हैं । सबसे पहले, हम बताते है कि कैसे इन परख को वायरल इनकोडिंग इम्यूनोमॉड्यूलेटरी कारकों की पहचान है कि या तो coinfection प्रयोगों के दौरान या उंमीदवार वायरल कारकों की अस्थानिक अभिव्यक्ति के माध्यम से VSV प्रतिबंध तोड़ने के लिए इस्तेमाल किया जा सकता है । एक उदाहरण के रूप में, हम वर्णन कैसे हम इन स्क्रीनिंग तकनीक का इस्तेमाल इम्यूनोमॉड्यूलेटरी कारकों का एक नया परिवार के रूप में poxvirus इनकोडिंग A51R प्रोटीन की पहचान है कि बचाव अंय poxvirus कारकों13के अभाव में VSV प्रतिकृति । दूसरा, हम कैसे प्रतिबंधात्मक VSV-LD652 सेल संक्रमण में RNAi स्क्रीनिंग को सीधे arbovirus प्रतिबंध13में शामिल eukaryotic मेजबान कारकों की पहचान करने के लिए इस्तेमाल किया जा सकता है वर्णन ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. जनरल Lymantria असमानता (LD652) सेल और वायरस संस्कृति

  1. LD652 सेल संवर्धन और चढ़ाना
    1. संस्कृति के लिए एल असमानता-व्युत्पंन LD652 कोशिकाओं, एक विकास के माध्यम (सामग्री की मेज) में कोशिकाओं के एक monolayer बनाए रखने के सामांय वातावरण के तहत 27 डिग्री सेल्सियस पर मशीन । 10 सेमी ऊतक में कोशिकाओं को बनाए रखने-संस्कृति-व्यंजन का इलाज किया और ८०% तक पहुंचने पर कोशिकाओं पारित करने के लिए प्रवाह ।
    2. थाली करने के लिए, अनुयाई LD652 कोशिकाओं से pipetting मीडिया बार monolayer (इन कोशिकाओं को बेदखल करने के लिए trypsinization की आवश्यकता नहीं है) पर, और विकास मीडिया में नमूना 1 एक्स 105 कोशिकाओं की एक अनुमानित घनत्व को पतला/ पतला संस्कृति के पिपेट 1 मिलीलीटर/अच्छी तरह से एक 24-खैर प्लेट की । बीज प्रत्येक समय बिंदु के लिए तीन दोहराने कुओं/उपचार प्रकार की एक ंयूनतम (आठ उपचार की एक अधिकतम/
    3. कक्षों को ंयूनतम 1 h के लिए व्यवस्थित करने की अनुमति दें ।
  2. Vaccinia वायरस की तैयारी
    1. VACV के स्टॉक्स तैयार करने के लिए, हेला कोशिकाओं में वायरस को बढ़ाना20 या अफ्रीकी ग्रीन बंदर गुर्दे की कोशिकाओं (बीएससी-1 या बीएससी-४० कोशिकाओं)20,21,22.
      नोट: VACV तनाव वेस्टर्न रिजर्व (VACV-WR) यहां वर्णित परख में अच्छी तरह से काम करता है ।
    2. अनुमापन ने बीएससी-1 या बीएससी-४० कक्षों पर पट्टिका परख के जरिए VACV तनाव को20,22.
      नोट: सभी संकेत VACV संक्रमण की बहुलता (MOI) LD652 कोशिका संक्रमण के लिए यहां वर्णित बीएससी-४० पट्टिका परख से प्राप्त titers पर आधारित हैं ।
  3. Vesicular stomatitis वायरस वडा
    1. VSV स्टॉक्स तैयार करने के लिए, बीएचके कोशिकाओं में वायरस को बढ़ाना23.
    2. अनुमापन VSV ने बीएससी-४० या बीएचके सेल monolayers13,23पर पट्टिका परख की ।
      नोट: सभी VSV MOIs LD652 कोशिका संक्रमण के लिए यहां वर्णित बीएससी-४० पट्टिका परख से प्राप्त titers पर आधारित हैं ।

2. प्रतिदीप्ति-आधारित VSV बचाव परख सह संक्रमण और लाइव सेल इमेजिंग का उपयोग

  1. सीडिंग और LD652 कोशिकाओं का संक्रमण
    1. प्लेट ४०,००० LD652 कोशिकाओं एक 8 अच्छी तरह से चैंबर के/
    2. प्रतिदीप्ति के लिए लाइव सेल इमेजिंग आधारित, VSV फ्लोरोसेंट प्रोटीन एंकोडिंग उपभेदों का उपयोग करें । यहां प्रस्तुत प्रयोगों VSV-DsRed17, एक रिकॉमबिनेंट VSV तनाव है कि मुक्त DsRed प्रोटीन है कि किसी भी अंय VSV प्रोटीन से जुड़े नहीं व्यक्त करता है का उपयोग करें ।
      नोट: LD652 कोशिकाओं के VSV संक्रमण ९६ hpi द्वारा cytopathic नहीं है और, इस प्रकार, कोशिका मृत्यु इस समय सीमा के भीतर VSV प्रतिकृति का मूल्यांकन करते समय एक निराधार कारक नहीं है ।
    3. एक सीरम मुक्त मीडिया में VSV-DsRed और VACV-FL-GFP तैयार (SFM; सामग्री की तालिका) 1 और 25 के एक MOI पर क्रमशः ।
      नोट: VACV-FL-GFP एक रिकॉमबिनेंट VACV तनाव है कि ल्यूक और GFP24के बीच एक संलयन व्यक्त करता है । VACV उपभेदों के लिए 25 या इससे अधिक की एक MOI का उपयोग सुनिश्चित करता है कि सभी LD652 कोशिकाओं13संक्रमित हैं । यदि एक अलग coinfecting वायरस का उपयोग कर, MOI उपयोगकर्ता द्वारा empirically निर्धारित किया जाना होगा । प्रत्येक संक्रमण उपचार नकली कुओं में स्थापित किया जाना चाहिए और नकली संक्रमित उपचार जिसमें केवल SFM कोशिकाओं को जोड़ा जाता है शामिल हैं ।
    4. 27 डिग्री सेल्सियस पर 2 घंटे के लिए इनोक्युलम के ०.२ मिलीलीटर में कोशिकाओं को मशीन ।
    5. कोशिकाओं को धोकर ग्रोथ मीडिया के ०.५ एमएल/
    6. 27 डिग्री सेल्सियस पर ४५ मिनट के लिए विकास मीडिया में सेल व्यवहार्यता डाई (सामग्री की तालिका) के 25 माइक्रोन में कोशिकाओं की मशीन ।
    7. मीडिया को महाप्राण और ०.५ मिलीलीटर के साथ कुओं को धो दें/
    8. वृद्धि मीडिया के ०.३ मिलीलीटर में कोशिकाओं को बनाए रखने/
  2. लाइव सेल छवि कैप्चरिंग
    1. एक फोकल माइक्रोस्कोप पर मुड़ें 30 अग्रिम में मिनट और एक 8-अच्छी तरह से चैंबर डिश लोड ।
      नोट: LD652 कोशिकाओं 20-25 डिग्री सेल्सियस से लेकर कमरे के तापमान पर imaged किया जा सकता है, लेकिन इष्टतम स्थितियों के लिए, कमरे का तापमान 27 डिग्री सेल्सियस के लिए समायोजित किया जाना चाहिए ।
    2. प्रत्येक फ्लोरोसेंट मार्कर प्रोटीन के लिए उपयुक्त उत्तेजना/उत्सर्जन सेटिंग्स की स्थापना की, साथ ही साथ चरण इसके विपरीत छवि सेटिंग्स ।
    3. प्रत्येक चैनल के लिए लेजर तीव्रता समायोजित करें ।
      नोट: यह एक पायलट प्रयोग चल फ्लोरोसेंट संकेत तीव्रता की सीमा निर्धारित करने के लिए समय पाठ्यक्रम भर में मनाया अंतिम प्रयोग में इस्तेमाल किया जा सकता है की आवश्यकता हो सकती है ।
    4. 10x उद्देश्य का उपयोग करना, एक अच्छी तरह से हर 1 के चरण इसके विपरीत और प्रतिदीप्ति छवियों पर कब्जा-एक वांछित समय बिंदु तक संक्रमण की अवधि के लिए 5 ज (उदा, 48-72 hpi) ।
      नोट: यह एक अच्छी तरह से देखने के कई क्षेत्रों पर कब्जा करने के लिए सही संस्कृति भर में संक्रमण की दर का अनुमान महत्वपूर्ण है ।
  3. छवि विश्लेषण
    1. उपयुक्त फ्लोरोसेंट चैनलों की स्वचालित छवि विश्लेषण के लिए छवि विश्लेषण सॉफ्टवेयर का प्रयोग करें (जैसे, ४०५ एनएम, ४८८ एनएम, ५६८ एनएम) ।
    2. कोशिकाओं है कि संक्रमित कर रहे है के प्रतिशत की गणना करने के लिए, VSV संक्रमण का संकेत फ्लोरोसेंट कोशिकाओं की कुल संख्या में विभाजित (उदाहरणके लिए, DsRed-VSV-DsRed संक्रमण के लिए सकारात्मक कोशिकाओं) व्यवहार्य कोशिकाओं के लिए सेल व्यवहार्यता डाई द्वारा लेबल की कुल संख्या से सभी उपचार भर में देखने के प्रत्येक क्षेत्र ।

3. LD652 कोशिकाओं में Luminescence-आधारित VSV बचाव परख के लिए जनरल वायरल संक्रमण प्रोटोकॉल

  1. इनोक्युलम की तैयारी
    1. 30 मिनट संक्रमण से पहले, VSV के स्टॉक गल-ल्यूक16 (एक रिकॉमबिनेंट VSV तनाव है कि मुक्त जुगनू luciferase प्रोटीन व्यक्त किसी भी अंय VSV प्रोटीन से जुड़े नहीं) । VACV coinfection के दौरान VSV-ल्यूक बचाव के लिए अगर परख, भी बर्फ पर VACV-WR वायरस गल ।
      नोट: अंय वायरस (इसके अलावा VACV-WR) coinfection के दौरान VSV-ल्यूक बचाव कर सकते हैं, लेकिन यह प्रत्येक उपयोगकर्ता द्वारा empirically निर्धारित किया जाना होगा ।
    2. कमजोर VSV-ल्यूक में उपस्थिति या VACV-WR के अभाव में इनोक्युलम द्वारा तैयार इस तरह कि एक MOI के 10 और 25, क्रमशः हासिल की है जब ०.२ मिलीलीटर की कुल इनोक्युलम मात्रा जोड़ने/
  2. कोशिकाओं के संक्रमण
    1. महाप्राण परिपक्व LD652 मीडिया सावधानी से परेशान करने से बचने के लिए monolayer और inoculate के साथ ०.२ मिलीलीटर वायरस/ इस समय 0 hpi के रूप में परिभाषित है । अतिरिक्त कुओं को बाँझ SFM जोड़ें के रूप में सेवा करने के लिए "नकली संक्रमित" नकारात्मक नियंत्रण उपचार ।
    2. इनोक्युलम में 27 डिग्री सेल्सियस पर 2 घंटे के लिए कोशिकाओं की मशीन ।
    3. 2 hpi पर, आकांक्षा द्वारा इनोक्युलम निकालें और 1 मिलीलीटर/अच्छी तरह से LD652 विकास मीडिया के साथ बदलें ।
    4. संक्रमण की अनुमति 24-72 hpi आगे बढ़ना है ।

4. Luciferase परख

  1. सेल lysates की तैयारी
    1. ध्यान से महाप्राण को supernatant और Dulbecco के फॉस्फेट-बफ़र्ड खारा (DPBS) के 1 मिलीलीटर जोड़ें/well.
    2. एक 1 मिलीलीटर सिरिंज के गोताख़ोर का उपयोग करना, DPBS में कोशिकाओं परिमार्जन.
    3. एक microcentrifuge ट्यूब करने के लिए कोशिकाओं स्थानांतरण, और 4 डिग्री सेल्सियस पर 20 मिनट के लिए ४०० x g पर केंद्रापसारक ।
    4. इस बीच, के 1x कमजोर पड़ने की तैयारी 5x रिपोर्टर lysis बफर (RLB) बाँझ एच2ओ में ।
    5. केंद्रापसारक के बाद, सेल गोली परेशान बिना DPBS महाप्राण ।
    6. 1x RLB के १५० µ एल में प्रत्येक गोली resuspend ।
    7. फ्रीज-गल नमूने 1x एक-८० डिग्री सेल्सियस में एक 5 मिन मशीन का उपयोग कर एक कमरे के तापमान पानी स्नान में तेजी से गल के बाद फ्रीजर । lysates पर स्टोर-८० ° c विश्लेषण करने के लिए तैयार जब तक ।
  2. Luciferase परख
    1. बर्फ पर lysates गल जाए.
    2. पिपेट 20 μL lysate के एक कुआं में एक ठोस काले या सफेद ९६-अच्छी तरह से microplate ।
    3. एक अच्छी तरह से करने के लिए luciferase परख एजेंट के १०० μL जोड़ें ।
    4. तुरंत एक luminometer का उपयोग प्रकाश तीव्रता को मापने (विशिष्ट luminometers के लिए उपयुक्त सेटिंग्स उपयोगकर्ता द्वारा empirically निर्धारित किया जाना होगा) ।
  3. Luciferase परख विश्लेषण
    1. नियंत्रण उपचार (प्रतिनिधि परिणाम) से प्राप्त लू रीडिंग करने के लिए प्रत्येक उपचार के लिए लू संकेतों को सामान्य. के बाद कम से तीन स्वतंत्र प्रयोगों प्रदर्शन किया गया है, प्रत्येक उपचार/नियंत्रण समूह से प्राप्त मतलब लू उचित सांख्यिकीय परीक्षणों द्वारा विश्लेषण किया जा सकता है ।

5. Immunoblot

  1. उपयोग lysates एसडीएस के लिए ल्यूक परख के लिए निकाले-पृष्ठ और बाद में immunoblotting, उपयुक्त रिएजेंट और इंस्ट्रूमेंटेशन का उपयोग कर ।

6. LD652 कोशिका संस्कृतियों से VSV का Titer

  1. १.१ चरण के अनुसार प्लेट LD652 कोशिकाओं ।
  2. वायरल कोशिकाओं को संक्रमित चरण 3 के अनुसार ।
  3. वांछित समय बिंदुओं पर, बाँझ microcentrifuge ट्यूबों में supernatants इकट्ठा.
  4. 4 डिग्री सेल्सियस पर 10 मिनट के लिए १,००० x g का उपयोग कर कोशिकाओं गोली और नए ट्यूबों के लिए supernatants हस्तांतरण ।
  5. supernatants-८० डिग्री सेल्सियस पर स्टोर या बीएससी-४० कोशिकाओं पर पट्टिका परख द्वारा अनुमापन के साथ आगे बढ़ना ।
    नोट: यदि titrating VACV निहित LD652 सेल संस्कृतियों से VSV, यह १०० μg/एमएल cytosine arabinoside (AraC) जोड़ने के लिए सलाह दी जाती है 2 hpi के भीतर बीएससी-४० संस्कृति मीडिया के लिए, बीएससी-४० VACV13पर पट्टिकाओं के गठन से अवशिष्ट monolayers कणों को रोकने के लिए । AraC एक वायरल डीएनए पोलीमरेज़ अवरोध करनेवाला है कि ब्लॉक VACV डीएनए प्रतिकृति25 लेकिन VSV प्रतिकृति को प्रभावित नहीं करता है ।

7. LD652 कोशिकाओं में Luminescence-आधारित VSV बचाव परख के रूपांतरों: RNAi और प्लाज्मिड अभिकर्मक प्रयोगों

  1. वायरल या मेजबान टेप के RNAi-मध्यस्थता पछाड़ना के लिए dsRNA की तैयारी
    1. डिजाइन जीन विशिष्ट T7 प्रवर्तक अनुक्रम (TAATACGACTCACTATAGGG) के साथ 5 ' अंत में पूंछ या तो coinfecting वायरस (जैसे, VACV) या एल ब्याज की असमानता mRNA टेप लक्ष्य है । इन प्राइमरों को प्रभावी RNAi-मध्यस्थता पछाड़ना के लिए 400 – 600 बीपी की पीसीआर उत्पाद का उत्पादन करना चाहिए । गैमन एट अल देखें । पछाड़ना VACV या एल के लिए नीचे इस्तेमाल किया प्राइमर दृश्यों के लिए 13 dsRNA द्वारा LD652 कोशिकाओं में मध्यस्थता RNAi द्वारा ...
      नोट: एल असमानता mRNA टेप प्रकाशित से पहचाना जा सकता है l. असमानता transcriptome डेटाबेस26,27,28
    2. RT-पीसीआर के माध्यम से एक डीएनए टेम्पलेट उत्पन्न (सीडीएनए संश्लेषण: 30 मिनट के लिए ५० ° c के 1 चक्र; पीसीआर: ४० चक्र के लिए ९४ ° c के लिए 15 s, ५० ° c के लिए 30 s, और ६८ ° c के लिए ४५ s प्रत्येक).
    3. पीसीआर शुद्धिकरण किट का इस्तेमाल कर पीसीआर प्रोडक्ट को शुद्ध करे ।
    4. एक टेम्पलेट के रूप में शुद्ध पीसीआर उत्पाद का उपयोग करना, इन विट्रो में टाइप करना और शुद्ध dsRNA एक इन विट्रो प्रतिलेखन और शुद्धि किट का उपयोग कर.
  2. LD652 कोशिकाओं में dsRNA या प्लाज्मिड डीएनए की अभिकर्मक
    1. बीज 1 x 105 कोशिकाओं के/अच्छी तरह से एक 24-खैर प्लेट और दो कोशिकाओं के लिए व्यवस्थित कम 1 ज ।
    2. के लिए एक अच्छी तरह से transfected हो, अभिकर्मक एजेंट के 4 μL SFM के १०० μL में पतला । कमरे के तापमान पर 15 मिनट के लिए मशीन । यह सभी transfections के लिए एक मास्टर मिश्रण करने के लिए किया जा करने के लिए स्केल किया जा सकता है ।
    3. एक अच्छी तरह से transfected के लिए dsRNA या SFM के १०० μL के साथ कुल प्लाज्मिड डीएनए के 1 μg को पतला । कमरे के तापमान पर 15 मिनट के लिए मशीन ।
      नोट: हम पहले पाया है कि dsRNA के 1 μg के एक अभिकर्मक/105 LD652 कोशिकाओं के लिए पर्याप्त है > 80% या तो वायरल या मेजबान टेप13के पछाड़ना, लेकिन dsRNA खुराक के लिए आवश्यक संशोधित प्रयोगात्मक सेट अप/ empirically निर्धारित किया जाए ।
    4. एक 1:1 अनुपात के साथ अभिकर्मक रिएजेंट और dsRNA/प्लाज्मिड डीएनए कमजोरियां गठबंधन (जैसे, १०० पतला dsRNA के μL के साथ मिलाया जाता है μL पतला अभिकर्मक के १०० के साथ मिश्रित है) और कमरे के तापमान पर 20 मिनट के लिए मशीन ।
    5. इस बीच, 1 मिलीलीटर के साथ कुएं धो/sfm के ठीक है, और फिर एक अच्छी तरह से sfm के ५०० μL जोड़ें ।
    6. धीरे अभिकर्मक रिएजेंट dsRNA (या प्लाज्मिड डीएनए) मिश्रण dropwise में एक अच्छी तरह से जोड़ें ।
    7. 5 एच के लिए कोशिकाओं के साथ अभिकर्मक एजेंट की मशीन ।
      1. RNAi प्रयोगों के लिए एक coinfecting वायरस (जैसे, VACV) द्वारा इनकोडिंग टेप के पछाड़ना को शामिल करने के लिए, अभिकर्मक-अभिकर्मक युक्त वायरस इनोक्युलम के साथ 5-h VSV गर्मी की अवधि के बाद (या के साथ या बिना ल्यूक एजेंट की जगह एक अंय coinfecting वायरस) (चरण 3) । इसके बाद, पूर्ण विकास मीडिया 2 hpi के साथ VSV-ल्यूक युक्त वायरस इनोक्युलम को प्रतिस्थापित करें । ल्यूक परख (चरण 4) तो निकाली lysates पर विभिंन समय अंक पर प्रदर्शन किया जा सकता है निर्धारित करने के लिए यदि coinfecting वायरस टेप के पछाड़ना VSV-ल्यूक बचाव का नुकसान होता है ।
      2. RNAi के लिए RNAi के साथ एल असमानता टेप शामिल प्रयोगों, पूर्ण विकास मीडिया के साथ अभिकर्मक मिश्रण की जगह और पछाड़ना 24 के लिए पीछा करने के लिए VSV-ल्यूक (4 कदम) के साथ संक्रमण से पहले की अनुमति । ल्यूक परख (4 कदम) तो निकाली lysates पर विभिंन समय अंक पर प्रदर्शन किया जा सकता है निर्धारित करने के लिए अगर एल के पछाड़ना का टेप VSV-ल्यूक बचाव को बढ़ावा देता है ।
      3. प्लाज्मिड अभिव्यक्ति वैक्टर उंमीदवार immunomodulators व्यक्त की transfections शामिल प्रयोगों के लिए, अभिकर्मक रिएजेंट की जगह और 24 एच के लिए प्रोटीन अभिव्यक्ति के लिए अनुमति देने के लिए VSV-ल्यूक (चरण 4) के साथ संक्रमण से पहले । ल्यूक परख (4 कदम) तो विभिंन समय अंक पर निकाले lysates पर प्रदर्शन किया जा सकता है अगर उंमीदवार इम्यूनोमॉड्यूलेटरी प्रोटीन की अभिव्यक्ति VSV-ल्यूक बचाव को बढ़ावा देता है निर्धारित करते हैं ।
        नोट: अभिकर्मक शर्तों 40-60%13की अभिकर्मक क्षमता में प्लाज्मिड डीएनए परिणाम के 1 μg/

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

लाइव सेल इमेजिंग अनुप्रयोगों के एक उदाहरण के रूप में VACV coinfection पर VSV बचाव की निगरानी के लिए, LD652 कोशिकाओं को एक 8 अच्छी तरह से चैम्बर्ड पकवान में चढ़ाया और फिर नकली संक्रमित या VSV-DsRed (MOI = 1) की उपस्थिति या अनुपस्थिति में VACV-FL-GFP (MOI = 25) के साथ संक्रमित थे । क्योंकि VSV-DsRed एक मुक्त प्रोटीन के रूप में DsRed व्यक्त करता है और संरचनात्मक VSV प्रोटीन (आंकड़ा 1a) के लिए जुड़े नहीं है, यह केवल VSV प्रवेश और जीन अभिव्यक्ति शुरू होने के बाद पता चला है । सभी कोशिकाओं को फिर सेल व्यवहार्यता डाई कि स्वतंत्र रूप से कोशिकाओं की प्लाज्मा झिल्ली, जहां यह एक झिल्ली में परिवर्तित-impermeant उत्पाद है, जो लेबल कोशिकाओं में फ्लोरोसेंट संकेत की अवधारण को बढ़ावा देता है के माध्यम से गुजरता है के साथ लेबल थे । छवियां हर 5 ज ६५ hpi को अधिग्रहीत किया गया, ४०५ एनएम, ४८८ एनएम, ५६८ एनएम, और सफेद प्रकाश फिल्टर का उपयोग करने के लिए सेल व्यवहार्यता डाई, VACV-FL-GFP, VSV-DsRed, और चरण कंट्रास्ट (पीसी) चैनल, क्रमशः कब्जा । एकल संक्रमण स्थितियों के अंतर्गत, LD652 कक्ष VSV-DsRed प्रतिकृति को प्रतिबंधित करते हैं; इसलिए, केवल एक छोटी संख्या में कक्षों का प्रदर्शन एक DsRed संकेत । हालांकि, coinfection के VSV-DsRed के साथ VACV-FL-GFP परिणाम समय पाठ्यक्रम के अंत तक DsRed संकेतों को प्रदर्शित अधिकांश कोशिकाओं में (आंकड़ा 1b). हर समय बिंदु पर कब्जा कर लिया छवियां छवि विश्लेषण सॉफ्टवेयर, जहां ४०५ एनएम और ५६८ एनएम चैनल छवियों को स्वचालित रूप से कुल और DsRed-सकारात्मक कोशिका संख्या, क्रमशः निर्धारित करने के लिए इस्तेमाल किया गया के अधीन थे । प्रत्येक उपचार के लिए एक DsRed संकेत प्रदर्शित कोशिकाओं का प्रतिशत वस्तुओं (कोशिकाओं) ५६८-एनएम चैनल में एक सकारात्मक संकेत के साथ विभाजित करके गणना की है ४०५ एनएम चैनल में हर समय बिंदु के लिए, १००% गुणा द्वारा पीछा के लिए वस्तुओं की संख्या से . के रूप में चित्रा 1Cमें दिखाया गया है, ~ VSV-DsRed एकल संक्रमण से कोशिकाओं के 2% DsRed-६५ hpi द्वारा सकारात्मक थे । इसके विपरीत, ~ VSV में कोशिकाओं के ७७%-DsRed + VACV-FL-GFP coinfections इस समय बिंदु पर DsRed-सकारात्मक थे । फिल्म s और S2 के VSV-DsRed संक्रमण की प्रगति एक संक्रमण और coinfection परिस्थितियों में पूरे ६५-h समय पाठ्यक्रम पर, क्रमशः दिखाते हैं । यह नोट करने के लिए महत्वपूर्ण है कि VACV द्वारा GFP अभिव्यक्ति-FL-GFP 10 hpi द्वारा detectable बन गया, DsRed संकेत करने से पहले, यह दर्शाता है कि पर्याप्त VACV जीन अभिव्यक्ति VSV-DsRed बचाव के लिए पहले की आवश्यकता है (नहीं दिखाया गया है). सामूहिक रूप से, इन परिणामों को स्पष्ट रूप से VACV coinfection द्वारा VSV-DsRed प्रतिकृति के बचाव का संकेत है । एक coinfecting वायरस VSV-DsRed बचाव करने में असमर्थ था, तो हम एकल संक्रमण और coinfection उपचार के बीच DsRed पॉजिटिव कोशिकाओं के बराबर प्रतिशत की उम्मीद है ।

LD652 कोशिकाओं में VSV प्रतिकृति वैकल्पिक रूप से VSV-ल्यूक उपभेदों (चित्रा 2a) का उपयोग करते समय luminescence आधारित परख का उपयोग quantified जा सकता है । एक उदाहरण के रूप में, चित्रा बी 8 नकली संक्रमित कोशिकाओं या VSV-ल्यूक (MOI = 10) की उपस्थिति या अनुपस्थिति में VACV-WR (MOI = 25) से संक्रमित कोशिकाओं से एक ७२ एच समय पाठ्यक्रम पर तैयार lysates का उपयोग कर एक ल्यूक परख के परिणाम से पता चलता है । VSV-ल्यूक प्रतिकृति के एक सकारात्मक बचाव coinfected कोशिकाओं से तैयार lysates के साथ मनमाना लू का पता चला में लघुगणकीय वृद्धि से संकेत दिया है, एकल lysates-VSV संक्रमण से ल्यूक की तुलना में. एक नकारात्मक परिणाम इस परख में एक coinfection की विफलता से संकेत दिया जाएगा एक VSV-ल्यूक संक्रमण उपचार में मनाया उन से लू रीडिंग बदलने के लिए । यदि वांछित, तैयार lysates भी immunoblotting के लिए इस्तेमाल किया जा सकता है coinfection उपचार में बढ़ाया VSV जीन अभिव्यक्ति की पुष्टि करने के लिए । उदाहरण के लिए, आकृति 2c VSV-एनकोडेड ल्यूक और मैट्रिक्स (M) के लिए एक विशिष्ट immunoblot परिणाम दिखाता है lysates में प्रोटीन से तैयार नकली-, VSV-ल्यूक, और VSV-ल्यूक + VACV-WR उपचार ७२ hpi । VACV संक्रमण के एक मार्कर के रूप में सेवा VACV I3L प्रोटीन के लिए Immunoblotting, और सेलुलर Immunoblotting के लिए actin एक लोडिंग नियंत्रण के रूप में इस्तेमाल किया गया था । coinfection में VSV इनकोडिंग ल्यूक और एम प्रोटीन की स्पष्ट वृद्धि lysates आगे VSV द्वारा VACV बचाव की पुष्टि करें । अंत में, उत्पादक VSV प्रतिकृति इन LD652 सेल संस्कृतियों से supernatants इकट्ठा करने और बीएससी-४० monolayers (चित्रा 2d) पर एक संक्रामक वायरस titrating द्वारा पुष्टि की जा सकती है । यह परिणाम केवल VACV coinfection के दौरान VSV उत्पादक प्रतिकृति करता है कि दिखाता है ।

एक बार एक coinfecting वायरस LD652 कोशिकाओं में VSV प्रतिकृति बचाव करने में सक्षम दिखाया गया है, RNAi स्क्रीनिंग coinfecting वायरस है कि VSV बचाव के लिए योगदान द्वारा इनकोडिंग कारकों की पहचान करने के लिए इस्तेमाल किया जा सकता है । इस प्रयोग में, एक RNAi शर्त के लिए स्क्रीन है कि एक बचाव वायरस के साथ VSV-ल्यूक coinfection के दौरान phenotype के एक "नुकसान" की ओर जाता है । हम पहले VACV के दर्जनों के एक RNAi स्क्रीनिंग के माध्यम से एक VSV बचाव कारक के रूप में VACV A51R प्रोटीन की पहचान-इनकोडिंग टेप13। एक उदाहरण के रूप में, हम इस स्क्रीन (चित्रा 3) के एक छोटे पैमाने पर संस्करण recapitulated है । RNAi में अभिकर्मक द्वारा मध्यस्थता है dsRNAs प्रतिलिखित कि लक्ष्य coinfecting वायरस द्वारा इनकोडिंग टेप. यहाँ दिखाए गए आंकड़ों में वायरल टेप्स एनकोडिंग VACV A50R, A51R, और A52R प्रोटीन्स को RNAi पछाड़ना के लिए निशाना बनाया गया । बचाव के नुकसान के लिए एक नकारात्मक नियंत्रण के रूप में, कोशिकाओं को भी GFP एंकोडिंग टेप dsRNAs लक्ष्यीकरण के साथ transfected थे । बचाव phenotype के नुकसान के लिए एक सकारात्मक नियंत्रण के रूप में, कोशिकाओं ल्यूक के खिलाफ dsRNAs के साथ transfected-एंकोडिंग टेप थे । इस उपचार coinfection के दौरान लू संकेत की एक मजबूत नुकसान का उत्पादन और शोधकर्ताओं अभिकर्मक/RNAi प्रोटोकॉल काम कर रहे हैं कि पुष्टि में मदद करता है. dsRNA अभिकर्मक के 5 ज के बाद, कोशिकाओं VSV-ल्यूक (MOI = 10) और VACV-WR (MOI = 25) के साथ coinfected थे । केवल VSV-ल्यूक के साथ अलग संक्रमण भी लू संकेत के एक पृष्ठभूमि स्तर स्थापित करने के लिए प्रदर्शन किया गया । Lysates तो ७२ hpi काटा और एक ल्यूक परख में इस्तेमाल किया गया । GFP dsRNA नियंत्रण उपचार के लिए dsRNA उपचार भर में VSV बचाव के स्तर की तुलना, परिणाम संकेत मिलता है कि पछाड़ना VACV के A51R बचाव phenotype का एक मजबूत नुकसान का उत्पादन, जबकि पछाड़ना के A50R और A52R एक नकारात्मक परिणाम पैदा करता है (कोई नुकसान का बचाव की तुलना में GFP dsRNA).

RNAi स्क्रीनिंग के लिए एक विकल्प के रूप में वायरल कारकों है कि VSV बचाव के लिए योगदान की पहचान करने के लिए, LD652 कोशिकाओं में एक्सप्रेस उंमीदवार वायरल कारकों और फिर VSV-ल्यूक बचाव के लिए परख । इस तरह के p16629 के रूप में उचित अभिव्यक्ति वैक्टर में ब्याज की क्लोनिंग उंमीदवार जीन द्वारा पूरा किया जा सकता है और VSV-ल्यूक चुनौती से पहले LD652 कोशिकाओं में इन plasmids transfecting । एक उदाहरण के रूप में, चित्रा 4a एक बचाव प्रयोग में जो झंडा टैग GFP (FGFP) या झंडा-टैग A51R (FA51R) p166 वैक्टर transfected कोशिकाओं में विभिंन सांद्रता, LD652-VSV संक्रमण (MO = 10) द्वारा पीछा किया गया में ल्यूक के बाद से पता चलता है 24 एच बाद में । VSV बचाव के लिए एक नकारात्मक नियंत्रण के रूप में, अतिरिक्त संस्कृतियों नकली-transfected थे और प्लाज्मिड डीएनए प्राप्त नहीं किया । Lysates संस्कृतियों ७२ hpi से एकत्र किए गए थे और ल्यूक परख के अधीन थे । FA51R उपचार एक सकारात्मक VSV बचाव परिणाम के रूप में कई खुराकों पर नकली-transfected उपचार पर बढ़ाया लू संकेतों द्वारा प्रदर्शन का उत्पादन किया । इसके विपरीत, FGFP उपचार VSV बचाव के लिए किसी भी खुराक परीक्षण में नकारात्मक थे । चित्रा 4a से lysates के Immunoblotting FGFP और FA51R प्रोटीन (चित्रा 4B) की एक समान अभिव्यक्ति की पुष्टि की ।

उंमीदवार के एक RNAi स्क्रीनिंग का उपयोग कर L असमानता कारकों, हमें पता चला है कि LD652 कोशिकाओं में VSV के प्रतिबंध विभिन्न सेलुलर कारकों एंटीवायरल RNAi रास्ते (जैसे, AGO2 और Dicer-2), परमाणु कारक से संबंधित द्वारा मध्यस्थता है कापा बी (NF-κB)-संबंधित आईएमडी मार्ग (जैसे, स्वाद), और ubiquitin-proteasome प्रणाली (जैसे, polyubiquitin)13। एक उदाहरण के रूप में, हम dsRNAs लक्ष्यीकरण के साथ इन RNAi प्रयोगों के एक छोटे पैमाने पर संस्करण दोहराया है L असमानता है कि टेप बढ़ाया VSV-ल्यूक पछाड़ना पर प्रतिकृति (जैसे, AGO2, Dicer-2, स्वाद, polyubiquitin) या कोई प्रभाव नहीं था (AGO1 )13. dsRNA अभिकर्मक के 24 ज के बाद, कोशिकाओं ७२ के लिए VSV-ल्यूक के साथ चुनौती दी थी कि अगर RNAi उपचार GFP dsRNA उपचार पर नकारात्मक नियंत्रण बढ़ाया LU संकेतों का निर्धारण करने के लिए । RNAi उपचार है कि लू संकेतों को बढ़ाने संकेत मिलता है कि लक्षित प्रतिलिपि द्वारा इनकोडिंग कारक VSV प्रतिकृति प्रतिबंधित करता है । RNAi पछाड़ना के लिए एक सकारात्मक नियंत्रण के रूप में, dsRNAs लक्ष्यीकरण ल्यूक-एंकोडिंग टेप भी समानांतर उपचार में transfected थे । GFP dsRNA नियंत्रण उपचार में पाया कम पृष्ठभूमि लू संकेतों के कारण, यह RNAi स्क्रीनिंग का उपयोग कर मेजबान इनकोडिंग प्रतिबंध कारकों की पहचान करने के लिए अपेक्षाकृत सरल था क्योंकि उनके पछाड़ना उत्पादन ~ 10-१,०००-गुना बढ़ जाती है लू संकेतों में ( चित्रा 5) । इस प्रकार, यह LD652 कोशिकाओं में VSV जीन अभिव्यक्ति के अपेक्षाकृत कम पृष्ठभूमि स्तर का लाभ लेने के लिए मेजबान RNAi पछाड़ना शर्तों है कि VSV प्रतिबंध से राहत के लिए स्क्रीन संभव है ।

Figure 1
चित्रा 1: प्रतिदीप्ति-आधारित लाइव सेल इमेजिंग का उपयोग LD652 कोशिकाओं के वायरस coinfection द्वारा VSV बचाव की पहचान. () इस पैनल के एक योजनाबद्ध VSV-DsRed जीनोम का संकेत DsRed (डॉ) जीन स्थान से पता चलता है. () इन प्रतिनिधि 10x फोकल माइक्रोस्कोपी छवियों पर कब्जा कर लिया है ६० hpi । ४०५ एनएम चैनल व्यवहार्य कोशिकाओं के लिए एक दाग इंगित करता है, ४८८-एनएम चैनल VACV-FL-GFP संक्रमण इंगित करता है, और ५६८ एनएम चैनल VSV-DsRed संक्रमण इंगित करता है । चरण कंट्रास्ट (PC) छवियां भी दिखाई जाती हैं । स्केल बार्स = १०० µm. () यह पैनल पूरे ६५ एच इंफेक्शन टाइम कोर्स पर DsRed-पॉजिटिव LD652 कोशिकाओं का प्रतिशत दिखाता है. प्रत्येक समय बिंदु के लिए DsRed संकेत दिखाने वाले कक्षों का माध्य (SD) प्रतिशत दिखाया गया है. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: ल्यूक परख का उपयोग LD652 कोशिकाओं में VSV बचाव का आकलन । () इस पैनल के एक योजनाबद्ध एक VSV-ल्यूक जीनोम से पता चलता है । () यह पैनल नकली संक्रमित कोशिकाओं या VACV-WR की अनुपस्थिति या उपस्थिति में VSV-ल्यूक से संक्रमित कोशिकाओं से lysates की मनमानी प्रकाश इकाइयों (ल्यूक) की परख दिखाता है । () इस पैनल के एक immunoblot ल्यूक, VSV एम, VACV I3L, और सेलुलर actin प्रोटीन से lysates में पैनल एक एकत्र ७२ hpi से पता चलता है । () यह पैनल VSV-ल्यूक titers में कल्चर supernatants से प्राप्त पैनल बीसे पता चलता है. पैनलों बी और डी में मात्रात्मक डेटा तपसिल में प्रदर्शन प्रयोगों से अर्थ (± एसडी) का प्रतिनिधित्व करते हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3: LD652 कोशिकाओं के coinfection के दौरान RNAi स्क्रीनिंग के माध्यम से एक वायरल इनकोडिंग VSV बचाव कारक की पहचान । इस पैनल के संकेत VACV उपचार के बाद VSV-ल्यूक और RNAi-WR के साथ कोशिकाओं ७२ hpi से lysates में पाया lu में परिवर्तन गुना दिखाता है, lysates से संक्रमित कोशिकाओं से VSV में पता चला लू के सापेक्ष-ल्यूक । डेटा तपसिल में प्रदर्शन प्रयोगों से अर्थ (± एसडी) का प्रतिनिधित्व करते हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्रा 4: LD652 कोशिकाओं में एक वायरल immunomodulator के व्यक्ती द्वारा VSV का बचाव. () यह पैनल VSV से एक ल्यूक परख-ल्यूक-संक्रमित कोशिकाओं को दिखाता है ७२ hpi कि नकली थे-transfected (नकली) या तो transfected या FGFP FA51R अभिव्यक्ति p166 के साथ plasmids । प्रत्येक उपचार से लू संकेतों नकली-transfected नियंत्रण उपचार में पाया संकेतों को सामान्यीकृत किया गया । डेटा तपसिल में प्रदर्शन प्रयोगों से अर्थ (± एसडी) का प्रतिनिधित्व करते हैं । () यह पैनल पैनल से lysates, ध्वज और actin एंटीबॉडी के साथ immunoblotted दिखाता है. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 5
चित्रा 5: RNAi स्क्रीनिंग के माध्यम से LD652 कोशिकाओं में VSV प्रतिकृति सीमित होस्ट कारकों की पहचान. इस पैनल GFP dsRNA नियंत्रण उपचार के सापेक्ष संकेत RNAi उपचार में लू संकेतों में गुना परिवर्तन से पता चलता है ७२ hpi VSV-ल्यूक के साथ । डेटा तपसिल में प्रदर्शन प्रयोगों से अर्थ (± एसडी) का प्रतिनिधित्व करते हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

फिल्म एस 1: प्रतिनिधि ४०५-एनएम (सेल व्यवहार्यता डाई) और ५६८ एनएम (DsRed) चैनल छवियों पर कब्जा कर लिया एक ६५ h समय पाठ्यक्रम (प्रत्येक फ्रेम = 5 एच अंतराल) के बाद VSV-DsRed संक्रमण LD652 कोशिकाओं । कृपया यहां क्लिक करें इस फ़ाइल को डाउनलोड करने के लिए ।

फिल्म S2: प्रतिनिधि ४०५-एनएम (सेल व्यवहार्यता डाई) और ५६८ एनएम (DsRed) चैनल छवियों पर कब्जा कर लिया ६५ h समय पाठ्यक्रम (प्रत्येक फ्रेम = 5 एच अंतराल) VSV-DsRed और VACV-FL-GFP के साथ LD652 कोशिकाओं के coinfection के बाद । कृपया यहां क्लिक करें इस फ़ाइल को डाउनलोड करने के लिए ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

यहां हम सरल प्रतिदीप्ति का वर्णन किया है-और luminescence आधारित परख शर्तों के लिए स्क्रीन करने के लिए कि बचाव प्रतिबंधात्मक lepidopteran सेल संस्कृतियों में VSV प्रतिकृति । lepidopteran कोशिकाओं में VSV के सत्तासीन संक्रमण एक उत्कृष्ट संकेत करने वाली शोर अनुपात जब VSV जीन अभिव्यक्ति के लिए परख बनाता है । उदाहरण के लिए, लू संकेत एकल VSV से lysates में पता चला-ल्यूक संक्रमण थे ~ १,०००-गुना से अधिक नकली-संक्रमित lysates, अभी तक इन संकेतों केवल एक ७२-h समय पाठ्यक्रम पर लगभग दोहरा बदल गया. इसके विपरीत, coinfection VSV-ल्यूक के साथ VACV बढ़ाया लू संकेतों ~ ३००-७२ VSV द्वारा एकल ल्यूक-hpi संक्रमण पर गुना । इस प्रकार, VSV बचाव परख एक उत्कृष्ट गतिशील रेंज प्रदर्शित करते हैं, परिमाण के कई आदेशों को शामिल ।

इन परख स्थापित करने में महत्वपूर्ण कदम में से एक VSV बचाव प्रतिदीप्ति का उपयोग कर के लिए परख के लिए निर्णय या luminescence आधारित दृष्टिकोण शामिल है । हम कैसे VSV इनकोडिंग DsRed संकेतों के उदाहरण है मात्रात्मक रहते सेल इमेजिंग तकनीकों और सॉफ्टवेयर संकुल है कि DsRed के अभाव या एक बचाव की उपस्थिति में सकारात्मक कोशिकाओं के स्वचालित ठहराव की सुविधा का उपयोग कर परख कर सकते है दिखाया गया है coinfection । यदि शोधकर्ताओं ने जीने के लिए उपयोग किया है-सेल इमेजिंग क्षमताओं, इन परख को स्थापित करने और उंहें समय अंक की एक विस्तृत श्रृंखला है कि VSV प्रतिकृति कैनेटीक्स में अंतर का पता लगाने में सहायता कर सकते है कि केवल संकीर्ण समय में देख रहे है पर कब्जा करने की अनुमति सस्ती है Windows. इसके विपरीत, luminescence आधारित दृष्टिकोण अनिवार्य रूप से अंत बिंदु परख है कि पूर्व निर्धारित समय बिंदुओं पर सेल lysates की तैयारी की आवश्यकता है, और lysate तैयारी समय लेने वाली हो सकता है । दूसरी ओर, luminescence आधारित परख परिष्कृत माइक्रोस्कोपी उपकरण की आवश्यकता नहीं है-केवल एक प्लेट luminescence संकेतों को पढ़ने में सक्षम पाठक । इसके अलावा, luminescence आधारित परख सूक्ष्म से अधिक से अधिक गतिशील रेंज आधारित परख कि संक्रमित कोशिकाओं के प्रतिशत की गणना है । उदाहरण के लिए, सूक्ष्म परख में, DsRed-सकारात्मक कोशिकाओं (VSV-DsRed संक्रमण का संकेत) केवल 0 से रेंज कर सकते है-दृश्य के एक क्षेत्र में विश्लेषित कोशिकाओं के 100% । इसके विपरीत, एकल VSV-ल्यूक और coinfection शर्तों (या अंय बचाव शर्तों) के बीच लू संकेतों परिमाण के कई आदेशों पर रेंज कर सकते हैं ।

VSV-एल असमानता सेल प्रणाली का उपयोग करने का एक महत्वपूर्ण लाभ यहां प्रस्तुत स्तनधारी वायरस के लिए स्क्रीन इनकोडिंग immunomodulators है कि यह स्वाभाविक वायरल कारकों की पहचान के लिए चुनता है कि दमन क्या संरक्षित और प्राचीन होने की संभावना है एंटीवायरल प्रतिसाद जो हड्डीवाला-विशिष्ट इंटरफेरॉन प्रतिसाद को दिनांकित करते हैं । दरअसल, प्रारंभिक टिप्पणियों सुझाव है कि A51R प्रोटीन एंटीवायरल ubiquitin-proteasome-संबंधित सेलुलर प्रतिक्रियाओं को बाधित (गैमन एट अल देखें । 13 और अप्रकाशित डेटा) । VSV के VACV A51R बचाव की खोज एक हड्डीवाला13में एक invertebrate वायरस द्वारा एक heterologous वायरस बचाव का पहला उदाहरण था, और यह संभावना है कि इन स्क्रीनिंग सिस्टम अतिरिक्त हड्डीवाला वायरस-इनकोडिंग immunomodulators को उजागर करेंगे . यह नोट करें कि होस्ट प्रतिरक्षा को बाधित शर्तों के लिए एक readout के रूप में VSV बचाव का उपयोग करने के लिए कुंजी महत्वपूर्ण है कि VSV प्रतिकृति भारी प्रतिबंधित (या VSV प्रतिकृति में जांच की जा रही है जो कक्ष प्रकार में सत्तासीन) होना चाहिए । इसलिए, सबसे स्तनधारी कोशिका प्रकार की संभावना है कि VSV स्तनधारी कोशिकाओं में अच्छी तरह से प्रतिकृति दी, परख के इन प्रकार के लिए अनुपयुक्त हो जाएगा । यही कारण है कि एल असमानता कोशिकाओं VSV के लिए एक स्वाभाविक रूप से प्रतिबंधात्मक मेजबान सेल प्रकार के रूप में यहां इस्तेमाल किया गया ।

Drosophila कोशिकाओं में एक पूर्व अध्ययन से पता चला कि एंटीवायरल RNAi प्रतिक्रियाओं के वायरल दमन अभिव्यक्ति के cotransfection द्वारा पहचाना जा सकता है plasmids एंकोडिंग उंमीदवार RNAi दमन और एक आत्म-नकल झुंड घर वायरस जीनोमिक आरएनए कि encodings GFP B2 के स्थान पर, अपनी प्राकृतिक RNAi शमन30। झुंड घर जीनोमिक आरएनए और GFP के उत्पादन की प्रतिकृति cotransfected उम्मीदवार कारक द्वारा RNAi के दमन पर निर्भर था और, इस प्रकार, GFP अभिव्यक्ति के बचाव RNAi दमन संकेत दिया30. हमारे अप्रकाशित कार्य इंगित करता है कि वायरस इनकोडिंग RNAi अवरोधकों के व्यक्त भी एल में VSV-ल्यूक जीन अभिव्यक्ति बचाव कोशिकाओं, सुझाव है कि इस प्रणाली भी के संदर्भ में RNAi प्रतिक्रियाओं के दमन की पहचान करने के लिए इस्तेमाल किया जा सकता एक बोना के रूप में एक replicon के विरोध में वायरल रोगज़नक़ द्वारा संक्रमण । वास्तव में, खोज है कि RNAi-, आईएमडी-, और ubiquitin-proteasome-संबंधित रास्ते में VSV प्रतिकृति के प्रतिबंध के लिए योगदान L...... । 13 से पता चलता है कि कई एंटीवायरल रास्ते के वायरल विरोधी VSV द्वारा पहचाना जा सकता है बचाव परख यहां प्रस्तुत किया ।

मेजबान एंटीवायरल प्रोटीन की पहचान के संबंध में इन स्क्रीनिंग तरीकों की एक संभावित सीमा है कि एल असमानता जीनोम अनुक्रम अभी तक उपलब्ध नहीं है । हालांकि, वहां सार्वजनिक रूप से उपलब्ध है एल असमानता transcriptomes कि RNAi पछाड़ना26,27,28के लिए उंमीदवार मेजबान लक्ष्य की पहचान करने के लिए इस्तेमाल किया जा सकता है । इसके अतिरिक्त, हम पहले से पता चला है कि VSV सेल अंय lepidopterans13 कि अब एक सार्वजनिक रूप से उपलब्ध जीनोम (जैसे, Manduca sexta)31से व्युत्पंन लाइनों में प्रतिबंधित है । इसलिए, सेल लाइनों अनुक्रम जीनोम के साथ अंय lepidopterans से व्युत्पंन एल असमानता यहां प्रोटोकॉल में वर्णित कोशिकाओं स्थानापन्न हो सकता है ।

arboviruses३२के बढ़ते आर्थिक और जन स्वास्थ्य के खतरे को देखते हुए, स्क्रीनिंग परख यहां प्रस्तुत उपंयास रणनीतियों के लिए arbovirus की नई सुविधाओं की पहचान-मेजबान बातचीत है कि नए एंटीवायरल के डिजाइन में मूल्य हो सकता है प्रदान कर सकते है चिकित्सा विज्ञान. इसके अलावा, क्योंकि आरएनए वायरस प्रतिकृति सीमित करने के लिए lepidopteran तंत्र की हमारी अपेक्षाकृत सीमित समझ के, यहां प्रस्तुत उपकरणों के लिए इस आर्थिक रूप से महत्वपूर्ण द्वारा इनकोडिंग मेजबान रक्षा तंत्र जांच करने के लिए नए अवसर प्रदान कीड़ों के आदेश ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

D.G. टेक्सास पश्चिमी मेडिकल सेंटर के संपंन विद्वानों कार्यक्रम विश्वविद्यालय से धन द्वारा समर्थित था । लेखक माइकल Whitt (टेनेसी स्वास्थ्य विज्ञान केंद्र के विश्वविद्यालय) और शॉन Whelan (हार्वर्ड मेडिकल स्कूल) VSV-DsRed और VSV-ल्यूक के प्रावधान के लिए धंयवाद । लेखक भी गैरी लुकेर (मिशिगन मेडिकल स्कूल के विश्वविद्यालय) VACV-FL-GFP तनाव के प्रकार के उपहार के लिए धंयवाद ।

Materials

Name Company Catalog Number Comments
6-well tissue culture plates CELLTREAT 229106
24-well tissue culture plates CELLTREAT 229124
10 cm tissue culture dishes Corning C430167
Grace’s Insect Medium Sigma G8142
EX-CELL 420 Sigma 14420C
Fetal Bovine Serum - Optima Atlanta Biologicals S12450
Growth medium 1:1 mixture of Grace's Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1% antibiotic-antimycotic solution and 10% Fetal bovine serum
Antibiotic-Antimycotic Solution (100×) Sigma A5955
Dulbecco’s Phosphate Buffered Saline (DPBS) Sigma D8662
Serum Free Media (SFM) Thermo Fisher 10902096
Cytosine arabinoside Sigma C1768
Transfection reagent Thermo Fisher 10362100
Corning cellgro DMSO (Dimethyl Sulfoxide) Corning 25950CQC
Reporter lysis buffer 5x Promega E3971
Luciferase Assay Reagent Promega E1483
96-Well Microplates Corning 3915
Mouse anti-FLAG antibody Wako 014-22383
Rabbit anti-firefly luciferase antibody Abcam ab21176
Mouse anti-actin antibody Sigma A2066
Mouse anti-VSV M N/A N/A Dr. John Connor (Boston University)
Mouse anti-VACV I3L N/A N/A Dr. David Evans (University of Alberta)
8-well Chambered dish Lab-Tek II 155409
Cell viability dye Thermo Fisher C12881
FLUOstar microplate reader BMG Labtech FLUOstar
Confocal microscope Olympus FV10i-LIV
Image analysis software Olympus v1.18 cellSens software
Eppendorf 5702 ventilated centrifuge Eppendorf 22628102
Odyssey Fc Infrared Imaging System Li-COR Biosciences Odyssey Fc
LD652 cells N/A N/A Dr. Basil Arif (Natural Resources Canada)
BSC-40 cells ATCC CRL-2761
BHK cells ATCC CCL-10
HeLa cells ATCC CCL-2
BSC-1 cells ATCC CCL-26
in vitro transcription and purification kit Thermo Fisher AM1626
PCR purification kit Qiagen 28104

DOWNLOAD MATERIALS LIST

References

  1. Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. Viral tropism. Frontiers in Microbiology. 3, 281 (2012).
  2. Werden, S. J., McFadden, G. The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus. Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784, (1), 228-237 (2008).
  3. McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. Cytokine determinants of viral tropism. Nature Reviews: Immunology. 9, (9), 645-655 (2009).
  4. Silva, J. M., et al. Second-generation shRNA libraries covering the mouse and human genomes. Nature Genetics. 37, (11), 1281-1288 (2005).
  5. Moffat, J., et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell. 124, (6), 1283-1298 (2006).
  6. Ma, D., Liu, F. Genome Editing and Its Applications in Model Organisms. Genomics Proteomics Bioinformatics. 13, (6), 336-344 (2015).
  7. Yin, H., Kauffman, K. J., Anderson, D. G. Delivery technologies for genome editing. Nature Reviews: Drug Discovery. 16, (6), 387-399 (2017).
  8. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, (7206), 890-893 (2008).
  9. Houzet, L., Jeang, K. T. Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis. Experimental Biology and Medicine. 236, (8), Maywood, NJ. 962-967 (2011).
  10. Marceau, C. D., et al. Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens. Nature. 535, (7610), 159-163 (2016).
  11. Savidis, G., et al. Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics. Cell Reports. 16, (1), 232-246 (2016).
  12. Panda, D., Cherry, S. Cell-based genomic screening: elucidating virus-host interactions. Current Opinion in Virology. 2, (6), 784-792 (2012).
  13. Gammon, D. B., et al. A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection. Elife. 3, (2014).
  14. Letchworth, G. J., Rodriguez, L. L., Del cbarrera,, J, Vesicular stomatitis. Veterinary Journal. 157, (3), 239-260 (1999).
  15. Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones. Proceedings of the National Academy of Sciences of the United States of America. 92, (18), 8388-8392 (1995).
  16. Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization. PLoS Pathogens. 5, (4), e1000394 (2009).
  17. Duntsch, C. D., et al. Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model. Journal of Neurosurgery. 100, (6), 1049-1059 (2004).
  18. Li, Y., Yuan, S., Moyer, R. W. The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus. Virology. 248, (1), 74-82 (1998).
  19. Seet, B. T., et al. Poxviruses and immune evasion. Annual Review of Immunology. 21, 377-423 (2003).
  20. Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. Preparation of Cell Cultures and Vaccinia Virus Stocks. Current Protocols in Microbiology. 39, 11-18 (2015).
  21. Andrei, G., et al. Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice. Journal of Virology. 80, (19), 9391-9401 (2006).
  22. Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. Preparation of recombinant vaccinia virus for expression of small GTPases. Methods in Enzymology. 174-188 (1995).
  23. Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection. Bio-Protocol. 7, (22), (2017).
  24. Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread. Virology. 341, (2), 284-300 (2005).
  25. Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. Vaccinia reporter viruses for quantifying viral function at all stages of gene expression. Journal of Visualizes Experiments. (87), e51522 (2014).
  26. Cao, C., et al. Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance. Pesticide Biochemistry and Physiology. 119, 54-61 (2015).
  27. Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis. PloS One. 8, (5), e61190 (2013).
  28. Sparks, M. E., Gundersen-Rindal, D. E. The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts. Viruses. 3, (11), 2339-2350 (2011).
  29. Lin, G., Li, G., Granados, R. R., Blissard, G. W. Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion. In Vitro Cellular & Developmental Biology - Animal. 37, (5), 293-302 (2001).
  30. Li, W. X., et al. Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing. Proceedings of the National Academy of Sciences of the United States of America. 101, (5), 1350-1355 (2004).
  31. Kanost, M. R., et al. Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta. Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).
  32. Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases. BMJ Global Health. 3, (2018).
वायरल Immunomodulators और मेजबान एंटीवायरल कारकों की पहचान के लिए स्क्रीनिंग उपकरण के रूप में Arbovirus संक्रमण
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).More

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter