Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Arbovirus infeksjoner som Screening verktøy for identifikasjon av Viral Immunomodulators og vert Antiviral faktorer

doi: 10.3791/58244 Published: September 13, 2018

Summary

Her presenterer vi protokoller for å identifisere 1) virus-kodede immunomodulators som fremmer arbovirus replikering og 2) eukaryote vert faktorer som begrenser arbovirus replikering. Metodene fluorescens og luminescence-baserte tillate forskere å raskt få kvantitative readouts arbovirus replikasjon i enkle analyser med lav signal-til-støy-forhold.

Abstract

RNA forstyrrelser- og genom redigering-basert screening plattformer har vært mye brukt til å identifisere verten celle faktorer som begrenser virus replikering. Disse skjermene er imidlertid vanligvis gjennomført i celler som er naturlig ettergivende til viral patogen under studien. Derfor kan robust replikering av virus kontroll forhold begrense det dynamiske utvalget av disse skjermene. Videre kan disse skjermene kanskje ikke å lett identifisere cellulære forsvar trasé som begrenser virus replikering hvis viruset er godt tilpasset til verten og i stand til å møte antiviral forsvar. I denne artikkelen beskriver vi et nytt paradigme for å utforske virus vert interaksjoner ved hjelp av skjermer som senter på naturlig mislykket infeksjoner med arboviruses som vesicular stomatitt virus (VSV). Til tross for muligheten for VSV å gjenskape i en rekke dipteran insekter og pattedyr verter, gjennomgår VSV en mislykket, etter oppføring infeksjon i en rekke cellelinjer avledet fra Lepidoptera insekter, som sigøyner møll (Lymantria dispar). Men kan disse mislykket VSV infeksjoner være "reddet" når verten celle antiviral forsvar er kompromittert. Beskriver vi hvordan VSV påkjenningen koding praktisk reporter gener og restriktiv L. dispar linjer kan kobles til oppsett skjermer å identifisere vert faktorer involvert i arbovirus begrensning. Videre, vi også vise nytten av disse screening verktøy i identifikasjon av virally kodet faktorer som redde VSV replikering under coinfection eller gjennom ektopisk uttrykk, inkludert de kodet av pattedyr virus. Naturlige begrensning VSV replikering i L. dispar celler gir høy signal-til-støy forholdet når screening for forhold som fremmer VSV redning, dermed muliggjør bruk av forenklede luminescence - og fluorescens-baserte analyser overvåke endringene i VSV replikering. Disse metodene er nyttige for å forstå samspillet mellom verten antiviral svar og viral immun evasion faktorer.

Introduction

Muligheten for et virus å gjenskape produktivt i en bestemt vert er delvis styrt av tilgjengeligheten av verten celle faktorer som støtter viral oppføringen og replikering1. Virus-vert området kan også være diktert av kapasiteten på virus til counter mobilnettet antiviral forsvar som ellers ville hindre viral replikasjon2,3. Det er resultatet av disse komplekse virus vert interaksjoner som til slutt avgjør om virus vil kunne fullføre livssyklusen i en bestemt vert. Gitt potensielt patogene konsekvensene for verten hvis viral replikasjon oppstår, er det avgjørende å utvikle eksperimentelle strategier for å fremme vår forståelse av viktige virus vert interaksjoner som kanskje tips balansen mellom mislykket og produktiv infeksjoner. Klargjørende molekylær funksjonene av virus-vert interplay vil være medvirkende i utviklingen av nye og alternative antiviral strategier.

Med ankomsten av RNA forstyrrelser (RNAi)4,5 og genomet-redigeringsverktøy (f.eks., CRISPR-Cas9, sink finger nucleases, TALENs)6,7, det har blitt eksperimentelt mulig å endre det uttrykk for cellulære faktorer på genomet-bred skalerer og utforske effekten av disse endringene på virus replikering. Faktisk, mange RNAi og genomet-redigering-baserte skjermer er utført i virvelløse og virveldyr vert celletyper som har avsløre nye fasetter av virus-vert interaksjoner8,9,10, 11 , 12. disse skjermene vanligvis benytter virus koding journalister, som firefly luciferase (LUC) eller fluorescerende proteiner (f.eks., GFP, DsRed), som gir praktisk måte kvantitativt vurdere viral genuttrykk som en avlesning for viral replikasjon9,12. Denne strategien kan forskerne identifisere vert faktorer som enten fremme eller antagonize viral replikasjon som gjenspeiles av øker eller reduseres, henholdsvis, i viral reporter signaler9,12. Imidlertid i de aller fleste tilfeller, har disse skjermene vært gjennomført med virus som er godt tilpasset til verten celle type der de blir undersøkt. Mens denne strategien kan være viktig for å forstå coevolutionary relasjoner mellom viral patogener og deres naturlige verter, utgjør det grunnleggende bekymringer angående bruken avdekke vert antiviral faktorer. I slike tilfeller en forbedring i virus reporter signalet på RNAi knockdown blir sett for eller inaktivering av en mobilnettet faktor som vanligvis hindrer viral replikasjon. Først, hvis et virus er allerede kunne robust gjenskape i vert cellen undersøkt under kontroll forhold, det dynamiske området av skjermen (dvs., muligheten til å skille mellom bakgrunn og forbedret viral reporter signaler) kan være begrenset. Det andre er problemet ytterligere forverret av situasjoner der viruset er godt tilpasset til verten cellen og effektiv på å bekjempe vert forsvar trasé som er målrettet i skjermen.

På grunn av de over bekymringene om tradisjonelle virus vert samhandling screening metoder, utviklet vi et nytt paradigme for å studere viruset vert interaksjoner som utnytte naturlig mislykket arbovirus infeksjoner i Lepidoptera insekt celler. Denne strategien kommer fra en observasjon at det godt studert menneskelige arbovirus, VSV, gjennomgår en mislykket infeksjon i cellene stammer fra den sigøyner møll (L. dispar)13. VSV overføres naturlig av dipteran insekter (dvs., sand fluer) til pattedyr verter, og har vist eksperimentelt å infisere et bredt spekter av virvelløse dyr og virveldyr verter både i celle kultur og i vivo14. 11-kb negative-sense single-strandet RNA genomet av VSV koder fem subgenomic mRNAs som hver er oversatt til proteiner som utgjør den omsluttede virion. Imidlertid har VSV omvendt genetiske systemer tillatt for opprettelse av replication kompetente stammer koding LUC eller fluorescerende proteiner, i tillegg til fem naturlige VSV genet produkter15,16,17. Fordi disse reporter proteiner ikke er innlemmet i VSV virion, gir de en praktisk avlesning for VSV genuttrykk som oppstår etter oppføring. Bruker VSV stammer koding GFP eller LUC, har vi tidligere vist at VSV genuttrykk er sterkt begrenset ved oppføring av LD652 celler og at VSV titers ikke økning av 72 timer etter infeksjon (hpi). Derimot fører coinfection av LD652 celler med VSV og pattedyr poxvirus, vaccinia virus (VACV), til logaritmisk øker både VSV genuttrykk og titers av dette tidspunkt. VACV gjennomgår tidlig genuttrykk utryddelse og sent genuttrykk i LD652 celle infeksjoner, men VACV replikering syklusen er slutt mislykket på grunn av ufullstendige virion morphogenesis18. Store ~ 192-kb DNA genomet av VACV koder > 200 proteiner, hvorav mange viser immunmodulerende egenskaper som fremmer viral replikasjon gjennom undertrykkelse av verten immunreaksjoner19. Derfor hypotesen vi at "redde" av VSV replikasjon i LD652 celler av VACV coinfection var sannsynlig formidlet av VACV immunomodulators som hemmet L. dispar svar vanligvis begrense VSV replikering. Dette redder behandling av LD652 celler med verten RNA polymerase II hemmer actinomycin D også VSV replikering i LD652 celler, som indikerer at transkripsjon-avhengige vert svarene blokkere VSV replikering etter oppføring13.

Over observasjoner foreslår at naturlig restriktive natur LD652 cellene VSV infeksjon kan gi en relativt lav bakgrunn når screening for forhold som forbedrer VSV-kodet reporter signaler (dvs.de som hemmer vert antivirale forsvar). Her gir vi metodene for å bruke fluorescens eller LUC-baserte analyser til skjermen for forhold som lindre VSV begrensning i Lepidoptera celler. Først viser vi hvordan disse analyser kan brukes til å identifisere virally kodet immunmodulerende faktorer som bryter VSV begrensning under enten coinfection eksperimenter eller gjennom ektopisk uttrykk for kandidaten viral faktorer. Som et eksempel viser vi hvordan vi brukt disse screening teknikker for å identifisere poxvirus-kodede A51R proteiner som en ny familie av immunmodulerende faktorer som redde VSV replikering i fravær av andre poxvirus faktorer13. Andre illustrerer vi hvordan RNAi screening i restriktiv VSV-LD652 celle infeksjoner kan brukes til å identifisere direkte eukaryote vert faktorer involvert i arbovirus begrensning13.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. generell Lymantria dispar (LD652) cellen og Virus kultur

  1. LD652 cellen dyrking og plating
    1. Kultur L. dispar-avledet LD652 celler, vedlikeholde en monolayer av celler i et vekst medium (Tabell for materiale) ruges ved 27 ° C under normale atmosfære. Opprettholde cellene i 10 cm vev kultur-behandlet retter og passasje cellene ved å nå 80% confluency.
    2. Plate, dislodge tilhenger LD652 celler fra platen av pipettering media gjentatte ganger på monolayer (disse cellene ikke krever trypsinization å dislodge) og fortynne prøven i vekst medier til en omtrentlig tettheten av 1 x 105 celler/mL. Pipetter 1 mL av utvannet kultur/vel av en 24-vel plate. Frø minst tre Repliker brønner/behandling type for hvert punkt (maksimalt åtte behandlinger/plate).
    3. At cellene å betale for minst 1 time.
  2. Vaccinia virus forberedelse
    1. Å forberede beholdning av VACV, forsterke viruset i HeLa celler20 eller afrikanske grønn ape nyre celler (BSC-1 eller BSC-40 celler)20,21,22.
      Merk: VACV belastning Western Reserve (VACV-WR) fungerer godt i analyser beskrevet her.
    2. Sjarmere VACV belastning via plakk analysen på BSC-1 eller BSC-40 celler20,22.
      Merk: Alle angitt VACV mangfold av infeksjon (MOI) beskrevet her for LD652 celle infeksjoner er basert på titers fra BSC-40 plakk analyser.
  3. Vesicular stomatitt virus forberedelse
    1. For å forberede VSV aksjer, forsterke viruset i BHK celler23.
    2. Sjarmere VSV av plakk analysen på BSC-40 eller BHK celle monolayers13,23.
      Merk: Alle VSV MOIs beskrevet her for LD652 celle infeksjoner er basert på titers fra BSC-40 plakk analyser.

2. fluorescens-baserte VSV redning analysen co infeksjon og Live-celle Imaging

  1. Såing og infeksjon av LD652 celler
    1. Plate 40.000 LD652 celler/vel av en 8-vel kammer.
    2. For fluorescens-basert live-celle avbildning, kan du bruke VSV stammer koding fluorescerende proteiner. Eksperimentene presenteres her bruker VSV-DsRed17, en rekombinant VSV stamme som uttrykker gratis DsRed protein som ikke er smeltet til noen andre VSV protein.
      Merk: VSV infeksjon av LD652 celler er ikke cytopathic av 96 hpi, og dermed at cellen er ikke en forvirrende faktor når du vurderer VSV replisering innen denne tidsrammen.
    3. Forberede VSV-DsRed og VACV-FL-GFP i serum-free media (SFM; Tabell av materialer) på en MOI 1 og 25, henholdsvis.
      Merk: VACV-FL-GFP er en rekombinant VACV stamme som uttrykker en fusjon av LUC og GFP24. Hvis du bruker en MOI 25 eller større for VACV stammer sikrer at alle LD652 celler er infisert13. Hvis bruker et annet coinfecting virus, må MOI bestemmes empirisk av brukeren. Hver infeksjon behandling bør settes opp i like brønner og inkluderer uekte-infiserte behandlinger som bare SFM er lagt til cellene.
    4. Inkuber cellene i 0,2 mL inoculum 2 h på 27 ° C.
    5. Vask cellene med 0,5 mL/vel av veksten medier.
    6. Inkuber cellene i 25 μM celle levedyktighet fargestoff (Tabell for materiale) i vekst medier for 45 min på 27 ° C.
    7. Sug opp media og vaske brønnene 1 x med 0,5 mL/godt for å fjerne overflødig fargestoff.
    8. Opprettholde cellene 0,3 mL/vel av veksten medier.
  2. Live celle avbildningsopptak
    1. Slå på AC confocal mikroskop 30 min på forhånd og laste en 8-vel kammer fatet.
      Merk: LD652 celler kan avbildes i romtemperatur fra 20-25 ° C, men for optimale forhold, temperaturen i rommet skal justeres til 27 ° C.
    2. Definer passende eksitasjon/utslipp innstillingene for hver fluorescerende markør protein avbildes, samt fase kontrast bildeinnstillingene.
    3. Justere laser intensiteten for hver kanal.
      Merk: Dette krever kjører et pilotprosjekt for å fastslå rekkevidden for fluorescerende signal intensiteter observert gjennom tid i siste eksperimentet.
    4. Bruke 10 X målsettingen, capture fase kontrast og fluorescens bilder av hver godt hver 1 – 5 h for varigheten av infeksjonen til et ønsket tidspunkt (f.eks., 48-72 hpi).
      Merk: Det er viktig å fange flere synsfelt i hver brønn nøyaktig beregne smittespredning hele kulturen.
  3. Bildeanalyser
    1. Bruk image analyseprogramvare for automatiserte image analyse av aktuelle fluorescerende kanaler (f.eks., 405 nm, 488 nm, 568 nm).
    2. For å beregne prosentdelen av celler som er infisert, kan du dele antall fluorescerende celler indikerer VSV infeksjon (f.eks., DsRed-positive celler for VSV-DsRed infeksjoner) av antall levedyktige cellers merket av cellen levedyktighet farge for hver synsfeltet over alle behandlinger.

3. generelle virusinfeksjon protokoll for Luminescence-baserte VSV redning analyser i LD652 celler

  1. Utarbeidelse av inoculum
    1. 30 min før infeksjon, tine aksjer VSV-LUC16 (en rekombinant VSV belastning som uttrykker gratis firefly luciferase protein ikke smeltet til noen andre VSV protein). Hvis assaying for VSV-LUC redning under VACV coinfection, også tine VACV-WR viruset på is.
      Merk: Andre virus (foruten VACV-WR) kan redde VSV-LUC under coinfection, men dette vil ha å empirisk hver bruker.
    2. Forberede inoculum fortynne VSV-LUC i tilstedeværelse eller fravær av VACV-WR i SFM slik at en MOI 10 og 25, henholdsvis oppnås når du legger til et totalt inoculum volum på 0,2 mL/godt.
  2. Infeksjon i cellene
    1. Sug opp eldre LD652 media nøye for å unngå å forstyrre monolayer og vaksinere med 0,2 mL virus/godt. Denne gangen er definert som 0 hpi. Legge til sterilt SFM flere brønner som "uekte-infisert" negativ kontroll behandlinger.
    2. Inkuber cellene i inoculum 2 h på 27 ° C.
    3. På 2 hpi, fjerne inoculum av aspirasjon og erstatte med 1 mL/vel LD652 vekst medier.
    4. Tillate infeksjonen fortsette 24-72 hpi.

4. luciferase analysen

  1. Utarbeidelse av cellen lysates
    1. Nøye Sug opp nedbryting og legge 1 mL av Dulbeccos fosfat-bufret saltvann (DPBS) / godt.
    2. Bruker stempelet til en 1 mL sprøyte, skrape cellene til DPBS.
    3. Overføre cellene til en microcentrifuge rør, og sentrifuge 400 x g for 20 min på 4 ° C.
    4. I mellomtiden Forbered 1 x fortynning av 5 x reporter lyseringsbuffer (RLB) i sterilt H2O.
    5. Sug opp DPBS uten å forstyrre den cellen pellet etter sentrifugering.
    6. Resuspend hver pellet i 150 µL av 1 x RLB.
    7. Fryse-Tin prøver 1 x bruker en 5-min inkubasjon i-80 ° C fryser etterfulgt av en rask bedring romtemperatur vannbad. Lagre lysates ved-80 ° C helt klar til å analysere.
  2. Luciferase analysen
    1. Tine lysates på is.
    2. Pipetter 20 μL lysate til et godt av en solid svart eller hvit 96-brønnen microplate.
    3. Tilsett 100 μL av luciferase analysen reagensen i hver brønn.
    4. Umiddelbart måle lysintensiteten bruker en luminometer (passende innstillinger for bestemte luminometers må bestemmes empirisk av brukeren).
  3. Luciferase analysen analyse
    1. Normalisere LU signaler for hver behandling til LU målinger fra kontroll behandlinger (Representant resultater). Når minst tre uavhengige eksperimenter har blitt utført, kan gjennomsnittet LU innhentet fra hver behandling/kontroll gruppe analyseres av passende statistiske tester.

5. Immunoblot

  1. Bruk lysates pakket ut av LUC analyser for SDS-side og påfølgende immunoblotting, bruke aktuelle reagenser og instrumentering.

6. titer av VSV fra LD652 cellekulturer

  1. Plate LD652 celler i henhold til trinn 1.1.
  2. Viral smitte cellene etter trinn 3.
  3. På ønsket tidspunkt, samle supernatants i sterilt microcentrifuge rør.
  4. Pellets cellene bruker 1000 x g for 10 min på 4 ° C, og Overfør supernatants til nye rør.
  5. Lagre supernatants ved-80 ° C eller fortsette titrering av plakk analysen på BSC-40 celler.
    Merk: Hvis titrating VSV fra LD652 cellekulturer som inneholdt VACV, er det tilrådelig å legge 100 μg/mL cytosine arabinoside (AraC) til BSC-40 kultur media innen 2 hpi, hindre gjenværende VACV partikler i å danne plaketter på BSC-40 monolayers13. AraC er en viral DNA polymerase inhibitor som blokkerer VACV DNA replikering25 , men påvirker ikke VSV replikering.

7. varianter av Luminescence-baserte VSV redde analyser i LD652 celler: RNAi og plasmider Transfection eksperimenter

  1. Utarbeidelse av dsRNA for RNAi-mediert knockdown på viral eller vert transkripsjoner
    1. Design gen-spesifikke primere tailed på 5' slutten T7 promoter sekvens (TAATACGACTCACTATAGGG) å målrette enten coinfecting viruset (f.eksVACV) eller L. dispar mRNA transkripsjoner av interesse. Disse veiledningene skal produsere et PCR-produkt av 400-600 bp for effektiv RNAi-mediert knockdown. Se Gammon et al. 13 for primer sekvenser brukes under knockdown VACV eller L. dispar utskrifter av dsRNA-mediert RNAi i LD652 celler.
      Merk: L. dispar mRNA utskrifter kan identifiseres fra publisert L. dispar , transcriptome, databaser,26,,27,,28.
    2. Generere en DNA mal via RT PCR (cDNA syntese: 1 syklus av 50 ° C for 30 min; PCR: 40 sykluser av 94 ° C for 15 s, 50 ° C for 30 s og 68 ° C for 45 s hver).
    3. Rense PCR produktet bruker en PCR rensing kit.
    4. Bruke renset PCR produktet som mal, i vitro transkribere og rense dsRNA bruker en i vitro transkripsjon og rensing kit.
  2. Hva dsRNA eller plasmider DNA i LD652 celler
    1. Frø 1 x 105 celler/vel av en 24-vel plate og la cellene betale for minst 1 time.
    2. For hver godt å være transfekterte, fortynne 4 μL transfection reagens i 100 μL SFM. Inkuber for opptil 15 minutter ved romtemperatur. Dette kan skaleres for å gjøre en master blanding for alle transfections utføres.
    3. Fortynne opptil 1 μg dsRNA eller totale plasmider DNA med 100 μL SFM for hver godt å være transfekterte. Inkuber for opptil 15 minutter ved romtemperatur.
      Merk: Vi har tidligere funnet at en transfection av 1 μg celleområde dsRNA/105 LD652 er tilstrekkelig for > 80% knockdown enten viral eller vert transkripsjoner13, men dsRNA doser nødvendig for endret eksperimentelle sette-pop-ups/betingelser vil måtte være bestemt empirisk.
    4. Kombinere transfection reagens- og dsRNA/plasmider DNA fortynninger med en 1:1 ratio (f.eks100 μL utvannet dsRNA er blandet med 100 μL utvannet transfection reagens) og Inkuber for 20 min ved romtemperatur.
    5. I mellomtiden vaske brønnene med 1 mL/vel av SFM, og deretter legge 500 μL SFM i hver brønn.
    6. Sakte legge til hva reagens dsRNA (eller plasmider DNA) blanding dropwise i hver brønn.
    7. Inkuber transfection reagensen med cellene for 5 h.
      1. For RNAi forsøk med knockdown av transkripsjoner kodet av coinfecting virus (f.eksVACV), erstatte transfection reagensen etter 5-h transfection vekst med virus inoculum som inneholder VSV-LUC (med eller uten VACV eller en annen coinfecting virus) (trinn 3). Deretter erstatte virus inoculum med VSV-LUC komplett vekst media 2 hpi. LUC analyser (trinn 4) kan deretter utføres på utdraget lysates på ulike tidspunkt å avgjøre hvis knockdown av coinfecting virus transkripsjoner fører til tap av VSV-LUC rescue.
      2. For RNAi eksperimenter med RNAi av L. dispar transkripsjoner, erstatte transfection blandingen med komplett vekst medier og la knockdown til følge for 24 timer før infeksjon med VSV-LUC (trinn 4). LUC analyser (trinn 4) kan deretter utføres på utdraget lysates på ulike tidspunkt å avgjøre hvis knockdown av L. dispar transkripsjoner fremmer VSV-LUC redning.
      3. For eksperimenter med transfections av plasmider uttrykk vektorer uttrykker kandidaten immunomodulators, erstatte transfection reagensen og tillate protein uttrykk for 24 timer før infeksjon med VSV-LUC (trinn 4). LUC analyser (trinn 4) kan deretter utføres på utdraget lysates på ulike tidspunkt å avgjøre om uttrykk for kandidaten immunmodulerende proteiner fremmer VSV-LUC redning.
        Merk: Hva betingelsene beskrevet her bruker 1 μg/godt plasmider DNA resultatet i transfection effektiviteten av 40-60%13.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Som et eksempel på live-celle tenkelig søknadene å overvåke VSV redning på VACV coinfection, LD652 celler var belagt i en 8-og kamret rett og uekte-smittet eller infisert med VSV-DsRed (MOI = 1) i tilstedeværelse eller fravær av VACV-FL-GFP (MOI = 25). Fordi VSV-DsRed uttrykker DsRed som et gratis protein og er ikke smeltet strukturelle VSV proteiner (figur 1A), er det bare oppdaget etter VSV oppføringen og gene expression starter. Alle celler ble deretter merket med cellen levedyktighet fargestoff som fritt passerer gjennom plasma membran av celler, hvor det konverteres til et membran-impermeant produkt, som fremmer oppbevaring av fluorescerende signalet i merkede celler. Bildene ble anskaffet hver 5 h til 65 hpi, bruker 405 nm, 488 nm, 568 nm og hvitt lys filtre for å fange celle levedyktighet fargestoff, VACV-FL-GFP, VSV-DsRed og fase kontrast (PC) kanaler, henholdsvis. Under enkelt infeksjon forhold begrense LD652 celler VSV-DsRed replikering; Derfor viser bare et lite antall celler et DsRed signal. Imidlertid resulterer coinfection av VSV-DsRed med VACV-FL-GFP i de fleste cellene viser DsRed signaler ved slutten av time course (figur 1B). Bilder tatt på hvert tidspunkt ble utsatt for analyseprogramvare, hvor 405 nm og 568 nm kanal bilder ble brukt til å automatisk finne totalt og DsRed-positive celle tall, henholdsvis. Prosent av celler viser et DsRed signal for hver behandling beregnes ved objekter (celler) med et positivt signal i 568-nm kanalen med antall objekter i 405 nm kanalen for hvert punkt, etterfulgt av multiplikasjon av 100% . Som vist i figur 1 c, var ~ 2% av cellene fra VSV-DsRed enkelt infeksjoner DsRed-positive ved 65 hpi. Derimot var ~ 77% av cellene i VSV-DsRed + VACV-FL-GFP coinfections DsRed-positive på dette tidspunkt. Filmer S1 og S2 vise progresjonen til VSV-DsRed infeksjon i løpet hele 65-h klokkeslett i én infeksjon og coinfection forhold, henholdsvis. Det er viktig å merke seg at det GFP uttrykket av VACV-FL-GFP ble synlig ved 10 hpi, før DsRed signalet, som angir at tilstrekkelig VACV genuttrykk er nødvendig før VSV-DsRed redning (vises ikke). Samlet indikerer disse resultatene klart en redning av VSV-DsRed replikering av VACV coinfection. Hvis en coinfecting virus kunne redde VSV-DsRed, forventer vi samme prosenter av DsRed-positive cellene mellom enkelt infeksjon og coinfection behandlinger.

VSV replikering i LD652 celler kan alternativt kvantifiseres bruker luminescence-baserte analyser ved VSV-LUC stammer (figur 2A). Som et eksempel, figur 2B viser resultatet av en LUC analysen med lysates utarbeidet en 72 h klokkeslett løpet uekte-infiserte celler eller celler som er infisert med VSV-LUC (MOI = 10) i tilstedeværelse eller fravær av VACV-WR (MOI = 25). En positiv redning VSV-LUC replikasjon angis med logaritmisk økningen i vilkårlig LU oppdaget med lysates utarbeidet av coinfected celler, i forhold til lysates fra enkelt VSV-LUC infeksjoner. Et negativt resultat ville være angitt i denne analysen av svikt i en coinfection å endre LU målingene fra de observert i enkelt VSV-LUC infeksjon behandlinger. Eventuelt forberedt lysates kan også brukes immunoblotting, å bekrefte forbedret VSV genuttrykk i coinfection behandlinger. For eksempel viser figur 2C et typisk immunoblot resultat for VSV-kodet LUC og matrise (M) proteiner i lysates utarbeidet av uekte-, VSV-LUC, og VSV-LUC + VACV-WR behandlinger 72 hpi. Immunoblotting for VACV I3L protein fungerte som en markør av VACV infeksjon, og immunoblotting for mobilnettet begrepsordbok ble brukt som en lasting. Klart styrking av VSV-kodet LUC og M proteiner i coinfection lysates videre bekrefte VSV redning av VACV. Til slutt, produktiv VSV replikering kan bekreftes ved å samle supernatants fra disse LD652 cellekulturer og titrating en smittsom virus på BSC-40 monolayers (figur 2D). Dette resultatet viser at bare under VACV coinfection ikke VSV produktivt Repliker.

Når en coinfecting virus vises i stand til rescuing VSV replikering i LD652 celler, kan RNAi screening brukes til å identifisere faktorer kodet av coinfecting virus som bidrar til VSV redning. I dette eksperimentet, skjermen for en RNAi tilstand som fører til en "tap av rescue" fenotypen under VSV-LUC coinfection redde virus. Vi har tidligere identifisert VACV A51R protein som VSV redning faktor gjennom en RNAi screening av dusinvis av VACV-kodet transkripsjoner13. Som et eksempel, har vi recapitulated en mindre skala versjon av dette skjermbildet (Figur 3). RNAi er formidlet av transfection in vitro transkribert dsRNAs at målet transkripsjoner kodet av coinfecting virus. Dataene vises her, var viral transkripsjoner koding VACV A50R, A51R og A52R proteiner mål for RNAi knockdown. Som en negativ kontroll for tap av redning, celler ble også transfekterte med dsRNAs målretting GFP-koding transkripsjoner. Som en positiv et tap på redning fenotype, celler var transfekterte med dsRNAs mot LUC-koding transkripsjoner. Denne behandlingen produserer sterk tap av LU signal coinfection og hjelper forskere bekrefter at transfection/RNAi protokoller arbeider. Etter 5 h dsRNA hva, celler var coinfected med VSV-LUC (MOI = 10) og VACV-WR (MOI = 25). Separat infeksjoner med bare VSV-LUC ble også utført for å skape bakgrunn av LU signal. Lysates ble da høstes 72 hpi og brukes i en LUC analysen. Sammenligne nivået på VSV redning over dsRNA behandlinger på GFP dsRNA kontroll behandlingen, indikerer resultatene at knockdown av VACV A51R gir sterk tap av redning fenotype, mens knockdown A50R og A52R genererer et negativt resultat (uten tap av Rescue sammenlignet med GFP dsRNA).

Som et alternativ til RNAi screening for å identifisere viral faktorer som bidrar til VSV redning, overexpress kandidat viral faktorer i LD652 celler og deretter analysen for VSV-LUC redning. Dette kan oppnås ved kloning kandidat gener av interesse i riktig uttrykk vektorer som p16629 og transfecting disse plasmider i LD652 celler før VSV-LUC utfordringen. Som et eksempel, figur 4A viser en redning eksperiment der flagg-merket GFP (FGFP) og flagg-merket A51R (FA51R) p166 vektorer var transfekterte i LD652 celler i ulike konsentrasjoner, etterfulgt av VSV-LUC infeksjon (MO = 10) 24 timer senere. Som en negativ kontroll for VSV redning, flere kulturer var uekte-transfekterte og får ikke plasmider DNA. Lysates var samlet inn fra kulturer 72 hpi og ble utsatt for LUC analyser. FA51R behandlinger produsert et positivt VSV redning resultat som demonstrert av forbedret LU signaler over uekte-transfekterte behandlinger på flere doser. FGFP behandlinger var derimot negative for VSV redning på noen dose testet. Immunoblotting av lysates fra figur 4A bekreftet en lignende uttrykk for FGFP og FA51R proteiner (figur 4B).

Bruker en RNAi screening av kandidaten L. dispar faktorer, vi har vist at begrensning VSV i LD652 celler er formidlet av flere cellulære faktorer tilhører antiviral RNAi veier (f.eks AGO2 og Dicer-2), kjernefysiske faktor Kappa B (NF-κB)-relaterte IMD pathway (f.eks velsmak), og ubiquitin-proteasome (f.eks., polyubiquitin)13. Som et eksempel, har vi gjentatt en mindre skala versjon av disse RNAi eksperimenter med dsRNAs målretting L. dispar utskrifter som forbedret VSV-LUC replikering på knockdown (f.eks., AGO2, Dicer-2, Relish, polyubiquitin) eller hadde ingen effekt (AGO1 )13. Etter 24 h dsRNA hva, ble celler utfordret med VSV-LUC 72 h å avgjøre hvis RNAi behandlinger forbedret LU signaler over negativ kontroll GFP dsRNA behandlinger. RNAi behandlinger som forbedrer LU signaler indikerer at faktoren kodet av målrettet transkripsjon begrenser VSV replikering. Som en positiv kontroll for RNAi knockdown, dsRNAs målretting LUC-koding transkripsjoner var også transfekterte i parallell behandlinger. På grunn av lav bakgrunnen LU signaler oppdaget i GFP dsRNA kontroll behandlinger, det var relativt enkelt å identifisere vert-kodet begrensning faktorer med RNAi screening fordi deres knockdown produserer ~ 10-1000 ganger økning i LU signaler ( Figur 5). Dermed er det mulig å dra nytte av relativt lav bakgrunnen nivå av VSV genuttrykk i LD652 celler til skjermen for verten RNAi knockdown forhold som lindre VSV begrensning.

Figure 1
Figur 1: identifisering av VSV redning av virus coinfection av LD652 celler med fluorescens-basert live-celle imaging. (A) dette panelet viser en skjematisk av en VSV-DsRed genomet som viser DsRed (dR) genet plasseringen. (B) disse representant 10 X AC confocal mikroskopi bilder er fanget 60 hpi. 405 nm kanalen viser en flekk for levedyktig celler, 488-nm kanalen angir VACV-FL-GFP infeksjon, og 568 nm kanalen angir VSV-DsRed infeksjon. Fase kontrast (PC) bilder vises også. Skalere barer = 100 µm. (C) dette panelet viser prosentandelen av DsRed-positive LD652 celler gjennom hele 65 h infeksjon tid. Betyr (SD) andelen cellene viser et DsRed signal for hvert punkt vises. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: vurdering av VSV redning i LD652 celler ved hjelp av LUC analyser. (A) dette panelet viser en skjematisk av en VSV-LUC genom. (B) dette panelet viser vilkårlig lyset enheter (LUC) analyser av lysates fra uekte-infiserte celler eller celler som er infisert med VSV-LUC, i fravær eller tilstedeværelse av VACV-WR. (C) dette panelet viser en immunoblot av LUC, VSV M, VACV I3L, og cellulær begrepsordbok proteiner i lysates A -panelet samlet 72 hpi. (D) dette panelet viser VSV-LUC titers i kultur supernatants fra panelet B. Kvantitative data i paneler B og D representerer midler (± SD) fra eksperimenter utført i tre eksemplarer. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: Identifikasjon av en virally-kodet VSV redning faktor gjennom RNAi screening under coinfection av LD652 celler. Dette panelet viser fold endringer i LU oppdaget i lysates fra celler 72 hpi VSV-LUC og VACV-WR etter angitt RNAi behandling, i forhold til LU oppdaget i lysates fra cellene enkeltvis infisert med VSV-LUC. Data representerer betyr (± SD) fra eksperimenter utført i tre eksemplarer. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: redning av VSV ved overuttrykte av en viral immunomodulator i LD652 celler. (A) dette panelet viser en LUC analysen fra VSV-LUC-infiserte celler 72 hpi som var uekte-transfekterte (mock) eller transfekterte med FGFP eller FA51R p166 uttrykk plasmider. LU signaler fra hver behandling var normalisert til signaler i uekte-transfekterte kontroll behandlinger. Data representerer betyr (± SD) fra eksperimenter utført i tre eksemplarer. (B) dette panelet viser lysates fra panelet A, immunoblotted med flagg og utgangen antistoffer. Klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: Identifikasjon av vert faktorer begrense VSV replikering i LD652 celler gjennom RNAi screening. Dette panelet viser fold endre i LU signaler i angitt RNAi behandlinger i forhold til den GFP dsRNA kontroll behandlinger 72 hpi med VSV-LUC. Data representerer betyr (± SD) fra eksperimenter utført i tre eksemplarer. Klikk her for å se en større versjon av dette tallet.

Film S1: representant 405-nm (celle levedyktighet fargestoff) og 568 nm (DsRed) kanal bilder tatt en 65 h klokkeslett løpet (hver ramme = 5 h intervall) etter VSV-DsRed infeksjon av LD652 celler. Klikk her for å laste ned denne filen.

Film S2: representant 405-nm (celle levedyktighet fargestoff) og 568 nm (DsRed) kanal bilder tatt en 65 h klokkeslett løpet (hver ramme = 5 h intervall) etter coinfection av LD652 celler med VSV-DsRed og VACV-FL-GFP. Klikk her for å laste ned denne filen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Her har vi beskrevet enkel fluorescens - og luminescence-baserte analyser til skjermen for forhold som redde VSV replikering i restriktiv Lepidoptera cellekulturer. Mislykket infeksjon av VSV i Lepidoptera celler oppretter en utmerket signal-til-støy-forhold når assaying for VSV genuttrykk. For eksempel LU signalene oppdaget i lysates fra enkelt VSV-LUC-infeksjoner ble ~ 1000 ganger høyere enn i uekte-infiserte lysates, men disse signalene bare forandret ca todelt en 72-h klokkeslett løpet. Derimot coinfection av VSV-LUC med VACV forbedret LU signaler ~ 300-fold over enkelt VSV-LUC infeksjoner av 72 hpi. Dermed viser VSV redning analyser en god dynamisk rekkevidde, omfatter flere størrelsesordener.

En av de avgjørende skritt i å sette opp disse analyser innebærer beslutningen om å analysen for VSV redning bruke fluorescens - eller luminescence-baserte tilnærminger. Vi har vist eksempler på hvordan VSV-kodede DsRed signaler kan være assayed kvantitativt ved hjelp av live-celle Bildeteknikker og programvarepakker som letter den automatiserte kvantifiseringen av DsRed-positive celler i fravær eller tilstedeværelse av en redning Coinfection. Hvis forskerne har tilgang til live-celle tenkelig evner, er disse analyser billig å sette opp og tillate dem å ta et bredt spekter av tiden punkter som kan hjelp i deteksjon av forskjeller i VSV replikasjon kinetikk som eneste observerbare i smale tid Windows. Derimot luminescence tilnærminger er i hovedsak end-point analyser som krever utarbeidelse av celle lysates på forhåndsdefinert tidspunkt, og lysate forberedelse kan være tidkrevende. På den annen side, de luminescence-baserte analyser krever ikke avanserte mikroskopi utstyr-bare en plate leser kan lese luminescence signaler. Videre har luminescence-baserte analyser et større dynamisk område enn mikroskopi-baserte analyser som beregner prosenten av celler som er infisert. For eksempel i mikroskopi analyser, DsRed-positive celler (angir VSV-DsRed infeksjon) kan bare variere fra 0-100% av analyserte celler i en synsfelt. Derimot kan LU signaler mellom enkelt VSV-LUC og coinfection forhold (eller andre redning forhold) variere over flere størrelsesordener.

En viktig fordel med å bruke VSV -L. dispar cellen systemet presenteres her til skjermen for pattedyr virus-kodede immunomodulators er at den iboende velger for identifikasjon av viral faktorer som hemmer hva er sannsynlig å være bevart og gamle antivirale svar som er eldre enn virveldyr-spesifikke interferon svaret. Faktisk foreslår foreløpige observasjoner at A51R proteiner hemme bevarte antiviral ubiquitin-proteasome-relaterte mobilnettet svar (se Gammon et al. 13 og upubliserte data). Oppdagelsen av VACV A51R redning av VSV var det første eksempelet på en heterologous virus hjelpe av virveldyr virus i en virvelløse vert13, og det er sannsynlig at disse screening systemer vil avdekke flere virveldyr virus-kodede immunomodulators . Det er viktig å merke seg at nøkkelen til å bruke VSV redning som en avlesning for forhold som hemmer vert immunitet er at VSV replikering må være sterkt begrenset (eller mislykket) i celle type som VSV replikering er undersøkt i. Derfor ville mest pattedyr celletyper trolig være uegnet for disse typer analyser, gitt at VSV replikerer i pattedyrceller. Derfor L. dispar celler ble brukt som en naturlig restriktive verten celle type for VSV.

En tidligere studie i Drosophila celler viste at viral suppressors antiviral RNAi svar kan identifiseres ved cotransfection av uttrykket plasmider koding kandidaten RNAi suppressors og en selvreplikerende Flock House virus genomisk RNA som koder GFP i stedet for B2, sin naturlige RNAi suppressor30. Replikering av Flock House genomisk RNA og produksjon av GFP var avhengig av undertrykkelse av RNAi ved cotransfected kandidat faktoren, og dermed redning av GFP uttrykk indikerte RNAi undertrykkelse30. Våre upublisert arbeid angir at overuttrykte virus-kodede RNAi hemmere også redder VSV-LUC genuttrykk i L. dispar celler, noe som tyder på at dette systemet kan også brukes til å identifisere suppressors RNAi svar i forbindelse med infeksjon av en bona fide viral patogen i motsetning til en replicon. Faktisk antyder finne at RNAi - IMD- og ubiquitin-proteasome-relaterte veier bidra til begrensning VSV replikering i L. dispar celler13 at viral antagonister av flere antiviral kan identifiseres ved VSV redde analyser presenteres her.

En potensiell begrensning av disse screening metoder når det gjelder identifisering av verten antiviral proteiner er at det L. dispar Genova orden ikke er ennå tilgjengelig. Men det er offentlig tilgjengelig L. dispar transcriptomes som kan brukes til å identifisere kandidat vert mål for RNAi knockdown26,27,28. I tillegg har vi vist tidligere at VSV er begrenset i cellelinjer avledet fra andre lepidopterans13 som nå har et offentlig tilgjengelig genom (f.eks Manduca sexta)31. Derfor kan linjer fra andre lepidopterans med sekvensert genomer erstatte L. dispar cellene beskrevet i protokollen her.

Gitt den økende økonomiske og folkehelsen trusselen om arboviruses32, kan screening analyser presenteres her gi romanen strategier for å identifisere nye funksjoner i arbovirus-vert interaksjoner som kan ha verdi i utformingen av nye antivirale Therapeutics. Videre, på grunn av vår relativt begrenset forståelse av Lepidoptera mekanismer for å begrense RNA-virus replikering, verktøyene presenteres her gi nye muligheter til å undersøke vert forsvarsmekanismer kodet med dette økonomisk viktigste orden av insekter.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

D.G. ble støttet av finansiering fra University of Texas Southwestern Medical Center utstyrt Scholars Program. Forfatterne takker Michael Whitt (The University of Tennessee Health Science Center) og Sean Whelan (Harvard Medical School) for levering av VSV-DsRed og VSV-LUC. Forfatterne takker også Gary Luker (University of Michigan Medical School) for type gave VACV FL GFP belastningen.

Materials

Name Company Catalog Number Comments
6-well tissue culture plates CELLTREAT 229106
24-well tissue culture plates CELLTREAT 229124
10 cm tissue culture dishes Corning C430167
Grace’s Insect Medium Sigma G8142
EX-CELL 420 Sigma 14420C
Fetal Bovine Serum - Optima Atlanta Biologicals S12450
Growth medium 1:1 mixture of Grace's Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1% antibiotic-antimycotic solution and 10% Fetal bovine serum
Antibiotic-Antimycotic Solution (100×) Sigma A5955
Dulbecco’s Phosphate Buffered Saline (DPBS) Sigma D8662
Serum Free Media (SFM) Thermo Fisher 10902096
Cytosine arabinoside Sigma C1768
Transfection reagent Thermo Fisher 10362100
Corning cellgro DMSO (Dimethyl Sulfoxide) Corning 25950CQC
Reporter lysis buffer 5x Promega E3971
Luciferase Assay Reagent Promega E1483
96-Well Microplates Corning 3915
Mouse anti-FLAG antibody Wako 014-22383
Rabbit anti-firefly luciferase antibody Abcam ab21176
Mouse anti-actin antibody Sigma A2066
Mouse anti-VSV M N/A N/A Dr. John Connor (Boston University)
Mouse anti-VACV I3L N/A N/A Dr. David Evans (University of Alberta)
8-well Chambered dish Lab-Tek II 155409
Cell viability dye Thermo Fisher C12881
FLUOstar microplate reader BMG Labtech FLUOstar
Confocal microscope Olympus FV10i-LIV
Image analysis software Olympus v1.18 cellSens software
Eppendorf 5702 ventilated centrifuge Eppendorf 22628102
Odyssey Fc Infrared Imaging System Li-COR Biosciences Odyssey Fc
LD652 cells N/A N/A Dr. Basil Arif (Natural Resources Canada)
BSC-40 cells ATCC CRL-2761
BHK cells ATCC CCL-10
HeLa cells ATCC CCL-2
BSC-1 cells ATCC CCL-26
in vitro transcription and purification kit Thermo Fisher AM1626
PCR purification kit Qiagen 28104

DOWNLOAD MATERIALS LIST

References

  1. Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. Viral tropism. Frontiers in Microbiology. 3, 281 (2012).
  2. Werden, S. J., McFadden, G. The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus. Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784, (1), 228-237 (2008).
  3. McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. Cytokine determinants of viral tropism. Nature Reviews: Immunology. 9, (9), 645-655 (2009).
  4. Silva, J. M., et al. Second-generation shRNA libraries covering the mouse and human genomes. Nature Genetics. 37, (11), 1281-1288 (2005).
  5. Moffat, J., et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell. 124, (6), 1283-1298 (2006).
  6. Ma, D., Liu, F. Genome Editing and Its Applications in Model Organisms. Genomics Proteomics Bioinformatics. 13, (6), 336-344 (2015).
  7. Yin, H., Kauffman, K. J., Anderson, D. G. Delivery technologies for genome editing. Nature Reviews: Drug Discovery. 16, (6), 387-399 (2017).
  8. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, (7206), 890-893 (2008).
  9. Houzet, L., Jeang, K. T. Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis. Experimental Biology and Medicine. 236, (8), Maywood, NJ. 962-967 (2011).
  10. Marceau, C. D., et al. Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens. Nature. 535, (7610), 159-163 (2016).
  11. Savidis, G., et al. Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics. Cell Reports. 16, (1), 232-246 (2016).
  12. Panda, D., Cherry, S. Cell-based genomic screening: elucidating virus-host interactions. Current Opinion in Virology. 2, (6), 784-792 (2012).
  13. Gammon, D. B., et al. A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection. Elife. 3, (2014).
  14. Letchworth, G. J., Rodriguez, L. L., Del cbarrera,, J, Vesicular stomatitis. Veterinary Journal. 157, (3), 239-260 (1999).
  15. Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones. Proceedings of the National Academy of Sciences of the United States of America. 92, (18), 8388-8392 (1995).
  16. Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization. PLoS Pathogens. 5, (4), e1000394 (2009).
  17. Duntsch, C. D., et al. Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model. Journal of Neurosurgery. 100, (6), 1049-1059 (2004).
  18. Li, Y., Yuan, S., Moyer, R. W. The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus. Virology. 248, (1), 74-82 (1998).
  19. Seet, B. T., et al. Poxviruses and immune evasion. Annual Review of Immunology. 21, 377-423 (2003).
  20. Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. Preparation of Cell Cultures and Vaccinia Virus Stocks. Current Protocols in Microbiology. 39, 11-18 (2015).
  21. Andrei, G., et al. Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice. Journal of Virology. 80, (19), 9391-9401 (2006).
  22. Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. Preparation of recombinant vaccinia virus for expression of small GTPases. Methods in Enzymology. 174-188 (1995).
  23. Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection. Bio-Protocol. 7, (22), (2017).
  24. Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread. Virology. 341, (2), 284-300 (2005).
  25. Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. Vaccinia reporter viruses for quantifying viral function at all stages of gene expression. Journal of Visualizes Experiments. (87), e51522 (2014).
  26. Cao, C., et al. Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance. Pesticide Biochemistry and Physiology. 119, 54-61 (2015).
  27. Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis. PloS One. 8, (5), e61190 (2013).
  28. Sparks, M. E., Gundersen-Rindal, D. E. The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts. Viruses. 3, (11), 2339-2350 (2011).
  29. Lin, G., Li, G., Granados, R. R., Blissard, G. W. Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion. In Vitro Cellular & Developmental Biology - Animal. 37, (5), 293-302 (2001).
  30. Li, W. X., et al. Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing. Proceedings of the National Academy of Sciences of the United States of America. 101, (5), 1350-1355 (2004).
  31. Kanost, M. R., et al. Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta. Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).
  32. Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases. BMJ Global Health. 3, (2018).
Arbovirus infeksjoner som Screening verktøy for identifikasjon av Viral Immunomodulators og vert Antiviral faktorer
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).More

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter