Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Arbovírus infecções como ferramentas de triagem para a identificação de fatores Antiviral Viral de imunomoduladores e Host

doi: 10.3791/58244 Published: September 13, 2018

Summary

Aqui, apresentamos os protocolos para identificar imunomoduladores 1) vírus-codificado que promovem a replicação de arbovírus e fatores do hospedeiro 2) eucariota que restringem a replicação de arbovírus. Esses métodos baseados em fluorescência e luminescência permitem aos investigadores para rapidamente obter leituras quantitativas de replicação de arbovírus em simplistas ensaios com baixa relação sinal-ruído.

Abstract

Interferência do RNA - e genoma de edição com base em plataformas de triagem têm sido amplamente utilizados para identificar fatores de célula do hospedeiro que restringem a replicação do vírus. No entanto, essas telas geralmente são realizadas em células que são naturalmente permissivas ao patógeno viral sob estudo. Portanto, a replicação robusta de vírus em condições de controle pode limitar a gama dinâmica dessas telas. Além disso, estas telas podem ser incapazes de identificar facilmente os caminhos de defesa celular que restringem a replicação do vírus, se o vírus é capaz de combater as defesas antivirais e adaptado para o host. Neste artigo, descrevemos um novo paradigma para explorar interações vírus-hospedeiro com o uso de telas o centro na naturalmente abortiva infecções por arbovírus, tais como o vírus da estomatite vesicular (VSV). Apesar da capacidade de VSV para replicar em uma ampla gama de inseto frequentes e hospedeiros mamíferos, VSV sofre uma infecção pós-entrada, abortiva em uma variedade de linhas de células derivadas de insetos lepidópteros, como a mariposa cigana (mariposa dispar). No entanto, essas infecções de VSV abortiva podem ser "resgatadas" quando as defesas antivirais de célula do hospedeiro estão comprometidas. Descrevemos como VSV cepas codificação genes repórter conveniente e restritivas dispar L. linhagens celulares podem ser emparelhadas com telas de configuração para identificar fatores do hospedeiro envolvidos na restrição de arbovírus. Além disso, mostramos também a utilidade dessas ferramentas de triagem na identificação dos fatores virally codificados que resgatar replicação VSV durante co-infecção ou por meio de expressão ectópica, incluindo aqueles codificada pelo vírus de mamíferos. A restrição natural de replicação de VSV nas células dispar L. fornece uma alta relação sinal-ruído quando rastreio para as condições que promovem o resgate VSV, permitindo assim o uso de simplista da luminescência e fluorescência-ensaios - based para monitorar as mudanças na replicação de VSV. Essas metodologias são valiosas para a compreensão da interação entre respostas antivirais hospedeiro e fatores de evasão imune viral.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A capacidade de um vírus de forma produtiva replicar em um host específico em parte rege-se pela disponibilidade de fatores de célula do hospedeiro que suportam entrada viral e replicação1. A gama de vírus-host também pode ser ditada pela capacidade de um vírus para contador celular antiviral as defesas que caso contrário iria impedir a replicação viral2,3. É o resultado dessas interações vírus-hospedeiro complexo que, finalmente, decidir se um vírus serão capaz de completar o seu ciclo de vida em um host específico. Dadas as consequências potencialmente patogénicas para o host se segue de replicação viral, é fundamental para desenvolver estratégias experimentais para promover nossa compreensão das interações vírus-hospedeiro chave que pode desequilibrar a balança entre abortivo e produtivo infecções. Elucidar as características moleculares da interação vírus-hospedeiro será fundamental para o desenvolvimento de novas e alternativas estratégias terapêuticas antivirais.

Com o advento do RNA de interferência (RNAi)4,5 e as ferramentas de edição do genoma (EG., CRISPR-Cas9, zinco dedo nucleases, TALENs)6,7, tornou-se viável experimentalmente para alterar a expressão de fatores celulares em todo o genoma escalas e explorar o impacto dessas alterações na replicação do vírus. Com efeito, foram realizadas numerosos RNAi e telas do genoma-edição-baseado em tipos de células do hospedeiro de invertebrados e vertebrados que têm revelado novas facetas do vírus-anfitrião interações8,9,10, 11 , 12. essas telas geralmente empregam vírus codificação repórteres, como luciferase de vaga-lume (LUC) ou proteínas fluorescentes (EG., GFP, DsRed), que fornecem um meio conveniente de avaliar quantitativamente a expressão de gene viral como uma leitura para a replicação viral9,12. Esta estratégia permite que os pesquisadores identificar os fatores do hospedeiro que ou promovem ou antagonizar a replicação viral, como evidenciado pela aumenta ou diminui, respectivamente, em repórter viral sinaliza9,12. No entanto, na maioria dos casos, estas telas foram realizadas usando vírus que são bem adaptados para o tipo de célula do hospedeiro em que eles estão sendo estudados. Enquanto esta estratégia pode ser importante para a compreensão coevolutionary relações entre patógenos virais e seus hospedeiros naturais, isso levanta preocupações fundamentais em relação a seu uso em descobrir fatores antiviral do hospedeiro. Nestes casos, um aperfeiçoamento no repórter vírus sinal em cima de RNAi "knockdown" está sendo procurado, ou a inativação de um fator celular que normalmente impede a replicação viral. Primeiro, se um vírus já é capaz de robustamente replicar na célula hospedeira, sendo examinada sob condições de controlo, a gama dinâmica da tela (ou seja, a capacidade de distinguir entre o fundo e sinais de maior repórter viral) pode ser limitada. Em segundo lugar, esta questão é ainda mais agravada pelas situações em que o vírus está bem adaptada para a célula hospedeira e eficaz na luta contra vias de defesa de anfitrião que estão a ser alvo na tela.

Devido as preocupações acima de interação vírus-hospedeiro tradicionais métodos de rastreio, desenvolvemos um novo paradigma para o estudo de interações vírus-hospedeiro que exploram infecções naturalmente abortivo arbovírus em células de insetos lepidópteros. Esta estratégia deriva de uma observação que o arbovírus humana estudada, VSV, sofre uma infecção abortiva em células derivadas de gypsy moth (L. dispar)13. VSV é naturalmente transmitida por insectos frequentes (ou seja, areia moscas) para hospedeiros mamíferos e tem sido demonstrado experimentalmente para infectar uma grande variedade de invertebrados e vertebrados hospedeiros em celulares cultura e na vivo14. 11-kb sentido negativo single-stranded RNA genoma de VSV codifica cinco mRNAs subgenomic que cada um foram traduzidos para as proteínas que compõem o vírion envelopada. No entanto, sistemas de genética reversos VSV permitiram a criação de replicação competente cepas codificação LUC ou proteínas fluorescentes, além de cinco natural VSV gene produtos15,16,17. Porque estas proteínas repórter não são incorporadas o vírion VSV, eles fornecem uma leitura conveniente para expressão de gene VSV que ocorre após a entrada. Usando cepas VSV codificação GFP ou LUC, anteriormente mostramos que a expressão gênica VSV é severamente restringido aquando da entrada das células LD652 e que títulos VSV não aumentam por infecção pós de 72 horas (hpi). Em contraste, a co-infecção de LD652 células com VSV e o poxvírus mamíferos, vírus vaccinia (VACV), conduz a aumentos logarítmicos na expressão gênica VSV e títulos por este ponto de tempo. VACV sofre a expressão de gene inicial, replicação do DNA e tarde expressão gênica em infecções de células LD652, mas o ciclo de replicação VACV é abortivo, finalmente, devido à incompleta do virion morfogênese18. O genoma de DNA ~ 192 kb grande de VACV codifica proteínas > 200, muitos dos quais exibem propriedades immunomodulatory que promovem a replicação viral através da supressão de respostas imunes do anfitrião19. Portanto, formulamos a hipótese que o "resgate" de replicação VSV nas células LD652 por co-infecção VACV foi provavelmente mediado por VACV imunomoduladores que inibiu dispar L. respostas normalmente restringir a replicação de VSV. Em apoio isso, o tratamento de células LD652 com inibidor anfitrião RNA polimerase II actinomicina D também resgata a replicação do VSV nas células LD652, indicando que as respostas do hospedeiro dependente de transcrição bloqueiam VSV replicação pós-entrada13.

As observações acima sugerem que a natureza naturalmente restritiva de LD652 células à infecção VSV pode fornecer um fundo relativamente baixo, quando o rastreio para as condições que aumentam os sinais codificados VSV repórter (ou seja, aqueles que inibem o anfitrião defesas antivirais). Aqui, nós fornecemos os métodos para usando fluorescência ou ensaios baseados em LUC a tela para as condições que aliviar a restrição de VSV nas células lepidópteros. Primeiro, mostramos como estes ensaios podem ser usados para identificar fatores de imunomoduladores virally codificado que quebre a restrição de VSV também experiências de co-infecção ou por meio de expressão ectópica de fatores virais de candidato. Como exemplo, ilustramos como usamos estas técnicas de triagem para identificar proteínas codificadas poxvírus de A51R como uma nova família de fatores de imunomoduladores que resgatar a replicação de VSV, na ausência de outros fatores de poxvírus13. Em segundo lugar, ilustramos como RNAi triagem em infecções de célula restritivas VSV-LD652 pode ser usado para identificar diretamente fatores do hospedeiro eucarióticas envolvidos em arbovírus restrição13.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. geral mariposa dispar (LD652) celular e cultura de vírus

  1. Célula LD652 cultivo e chapeamento
    1. A cultura dispar L.-derivada LD652 células, manter uma monocamada de células em um meio de crescimento (Tabela de materiais), incubados a 27 ° C, sob atmosfera normal. Manter as células em pratos de tecido-cultura-Tratado de 10cm e passagem das células ao atingir 80% de confluência.
    2. A placa, desalojar aderente LD652 células da placa pipetando mídia repetidamente para a monocamada (estas células não exigem tripsinização para desalojar) e diluir a amostra em meios de crescimento para uma densidade aproximada de 1 x 105 células/mL. Pipete 1 mL da cultura/bem diluído de uma placa de 24. Sementes de um mínimo de tipo de replicar e três poços de tratamento para cada ponto de tempo (um máximo de oito tratamentos/placa).
    3. Permitir que as células a se contentar com um mínimo de 1 h.
  2. Preparação de vírus vaccinia
    1. Para preparar as existências de VACV, amplificar o vírus em HeLa20 de células ou células de rim de macaco verde africano (BSC-1 ou BSC-40 células)20,21,22.
      Nota: Tensão VACV Western Reserve (VACV-WR) funciona bem em ensaios descritos aqui.
    2. Titule VACV tensão através do ensaio da chapa no BSC-1 ou BSC-40 células20,22.
      Nota: Todos os indicaram multiplicidade VACV de infecção (MOI) descrito aqui para LD652 infecções de célula baseiam-se em títulos obtidos de ensaios de placa BSC-40.
  3. Preparação de vírus estomatite vesicular
    1. Para preparar ações VSV, amplifica o vírus no de células BHK23.
    2. Titule VSV pelo ensaio de placa na BSC-40 ou BHK célula monocamadas13,23.
      Nota: Todos MOIs de VSV descrito aqui para LD652 infecções de célula baseiam-se em títulos obtidos de ensaios de placa BSC-40.

2. baseado em fluorescência VSV resgate ensaio usando co-infecção e imagem latente da viver-pilha

  1. A propagação e a infecção de células LD652
    1. Placa 40.000 LD652 células/poço de uma câmara de 8 poços.
    2. Para a imagem latente viver-pilha baseada em fluorescência, use cepas VSV codificação de proteínas fluorescentes. Os experimentos apresentados aqui usam VSV-DsRed17, uma estirpe VSV recombinante que expressa a proteína de DsRed livre que não está fundida a qualquer outra proteína VSV.
      Nota: VSV infecção de células LD652 não é citopático por 96 hpi e, assim, a morte celular não é um fator de confundimento, ao avaliar a replicação de VSV dentro deste prazo.
    3. Preparar o VSV-DsRed e VACV-FL-GFP em uma mídia livre de soro (SFM; Tabela de materiais) em um MOI de 1 e 25, respectivamente.
      Nota: VACV-FL-GFP é uma estirpe VACV recombinante que expressa uma fusão entre LUC e GFP24. Usar um MOI de 25 ou maior para as estirpes VACV garante que todas as células LD652 são infectados13. Se usando um vírus diferente coinfecting, o MOI terá de ser determinado empiricamente pelo usuário. Cada tratamento de infecção deve ser configurado em poços duplicados e incluem tratamentos infectados por simulação em que apenas SFM é adicionado às células.
    4. Incube as celulas em 0,2 mL de inóculo para 2 h a 27 ° C.
    5. Lave as células com 0,5 mL/bem de mídia de crescimento.
    6. Incube as celulas em 25 μM de corante de viabilidade celular (Tabela de materiais) em meios de crescimento por 45 min a 27 ° C.
    7. A mídia de aspirar e lavar os poços 1 x 0,5 ml/bem para remover o corante em excesso.
    8. Manter as células em 0,3 mL/bem dos meios de crescimento.
  2. Viver a captura de imagem de célula
    1. Ligue um microscópio confocal 30 min de antecedência e carregar um prato de câmara de 8 poços.
      Nota: LD652 células podem ser fotografadas à temperatura variando entre 20 e 25 ° C, mas para condições ideais, a temperatura da sala deve ser ajustada a 27 ° C.
    2. Configure as definições de excitação/emissão adequadas para cada proteína marcador fluorescente para ser fotografada, bem como as configurações de imagem de contraste de fase.
    3. Ajuste a intensidade do laser para cada canal.
      Nota: Isto pode exigir a execução uma experiência piloto para determinar a gama de intensidades do sinal fluorescente observados ao longo do tempo a ser usado na experiência final.
    4. Usando o objectivo X 10, capturar as imagens de contraste e fluorescência de fase de cada bem cada 1 – 5 h para a duração da infecção até certo ponto o tempo desejado (ex., 48 – 72 hpi).
      Nota: É importante capturar vários campos de visão em cada poço para estimar com precisão as taxas de infecção em toda a cultura.
  3. Análise de imagem
    1. Use o software de análise de imagem para análise automatizada de imagem dos canais apropriados fluorescentes (EG., 405 nm, 488 nm, 568 nm).
    2. Para calcular a porcentagem de células que são infectadas, dividir o número total de células fluorescentes, indicando infecção VSV (ex., células DsRed positivo para infecções de VSV-DsRed) pelo número total de células viáveis, rotulado por tintura de viabilidade celular para cada campo de visão em todos os tratamentos.

3. general infecção Viral protocolo para ensaios de salvamento baseados em luminescência VSV nas células LD652

  1. Preparação do inóculo
    1. 30 min antes da infecção, descongelar as existências de VSV-LUC16 (um recombinante VSV estirpe que manifesta a sua enciclopédia vagalume luciferase proteína não fundida a qualquer outra proteína VSV). Se a análise para resgate de VSV-LUC durante co-infecção VACV, também descongele o vírus VACV-WR no gelo.
      Nota: Outros vírus (além de VACV-WR) podem resgatar VSV-LUC durante a co-infecção, mas isto terá que ser determinado empiricamente por cada usuário.
    2. Preparar o inóculo diluindo VSV-LUC na presença ou ausência de VACV-WR em SFM tal que um MOI de 10 e 25, respectivamente, é alcançado quando adicionando um volume total de inóculo de 0,2 mL/bem.
  2. Infecção das células
    1. Aspire maduro LD652 mídia cuidadosamente para evitar perturbar a monocamada e inocular 0,2 mL de vírus/poço. Este tempo é definido como 0 hpi. Adicione SFM estéril para poços adicionais para servir como "simulação infectados" tratamentos de controle negativo.
    2. Incube as celulas em inóculo para 2 h a 27 ° C.
    3. No hpi 2, remover o inóculo por aspiração e substituir com 1ml/bem LD652 meios de crescimento.
    4. Permitir que a infecção proceder hpi 24-72.

4. luciferase ensaio

  1. Preparação de lisados celulares
    1. Cuidadosamente, aspirar o sobrenadante e adicionar 1 mL de fosfato salino de Dulbecco (DPBS) / bem.
    2. Usando o êmbolo de uma seringa de 1 mL, raspe as células em DPBS.
    3. Transferir as células para um tubo de microcentrifugadora e centrifugar 400 x g por 20 min a 4 ° C.
    4. Enquanto isso, preparar a 1 diluição x 5 x repórter do lysis (RLB) em estéril H2O.
    5. Após a centrifugação, Aspire o DPBS sem perturbar o centrifugado.
    6. Ressuspender em 150 µ l de 1 a cada x RLB.
    7. Congelamento e descongelamento das amostras 1 x usando uma incubação de 5 min em um freezer-80 ° C, seguido de um rápido degelo em água à temperatura ambiente. Armazene os lysates a-80 ° C até que esteja pronto para analisar.
  2. Ensaio do luciferase
    1. Descongele os lysates no gelo.
    2. Adicionar 20 μL de lisado num poço de uma microplaca de 96 poços de preto ou branco sólido.
    3. Adicione 100 µ l de reagente de ensaio do luciferase a cada poço.
    4. Imediatamente, medir a intensidade da luz usando um luminómetro (configurações apropriadas para luminometers específico terá que ser determinado empiricamente pelo usuário).
  3. Análise do ensaio de luciferase
    1. Normalize a LU sinais para cada tratamento para leituras de LU obtidos de tratamentos controle (Representante resultados). Depois de pelo menos três experimentos independentes foram realizados, a média de que Lu obtido de cada grupo de tratamento/controle pode ser analisada por testes estatísticos adequados.

5. Immunoblot

  1. Use lysates extraído para os ensaios LUC para SDS-PAGE e immunoblotting subsequente, usando instrumentação e reagentes apropriados.

6. título de VSV de culturas de células de LD652

  1. Placa LD652 células conforme item 1.1.
  2. Viral infectar as células de acordo com a etapa 3.
  3. Nos pontos de tempo desejado, colete os sobrenadantes em tubos estéreis microcentrifuga.
  4. As células com 1.000 x g durante 10 minutos a 4 ° C de pelotas e transferir os sobrenadantes para tubos novos.
  5. Armazenar os sobrenadantes a-80 ° C ou proceder com titulação pelo ensaio de placa no BSC-40 células.
    Nota: Se titulada VSV de culturas de células LD652 que continha VACV, é aconselhável adicionar 100 μg/mL arabinoside de citosina (AraC) para os meios de cultura de BSC-40 dentro 2 hpi, para impedir que partículas residuais de VACV formando placas em monocamadas de BSC-4013. AraC é um inibidor da polimerase de DNA viral que bloqueia a replicação de DNA VACV25 mas não afeta a replicação de VSV.

7. variações de VSV baseada em luminescência resgatar ensaios em células de LD652: RNAi e experimentos de transfeccao Plasmideo

  1. Preparação do dsRNA por nocaute mediada por RNAi de viral ou hospedar transcrições
    1. Primeiras demão gene-específicas do projeto de cauda na extremidade 5' com a sequência do promotor T7 (TAATACGACTCACTATAGGG) para o alvo ou o vírus coinfecting (por exemplo, VACV) ou transcrições de mRNA dispar L. de interesse. Estas primeiras demão deve produzir um produto PCR do bp 400 – 600 por nocaute eficaz mediada por RNAi. Ver Gammon et al 13 para sequências da primeira demão costumava abaixo knockdown VACV ou dispar L. transcrições por RNAi mediada por dsRNA nas células LD652.
      Nota: Dispar L. mRNA transcritos podem ser identificados de publicou dispar L. bancos de dados de transcriptoma26,27,28.
    2. Gerar um DNA modelo através de RT-PCR (síntese do cDNA: 1 ciclo de 50 ° C por 30 min; PCR: 40 ciclos de 94 ° C por 15 s, 50 ° C por 30 s e 68 ° C por 45 s cada).
    3. Purifica o produto do PCR usando um kit de purificação de PCR.
    4. Usando o produto do PCR purificado como um modelo, em vitro transcrever e purificar dsRNA usando um em vitro transcrição e purificação kit.
  2. Transfecção de dsRNA ou plasmídeo em células LD652
    1. Semente de 1 x 105 células/poço de uma placa de 24 e deixar que as células se contentar com pelo menos 1 h.
    2. Para cada poço a transfected, dilua 4 µ l de reagente de transfeccao em 100 μL de SFM. Encube por até 15 min. à temperatura ambiente. Isto pode ser escalado para fazer uma mistura de mestre para todos os transfections a ser executada.
    3. Dilua até 1 μg de dsRNA ou total plasmídeo com 100 μL de SFM para cada poço a transfected. Encube por até 15 min. à temperatura ambiente.
      Nota: Anteriormente encontramos que um transfection de 1 μg de dsRNA/105 LD652 células é suficiente para > nocaute de 80% de qualquer viral ou hospedar transcrições13, mas dsRNA doses necessárias para modificado experimental set-ups/condições terá que ser determinada empiricamente.
    4. Combinar a transfeccao reagente e dsRNA/shRNA DNA as diluições com uma proporção de 1:1 (p. ex., 100 μL de dsRNA diluído é misturado com 100 µ l de reagente de transfeccao diluído) e incube por 20 min em temperatura ambiente.
    5. Enquanto isso, lavar os poços com 1ml/bem de SFM e em seguida, adicione 500 μL de SFM a cada poço.
    6. Adicionar lentamente o dsRNA reagente de transfeccao (ou plasmídeo) mistura gota a gota em cada poço.
    7. Incube o reagente de transfeccao com as células por 5h.
      1. Para RNAi experimentos envolvendo a derrubada de transcrições codificado por um vírus coinfecting (por exemplo, VACV), substituir o reagente de transfeccao após o período de incubação de 5-h transfecção com inóculo de vírus contendo VSV-LUC (com ou sem VACV ou outro vírus coinfecting) (passo 3). Posteriormente, substitua o inóculo de vírus contendo VSV-LUC com crescimento completa mídia 2 hpi. Ensaios LUC (etapa 4) então podem ser executados em lysates extraído em vários pontos de tempo para determinar se o nocaute de coinfecting transcrições de vírus leva a uma perda de resgate VSV-LUC.
      2. Para RNAi experimentos envolvendo RNAi de dispar L. transcrições, substituir a mistura de transfeccao com mídia de crescimento completo e permitir nocaute para ensue para 24 h antes da infecção com VSV-LUC (passo 4). Ensaios LUC (etapa 4) então podem ser executados em lysates extraído em vários pontos de tempo para determinar se o nocaute de dispar L. transcrições promove resgate VSV-LUC.
      3. Para os experimentos envolvendo transfections de vetores de expressão do plasmídeo expressando candidato imunomoduladores, substituir o reagente de transfeccao e permitir a expressão da proteína durante 24 h antes da infecção com VSV-LUC (passo 4). Ensaios LUC (etapa 4) então podem ser executados em lysates extraído em vários pontos de tempo para determinar se a expressão de proteínas de imunomoduladores candidato promove resgate VSV-LUC.
        Nota: As transfeccao condições descritas aqui usando 1 μg/poço de resultado de DNA do plasmídeo em eficiências de Transfeccao de 40 – 60%13.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Como um exemplo de aplicativos de imagem ao vivo-celular para monitorar o resgate VSV sobre co-infecção VACV, LD652 células foram banhadas em um prato de 8 poços septado e mock-infectado ou infectadas com VSV-DsRed (MOI = 1) na presença ou ausência de VACV-FL-GFP (MOI = 25). Porque VSV-DsRed expressa DsRed como livre de proteínas e não é fundido para proteínas estruturais de VSV (figura 1A), só é detectado após a expressão de gene e entrada VSV inicia. Todas as células foram então rotuladas com tintura de viabilidade celular que passa livremente através da membrana plasmática das células, onde é convertido em um produto de membrana-impermeant, que promove a retenção do sinal fluorescente em pilhas etiquetadas. Imagens foram adquiridas todas as 5h até 65 hpi, usando a 405 nm, 488 nm, 568 nm e branco luz filtros para capturar o corante de viabilidade celular, VACV-FL-GFP, VSV-DsRed e canais (PC) de contraste de fase, respectivamente. Em condições de infecção única, LD652 células restringem VSV-DsRed replicação; Portanto, apenas um pequeno número de células exibem um sinal DsRed. No entanto, a co-infecção de VSV-DsRed com VACV-FL-GFP resulta na maioria das células exibindo sinais de DsRed até ao final do curso de tempo (figura 1B). Imagens capturadas em cada ponto de tempo foram submetidas ao software de análise de imagem, onde 405 nm e 568 imagens de canal nm foram usadas para determinar automaticamente o total e o número de células DsRed positivo, respectivamente. A percentagem de células exibindo um sinal DsRed para cada tratamento é calculada dividindo objetos (células) com um sinal positivo no canal 568-nm pelo número de objetos identificados no canal 405 nm para cada ponto de tempo, seguido por multiplicação por 100% . Como mostrado na Figura 1, ~ 2% das células da VSV-DsRed única infecções eram DsRed-positivo por 65 hpi. Em contraste, ~ 77% das células de VSV-DsRed + formas VACV-FL-GFP foram DsRed positivo neste ponto do tempo. Filmes de S1 e S2 mostrar a progressão da infecção de VSV-DsRed ao longo de todo tempo de 65-h na única infecção e condições de co-infecção, respectivamente. É importante notar que a expressão de GFP por VACV-FL-GFP tornou-se detectáveis por 10 hpi, antes do sinal de DsRed, indicando que a expressão de gene VACV suficiente é necessário antes de VSV-DsRed resgate (não mostrado). Coletivamente, esses resultados indicam claramente um resgate de VSV-DsRed replicação por co-infecção VACV. Se um vírus coinfecting não pôde resgatar VSV-DsRed, esperaríamos iguais percentagens de células DsRed positiva entre infecção única e tratamentos de co-infecção.

Replicação de VSV nas células LD652 como alternativa pode ser quantificada utilizando ensaios baseados em luminescência quando usando cepas VSV-LUC (Figura 2A). Como exemplo, a Figura 2B mostra os resultados de um ensaio LUC usando lysates preparado ao longo de um curso de tempo de 72 h de células infectadas por simulação ou células infectadas com VSV-LUC (MOI = 10) na presença ou ausência de VACV-WR (MOI = 25). Um resgate positivo de replicação VSV-LUC é indicado pelo aumento arbitrário LU detectado com lisados preparados a partir de células co-infectados, em comparação com lysates de infecções simples do VSV-LUC logarítmico. Um resultado negativo iria ser indicado neste ensaio pelo fracasso de uma co-infecção alterar leituras LU daqueles observados em tratamentos de infecção único VSV-LUC. Se desejado, lysates preparado também pode ser usado para immunoblotting, para confirmar a expressão de gene VSV reforçada em tratamentos de co-infecção. Por exemplo, Figura 2 mostra um resultado típico immunoblot para LUC VSV-codificado e matriz (M) as proteínas em lysates preparados a partir de simulação-, VSV-LUC e VSV-LUC + VACV-WR tratamentos 72 hpi. Immunoblotting para proteína VACV I3L serviu como um marcador de infecção VACV e immunoblotting para celular actina foi usado como um controle de carregamento. A clara melhoria da proteínas LUC VSV-codificado e M os lysates co-infecção mais confirmar o resgate VSV por VACV. Finalmente, a replicação de VSV produtiva pode ser confirmada por coletando sobrenadantes destas culturas de células LD652 e titulada um vírus infeccioso em monocamadas BSC-40 (Figura 2D). Esse resultado ilustra que somente durante VACV co-infecção faz VSV produtivamente replicar.

Uma vez que um vírus coinfecting é mostrado capaz de salvar a replicação de VSV nas células LD652, triagem de RNAi pode ser usada para identificar fatores codificadas pelo vírus coinfecting que contribuem para o resgate VSV. Neste experimento, tela para uma condição de RNAi que leva a um fenótipo de "perda de resgate" durante a co-infecção VSV-LUC com um vírus resgatando. Anteriormente, identificamos a proteína VACV A51R como um fator de resgate VSV através de uma triagem de RNAi de dezenas de transcrições codificado VACV13. Como exemplo, podemos ter instaurada uma versão menor da escala desta tela (Figura 3). RNAi é mediada por transfecção in vitro transcrito dsRNAs transcrições codificadas pelo vírus coinfecting de destino. Os dados mostrados aqui, transcrições virais codificação de proteínas VACV A50R, A51R e A52R foram alvo de RNAi nocaute. Como um controle negativo para perda de resgate, as células foram também transfected com dsRNAs segmentação GFP-codificação transcrições. Como um controle positivo para uma perda de fenótipo de resgate, células foram transfectadas com dsRNAs contra LUC-codificação transcrições. Este tratamento produz uma forte perda de sinal de LU durante co-infecção e ajuda os pesquisadores confirmam que a transfeccao/RNAi protocolos estão funcionando. Após 5h de transfeccao dsRNA, as células eram co-infectados com VSV-LUC (MOI = 10) e VACV-WR (MOI = 25). Infecções separadas com apenas VSV-LUC também foram realizadas para estabelecer um nível de plano de fundo do sinal de LU. Lisados foram então colhidas 72 hpi e usado em um ensaio LUC. Comparando o nível de resgate VSV através do dsRNA tratamentos para o tratamento de controle de dsRNA GFP, os resultados indicam que o knockdown de VACV A51R produz uma forte perda de fenótipo de resgate, Considerando que o knockdown de A50R e A52R produz um resultado negativo (sem perda de resgate, em comparação com GFP dsRNA).

Como uma alternativa para RNAi rastreio para identificar fatores virais que contribuem para o resgate VSV, overexpress fatores virais de candidato nas células LD652 e depois do ensaio para o salvamento de VSV-LUC. Isso pode ser feito por clonagem de genes candidatos de interesse em vetores de expressão adequado como p16629 e transfecting estes plasmídeos em células de LD652 antes do desafio de VSV-LUC. Por exemplo, Figura 4A mostra um experimento de resgate em que bandeira-tag GFP (FGFP) ou com a bandeira-tag A51R (FA51R) p166 vetores foram transfectadas em células LD652 em várias concentrações, seguidas por infecção de VSV-LUC (MO = 10) 24 horas mais tarde. Como um controle negativo para resgate VSV, culturas adicionais foram transfectadas para simulação e não receberam Plasmídeo. Lisados foram coletados de culturas 72 hpi e foram submetidos a ensaios LUC. FA51R tratamentos produziram um resultado positivo de resgate VSV como demonstrado pelo reforçada LU sinais sobre tratamentos mock-transfectadas com múltiplas doses. Em contraste, tratamentos FGFP foram negativos para resgate VSV em qualquer dose testada. Immunoblotting dos lysates da Figura 4A confirmou uma expressão similar de proteínas FGFP e FA51R (Figura 4B).

Usando uma triagem de RNAi dos fatores de L. dispar candidato, temos mostrado que a restrição de VSV nas células LD652 é mediada por diversos fatores celulares pertencentes a caminhos de RNAi antivirais (p. ex., AGO2 e Dicer-2), o fator Nuclear Kappa B (NF-κB)-caminho de IMD relacionado (por exemplo, Relish)e o sistema ubiquitina-Proteassoma (EG., polyubiquitin)13. Como exemplo, repetimos uma versão menor da escala desses experimentos de RNAi com dsRNAs dispar L. transcrições que melhoravam a duplicação de VSV-LUC na derrubada de segmentação (ex., AGO2, Dicer-2, Relish, polyubiquitin) ou não teve efeito (AGO1 )13. Após 24h do transfection dsRNA, células foram desafiadas com VSV-LUC para 72 h para determinar se o RNAi tratamentos avançados LU sinais sobre tratamentos de dsRNA GFP controlo negativo. Tratamentos de RNAi que melhoram a LU sinais indicam que o fator codificado pelo alvo transcrição restringe a replicação de VSV. Como um controle positivo para knockdown RNAi, dsRNAs segmentação transcrições LUC-codificação também foram transfectadas em tratamentos paralelos. Devido o baixo fundo LU sinais detectados em tratamentos de controle do GFP dsRNA, era relativamente simples para identificar fatores de restrição anfitrião codificado usando RNAi triagem porque seu nocaute produz ~ 10-com aumentos 1,000-fold sinais de LU ( Figura 5). Assim, é possível aproveitar o fundo relativamente baixo nível de expressão do gene VSV nas células LD652 para a tela para anfitrião RNAi knockdown condições que aliviar a restrição de VSV.

Figure 1
Figura 1: identificação de resgate VSV por co-infecção de vírus de LD652 células usando a imagem latente da viver-pilha baseada em fluorescência. (A), este painel mostra um diagrama esquemático de um genoma de VSV-DsRed indicando a localização do gene DsRed (dR). Imagens de microscopia confocal (B) estes representante 10 X são capturados hpi 60. O canal de 405 nm indica uma mancha para células viáveis, o canal de 488 nm indica infecção VACV-FL-GFP e canal 568 nm indica infecção VSV-DsRed. Também são mostradas imagens de contraste (PC) de fase. Barras de escala = 100 µm. (C), este painel mostra a porcentagem de células positivas DsRed LD652 sobre o curso a tempo inteiro h 65 infecção. A percentagem média de (SD) das células mostrando um sinal DsRed para cada ponto de tempo é mostrada. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: avaliação de resgate VSV nas células LD652 usando ensaios LUC. (A), este painel mostra um diagrama esquemático de um genoma de VSV-LUC. (B) este painel mostra unidades arbitrárias de luz ensaios (LUC) de lisados de células infectadas por simulação ou células infectadas com VSV-LUC, na ausência ou presença de VACV-WR. (C), este painel mostra uma immunoblot de LUC, VSV M, VACV I3L e proteínas actina celulares nos lysates do painel A coletadas 72 hpi. (D) este painel mostra títulos VSV-LUC em sobrenadantes de cultura obtidos de painel B. Os dados quantitativos em painéis B e D representam os meios (± DP) de experimentos realizados em triplicata. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: identificação de um fator de resgate VSV virally codificado através de triagem de RNAi durante a co-infecção de células LD652. Este painel mostra alterações de dobra em LU detectado em lysates de hpi de 72 células com VSV-LUC e VACV-WR após o tratamento indicado de RNAi, em relação a LU detectado em lysates de células infectadas isoladamente com VSV-LUC. Os dados representam os meios (± DP) de experimentos realizados em triplicata. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4: resgate de VSV pela superexpressão de um imunomodulador viral em células de LD652. (A), este painel mostra um LUC do ensaio de VSV-LUC-células infectadas por 72 hpi que foram transfectadas de simulação (simulação) ou transfectadas com plasmídeo de expressão p166 FGFP ou FA51R. LU sinais de cada tratamento foram normalizados para sinais detectados em tratamentos de controle de simulação-transfectadas. Os dados representam os meios (± DP) de experimentos realizados em triplicata. (B), este painel mostra lysates do painel A, immunoblotted com bandeira e actina anticorpos. Clique aqui para ver uma versão maior desta figura.

Figure 5
Figura 5: identificação do host fatores restringindo replicação VSV nas células de LD652 a triagem de RNAi. Este painel mostra que a dobra muda em sinais de LU em tratamentos de RNAi indicados em relação a GFP dsRNA controle tratamentos 72 hpi com VSV-LUC. Os dados representam os meios (± DP) de experimentos realizados em triplicata. Clique aqui para ver uma versão maior desta figura.

Filme S1: representante 405 nm (tintura de viabilidade celular) e 568 imagens de canal nm (DsRed) absorveu ao longo de um curso de tempo 65 h (cada quadro = intervalo de 5 h) após VSV-DsRed infecção das células de LD652. Clique aqui para baixar este arquivo.

Filme S2: representante 405 nm (tintura de viabilidade celular) e 568 imagens de canal nm (DsRed) absorveu ao longo de um curso de tempo 65 h (cada quadro = intervalo de 5 h) após a co-infecção de LD652 células com VSV-DsRed e VACV-FL-GFP. Clique aqui para baixar este arquivo.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aqui descrevemos simples fluorescência e luminescência-ensaios - based para a tela para condições que resgatar a replicação de VSV em culturas de células de lepidópteros restritivas. A infecção abortiva de VSV nas células lepidópteros cria uma excelente relação sinal-ruído quando a análise de expressão gênica VSV. Por exemplo, eram os sinais de LU detectados em lysates do única infecções VSV-LUC ~ 1,000-fold superior em mock-infectados lisados, contudo estes sinais mudaram somente aproximadamente dupla um longo tempo de 72-h. Em contraste, a co-infecção do VSV-LUC com VACV reforçada sinais LU ~ 300-fold mais simples infecções VSV-LUC por 72 hpi. Assim, os ensaios de resgate VSV exibem uma excelente faixa dinâmica, englobando várias ordens de magnitude.

Um dos passos críticos na criação destes ensaios envolve a decisão de ensaio para resgate VSV usando abordagens baseadas em fluorescência ou luminescência. Mostramos exemplos de VSV-codificado como DsRed sinais podem ser analisados quantitativamente usando técnicas da imagem latente de viver-pilha e pacotes de software que facilitam a quantificação automatizada de células DsRed positivo na ausência ou presença de um resgate co-infecção. Se os pesquisadores têm acesso a recursos de imagens de viver-pilha, estes ensaios são baratos configurar e permitir-lhes capturar uma ampla gama de pontos de tempo que pode auxiliar na detecção de diferenças na cinética de replicação VSV que são observáveis somente no tempo estreito Windows. Em contraste, abordagens baseadas em luminescência são essencialmente os ensaios de ponto de extremidade que exigem a preparação de lisados celulares em pontos de tempo predeterminado e lisada preparação pode ser demorada. Por outro lado, os ensaios baseados em luminescência não exigem equipamentos sofisticados microscopia — apenas um leitor capaz de ler sinais de luminescência. Além disso, ensaios baseados em luminescência têm uma gama dinâmica maior do que ensaios baseados em microscopia que calcular a porcentagem de células infectadas. Por exemplo, em ensaios de microscopia, células DsRed-positivo (indicando infecção VSV-DsRed) só podem variar de 0 a 100% das células analisadas em um campo de visão. Em contraste, LU sinais entre único VSV-LUC e co-infecção condições (ou outras condições de resgate) podem variar ao longo de várias ordens de grandeza.

A principal vantagem de usar o sistema de célula de VSV -dispar L. aqui apresentado a tela para mamíferos imunomoduladores codificado vírus é que ele inerentemente seleciona para a identificação de fatores virais que suprimir o que são susceptíveis de ser conservado e antiga respostas antivirais que precedem a resposta de interferon vertebrado-específicos. Com efeito, observações preliminares sugerem que as proteínas A51R inibem conservadas antivirais ubiquitina-Proteassoma-relacionados respostas celulares (ver Gammon et al 13 e dados não publicados). A descoberta de VACV A51R resgate de VSV foi o primeiro exemplo de um resgate de vírus heterólogos por um vírus de vertebrados em um hospedeiro invertebrado13, e é provável que estes sistemas de triagem vão descobrir adicionais vertebrados imunomoduladores vírus-codificado . É importante notar que a chave para usar o resgate VSV como uma leitura para condições que inibem a imunidade do hospedeiro é a replicação de VSV deve ser fortemente restrito (ou abortada) no tipo de célula que replicação de VSV está sendo examinada no. Portanto, tipos de células de mamíferos mais provavelmente seria inadequados para esses tipos de ensaios, dado que VSV Replica bem em células de mamíferos. Eis porque dispar L. células foram utilizadas aqui como um tipo de célula do hospedeiro naturalmente restritivas para VSV.

Um estudo prévio em células de Drosophila mostrou que viral supressores de antiviral RNAi respostas poderiam ser identificados por cotransfection do plasmídeo de expressão codificação supressores de RNAi candidato e um auto-replicante rebanho casa vírus genoma RNA que codifica a GFP no lugar de B2, sua natural de supressor de RNAi30. A replicação do RNA genômico casa do rebanho e produção de GFP eram dependentes da supressão de RNAi pelo fator cotransfected candidato e, assim, o resgate da expressão de GFP indicado RNAi supressão30. Nosso trabalho não publicado indica que a superexpressão de inibidores de RNAi codificado vírus também resgata a expressão gênica VSV-LUC em células de L. dispar , sugerindo que este sistema também pode ser usado para identificar supressores de RNAi respostas no contexto da infecção por um patógeno viral bona fide em oposição a um Replicão. De facto, a conclusão de que o RNAi, IMD e vias ubiquitina-Proteassoma-relacionados contribuem para a restrição de replicação VSV em dispar L. células13 sugere que viral antagonistas de diversos caminhos antivirais podem ser identificadas pelo VSV ensaios de resgate aqui apresentados.

Uma limitação potencial desses métodos de triagem no que diz respeito a identificação das proteínas antivirais anfitrião é que a sequência do genoma de L. dispar ainda não está disponível. No entanto, existem disponíveis publicamente dispar L. transcriptomes que pode ser usado para identificar alvos de acolhimento do candidato para RNAi knockdown26,,27,28. Além disso, mostramos anteriormente que VSV é restrito em linhagens celulares derivadas de outros lepidópteros13 que agora têm um genoma publicamente disponível (por exemplo, Manduca sexta)31. Portanto, linhas de células derivadas de outros lepidópteros com genomas sequenciados podem substituir as células de dispar L. descritas no protocolo aqui.

Dado o crescimento económico e a ameaça de saúde pública de arbovírus32, os ensaios de rastreio aqui apresentados podem fornecer novas estratégias para identificar novos recursos de interações de arbovírus-host que podem ter valor na concepção do novo antiviral terapêutica. Além disso, por causa de nossa compreensão relativamente limitada de lepidópteros mecanismos para restringir a replicação de vírus de RNA, as ferramentas aqui apresentadas fornecem novas oportunidades para sondar os mecanismos de defesa do hospedeiro codificados por isso economicamente importante ordem de insetos.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

D.G. foi suportado pelo financiamento do programa de estudiosos do Universidade do Texas Southwestern Medical Center dotado. Os autores Obrigado Michael Whitt (The University of Tennessee Health Science Center) e Sean Whelan (Harvard Medical School) para a prestação de VSV-DsRed e VSV-LUC. Os autores também agradecer Gary Luker (Faculdade de medicina de Universidade de Michigan) o dom gentil da estirpe VACV-FL-GFP.

Materials

Name Company Catalog Number Comments
6-well tissue culture plates CELLTREAT 229106
24-well tissue culture plates CELLTREAT 229124
10 cm tissue culture dishes Corning C430167
Grace’s Insect Medium Sigma G8142
EX-CELL 420 Sigma 14420C
Fetal Bovine Serum - Optima Atlanta Biologicals S12450
Growth medium 1:1 mixture of Grace's Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1% antibiotic-antimycotic solution and 10% Fetal bovine serum
Antibiotic-Antimycotic Solution (100×) Sigma A5955
Dulbecco’s Phosphate Buffered Saline (DPBS) Sigma D8662
Serum Free Media (SFM) Thermo Fisher 10902096
Cytosine arabinoside Sigma C1768
Transfection reagent Thermo Fisher 10362100
Corning cellgro DMSO (Dimethyl Sulfoxide) Corning 25950CQC
Reporter lysis buffer 5x Promega E3971
Luciferase Assay Reagent Promega E1483
96-Well Microplates Corning 3915
Mouse anti-FLAG antibody Wako 014-22383
Rabbit anti-firefly luciferase antibody Abcam ab21176
Mouse anti-actin antibody Sigma A2066
Mouse anti-VSV M N/A N/A Dr. John Connor (Boston University)
Mouse anti-VACV I3L N/A N/A Dr. David Evans (University of Alberta)
8-well Chambered dish Lab-Tek II 155409
Cell viability dye Thermo Fisher C12881
FLUOstar microplate reader BMG Labtech FLUOstar
Confocal microscope Olympus FV10i-LIV
Image analysis software Olympus v1.18 cellSens software
Eppendorf 5702 ventilated centrifuge Eppendorf 22628102
Odyssey Fc Infrared Imaging System Li-COR Biosciences Odyssey Fc
LD652 cells N/A N/A Dr. Basil Arif (Natural Resources Canada)
BSC-40 cells ATCC CRL-2761
BHK cells ATCC CCL-10
HeLa cells ATCC CCL-2
BSC-1 cells ATCC CCL-26
in vitro transcription and purification kit Thermo Fisher AM1626
PCR purification kit Qiagen 28104

DOWNLOAD MATERIALS LIST

References

  1. Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. Viral tropism. Frontiers in Microbiology. 3, 281 (2012).
  2. Werden, S. J., McFadden, G. The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus. Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784, (1), 228-237 (2008).
  3. McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. Cytokine determinants of viral tropism. Nature Reviews: Immunology. 9, (9), 645-655 (2009).
  4. Silva, J. M., et al. Second-generation shRNA libraries covering the mouse and human genomes. Nature Genetics. 37, (11), 1281-1288 (2005).
  5. Moffat, J., et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell. 124, (6), 1283-1298 (2006).
  6. Ma, D., Liu, F. Genome Editing and Its Applications in Model Organisms. Genomics Proteomics Bioinformatics. 13, (6), 336-344 (2015).
  7. Yin, H., Kauffman, K. J., Anderson, D. G. Delivery technologies for genome editing. Nature Reviews: Drug Discovery. 16, (6), 387-399 (2017).
  8. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, (7206), 890-893 (2008).
  9. Houzet, L., Jeang, K. T. Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis. Experimental Biology and Medicine. 236, (8), Maywood, NJ. 962-967 (2011).
  10. Marceau, C. D., et al. Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens. Nature. 535, (7610), 159-163 (2016).
  11. Savidis, G., et al. Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics. Cell Reports. 16, (1), 232-246 (2016).
  12. Panda, D., Cherry, S. Cell-based genomic screening: elucidating virus-host interactions. Current Opinion in Virology. 2, (6), 784-792 (2012).
  13. Gammon, D. B., et al. A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection. Elife. 3, (2014).
  14. Letchworth, G. J., Rodriguez, L. L., Del cbarrera,, J, Vesicular stomatitis. Veterinary Journal. 157, (3), 239-260 (1999).
  15. Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones. Proceedings of the National Academy of Sciences of the United States of America. 92, (18), 8388-8392 (1995).
  16. Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization. PLoS Pathogens. 5, (4), e1000394 (2009).
  17. Duntsch, C. D., et al. Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model. Journal of Neurosurgery. 100, (6), 1049-1059 (2004).
  18. Li, Y., Yuan, S., Moyer, R. W. The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus. Virology. 248, (1), 74-82 (1998).
  19. Seet, B. T., et al. Poxviruses and immune evasion. Annual Review of Immunology. 21, 377-423 (2003).
  20. Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. Preparation of Cell Cultures and Vaccinia Virus Stocks. Current Protocols in Microbiology. 39, 11-18 (2015).
  21. Andrei, G., et al. Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice. Journal of Virology. 80, (19), 9391-9401 (2006).
  22. Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. Preparation of recombinant vaccinia virus for expression of small GTPases. Methods in Enzymology. 174-188 (1995).
  23. Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection. Bio-Protocol. 7, (22), (2017).
  24. Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread. Virology. 341, (2), 284-300 (2005).
  25. Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. Vaccinia reporter viruses for quantifying viral function at all stages of gene expression. Journal of Visualizes Experiments. (87), e51522 (2014).
  26. Cao, C., et al. Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance. Pesticide Biochemistry and Physiology. 119, 54-61 (2015).
  27. Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis. PloS One. 8, (5), e61190 (2013).
  28. Sparks, M. E., Gundersen-Rindal, D. E. The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts. Viruses. 3, (11), 2339-2350 (2011).
  29. Lin, G., Li, G., Granados, R. R., Blissard, G. W. Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion. In Vitro Cellular & Developmental Biology - Animal. 37, (5), 293-302 (2001).
  30. Li, W. X., et al. Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing. Proceedings of the National Academy of Sciences of the United States of America. 101, (5), 1350-1355 (2004).
  31. Kanost, M. R., et al. Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta. Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).
  32. Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases. BMJ Global Health. 3, (2018).
Arbovírus infecções como ferramentas de triagem para a identificação de fatores Antiviral Viral de imunomoduladores e Host
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).More

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter