Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Арбовирусных инфекций как скрининг инструменты для выявления вирусной иммуномодуляторов и принимающих противовирусное факторов

doi: 10.3791/58244 Published: September 13, 2018

Summary

Здесь мы представляем протоколы для идентификации 1) вирус кодировке иммунокорректоров, которые способствуют арбовирусных репликации и 2) эукариотических хост факторы, которые ограничивают арбовирусных репликации. Эти методы на основе флуоресценции и люминесценции позволяют исследователям быстро получить количественные отсчетов арбовирусных репликации в упрощенческой анализов с низкого соотношения сигнал шум.

Abstract

РНК - интерференции и редактирования на основе платформ скрининг генома широко использовались для выявления принимающей ячейки факторов, ограничивающих репликации вируса. Однако эти экраны обычно проводятся в клетках, которые естественно разрешительной для вирусного возбудителя изучается. Таким образом надежную репликацию вирусов в условиях управления может ограничить динамический диапазон этих экранов. Кроме того эти экраны могут быть не в состоянии легко определить пути сотовой обороны, которые ограничивают репликации вируса, если вирус хорошо адаптированы к хосту и способной противостоять противовирусной защиты. В этой статье мы опишем новую парадигму для изучения взаимодействия вируса хост с помощью экранов, которые центр на естественно неудачной инфекций путем арбовирусов например вирус везикулярного стоматита (ВСВ). Несмотря на виллах возможность реплицировать в широком диапазоне dipteran насекомых и млекопитающих хостов VSV проходит после вступления, неудачная инфекции в различных клеточных линий, полученных из спаривающиеся насекомых, таких как непарного шелкопряда (Lymantria dispar). Однако эти неудачной VSV инфекции можно «спасти» когда принимающей ячейки противовирусной защиты оказываются под угрозой. Мы описываем, как VSV штаммов кодирования удобно репортер генов и ограничительной л dispar клеточных линий может быть сопряжено для установки экранов для идентификации узла факторов в арбовирусных ограничение. Кроме того мы также показывают полезность этих инструментов скрининга в идентификации вирусно закодированные факторов, которые спасти VSV репликации при коинфекции или через внематочная выражения, в том числе закодированные млекопитающих вирусов. Природные ограничения VSV репликации в клетках dispar л обеспечивает высокое соотношение сигнал шум при отборе для условий, которые способствуют VSV спасения, таким образом позволяя использовать упрощенный люминесценции и флуоресценции-на основе анализов для мониторинга изменения в виллах репликации. Эти методологии являются ценными для понимания взаимосвязи между принимающей противовирусное ответы и вирусных иммунной уклонение факторов.

Introduction

Способность вируса эффективно реплицировать в конкретный узел регулируется в части наличия принимающей ячейки факторов, поддерживающих вирусный вход и репликации1. Вирус хозяйского диапазона может быть продиктовано способности вируса для счетчика сотовой противовирусной защиты, которые в противном случае будут препятствовать репликации вируса2,3. Это результат этих сложных вирусов хост взаимодействий, которые в конечном итоге решить, будет ли вирус смог завершить свой жизненный цикл в конкретный узел. Учитывая потенциально патогенные последствия для принимающей страны, если наступает вирусной репликации, важно разработать экспериментальные стратегии для дальнейшего нашего понимания ключевых вирус хост взаимодействий, которые могут нарушить баланс между неудачной и продуктивной инфекции. Изучение молекулярных особенности взаимодействия вируса хост будет важную роль в разработке новых и альтернативных противовирусное терапевтических стратегий.

С появлением РНК интерференции (RNAi)4,5 и геном-инструменты для редактирования (например., ТРИФОСФАТЫ-Cas9, цинковый палец nucleases, Таленс)6,7, он стал экспериментально целесообразно изменить выражение клеточных факторов на геном общесистемной весы и исследовать влияние этих изменений на репликацию вируса. Действительно были проведены многочисленные RNAi и геном редактирования на основе-экраны в беспозвоночных и позвоночных принимающих типы клеток, которые имеют обнародовал новые грани вирус хост взаимодействия8,9,10, 11 , 12. Эти экраны обычно используют вирусов кодирования репортеров, таких как Светлячок Люцифераза (Люк) или флуоресцентные белки (например., GFP, DsRed), которые обеспечивают удобные средства количественной оценки экспрессии вирусных генов как индикация для репликации вируса9,12. Эта стратегия позволяет исследователям для идентификации узла факторов, которые либо поощрения или раздражать вирусной репликации, что подтверждается увеличивается или уменьшается, соответственно, в Вирусный репортер сигналов9,12. Однако в подавляющем большинстве случаев, эти экраны были проведены с использованием вирусов, которые хорошо приспособлены к ячейки тип узла, в котором они изучаются. Хотя эта стратегия может быть важно для понимания coevolutionary отношений между вирусных патогенов и их естественной хостов, он создают глубокую озабоченность относительно их использования в раскрытие узла противовирусное факторов. В этих случаях увеличение в вирус репортер сигнал RNAi нокдаун ищется, или инактивации Сотовые фактор, который обычно препятствует репликации вируса. Во-первых если вирус уже способна надежно реплицировать в рассматривается в контрольных условиях клетки-хозяина, динамический диапазон экрана (то есть, способность различать между цветом фона и расширенной вирусный репортер сигналы) может быть ограничено. Во-вторых эта проблема усугубляется ситуаций, в которых вирус хорошо приспособлены к клетки-хозяина и эффективного противодействия принимающей обороны путей, которые ориентированы на экране.

Из-за выше опасения относительно взаимодействия традиционных вирус хост, методы фильтрации мы разработали новую парадигму для изучения вируса хост взаимодействий, которые использовать естественно неудачной арбовирусных инфекций в спаривающиеся насекомых клеток. Эта стратегия является производным от наблюдения, что хорошо изученных человека арбовирусами, виллах, подвергается неудачной инфекции в клетки, полученные от непарного шелкопряда (L. dispar)13. VSV естественно передается dipteran насекомыми (то есть, москитов) млекопитающих узлам и было доказано экспериментально заразить широкий спектр беспозвоночных и позвоночных хозяев в клеточной культуре и в естественных условиях14. 11-КБ отрицательный смысл одноцепочечной РНК Геном VSV кодирует пять субгеномной мРНК, которые каждый переводятся на белки, которые составляют запечатанная вириона. Однако обратный генетических систем VSV позволили создание репликации компетентных штаммов кодирования Люк или флуоресцентных белков, в дополнение к пяти природных VSV гена продуктов15,16,17. Потому что эти белки репортер не включаются в виллах вириона, они обеспечивают удобную индикацию VSV экспрессии генов, которое происходит после вступления. С помощью штаммы виллах кодирования GFP или люк, мы ранее показали что VSV экспрессии генов строго ограничены по вступлении LD652 клеток и что VSV титры не увеличить на 72 часа после инфекции (ХПИ). Напротив коинфекции LD652 клеток с VSV и млекопитающих поксвирусных vaccinia вируса (VACV), приводит к логарифмической увеличение экспрессии генов VSV и титры на этот момент времени. VACV проходит ранние экспрессии генов, репликации ДНК и конце экспрессии генов в LD652 клеток инфекции, но цикл репликации VACV в конечном счете неудачной из-за неполной вириона морфогенеза18. Большой ~ 192 kb ДНК генома VACV кодирует белки > 200, многие из которых отображать иммуномодулирующими свойствами, которые способствуют вирусной репликации через подавление принимающей иммунных реакций19. Таким образом мы предположили, что «спасение» VSV репликации в LD652 клетках, VACV коинфекции вероятно опосредовано VACV иммуномодуляторами, что препятствует л dispar ответы обычно ограничение VSV репликации. В поддержку этого обращения LD652 клеток с принимающей РНК полимеразой II ингибитор актиномицин Д спасает VSV репликации в LD652 клетках, указав, что ответы транскрипции зависимых хост блокировать VSV репликации после вступления13.

Выше наблюдения предполагают, что естественно ограничительный характер LD652 клеток VSV инфекции может обеспечить относительно низких фоновых при отборе для условий, которые повышают репортер VSV-кодированных сигналов (то есть, те, которые препятствуют хост антивирусной защиты). Здесь мы предлагаем методы использования флуоресценции или люк на основе анализов экран для условий, которые облегчают VSV ограничение в спаривающиеся клеток. Во-первых мы показываем, каким образом эти анализы может использоваться для определения факторов вирусно закодированные иммуномодулирующих, которые нарушают VSV ограничение во время экспериментов либо коинфекции или через внематочная выражение кандидат вирусные факторы. В качестве примера мы показываем, как мы использовали эти методы скрининга для выявления кодировке поксвирусных A51R белков как новое семейство иммуномодулирующих факторы спасти VSV репликации в отсутствие других поксвирусных факторы13. Во-вторых мы показываем, как RNAi скрининга в ограничительных инфекции клеток VSV-LD652 может использоваться для напрямую идентифицировать эукариотических хост факторов в арбовирусных ограничение13.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Общие Lymantria dispar (LD652) клеток и культура вирусов

  1. LD652 ячейка культивирования и покрытие
    1. К культуре dispar л-производные LD652 клетки, поддерживать монослоя клеток в рост среднего (Таблица материалов), инкубировали при 27 ° C в нормальной атмосфере. Сохранить клетки в 10 см ткани Культура лечение блюда и проход клетки при достижении 80% confluency.
    2. Пластина, выбить адэрентных клеток LD652 от плиты, закупорить СМИ неоднократно на монослое (эти клетки не требуют trypsinization выбить) и разбавления образца в СМИ роста Приблизительная плотность 1 х 105 кл/мл. Пипетка 1 мл разбавленного культуры/хорошо 24-ну плиты. Семя как минимум три реплицировать скважин/лечения типа для каждой точки времени (максимум восьми лечения/плиты).
    3. Позволяют клеткам урегулировать как минимум на 1 час.
  2. Vaccinia вируса подготовка
    1. Подготовить запасов VACV, усиливают вируса в НеЬа клетки20 или африканских Green Monkey почечной клетки (клетки BSC-1 или BSC-40)20,21,22.
      Примечание: VACV штамм Вестерн Резерв (VACV-WR) хорошо работает в анализов, описанных здесь.
    2. Титруйте VACV штамм через assay металлической пластинкы на BSC-1 или BSC-40 клеток20,22.
      Примечание: Все указали VACV кратности инфекции (МВД) описанные здесь для LD652 клеток инфекции основаны на титры, полученные от налета анализов BSC-40.
  3. Подготовка вирус везикулярного стоматита
    1. Чтобы подготовить VSV запасов, усиливают вируса в ППА клетки23.
    2. Титруйте виллах в assay металлической пластинкы на BSC-40 или ППА клеток монослои13,23.
      Примечание: Все VSV MOIs описано здесь для LD652 клеток инфекции основаны на титры, полученные от налета анализов BSC-40.

2. на основе флуоресценции VSV спасения Assay используя инфекции и клеток

  1. Заполнение и инфекции LD652 клеток
    1. Пластина 40000 LD652 клеток/хорошо 8-Ну палаты.
    2. На основе флуоресценции клеток изображений, используйте штаммы виллах кодирования флуоресцентных белков. Эксперименты, представленные здесь использовать VSV-DsRed17, рекомбинантных VSV штамм, который выражает свободного DsRed белок, который не сливается с любой другой белок VSV.
      Примечание: VSV инфекции LD652 клеток не цитопатического по 96 hpi и, таким образом, смерть клетки не является смешанным фактором при оценке VSV репликации в течение этого периода времени.
    3. Подготовить VSV-DsRed и VACV-FL-ГФП в сыворотке свободных СМИ (УЛП; Таблица материалов) в МВД 1 и 25 соответственно.
      Примечание: VACV-FL-GFP-рекомбинантный штамм VACV, который выражает слияние между Люк и GFP-24. Использование MOI 25 или больше для VACV штаммов гарантирует, что все LD652 клетки являются зараженные13. Если с помощью различных coinfecting вирус, МВД будет иметь эмпирически определяемые пользователем. Каждое лечение инфекции следует создать дубликаты скважин и включают макет инфицированных лечения, в которых только УЛП добавляется к клеткам.
    4. Инкубировать клетки в 0,2 мл посевным материалом для 2 ч при 27 ° C.
    5. Вымойте клетки с 0,5 мл/хорошо роста средств массовой информации.
    6. Инкубировать клетки в 25 мкм красителя жизнеспособность клеток (Таблица материалов) в средствах массовой информации роста за 45 мин при 27 ° C.
    7. Аспирационная СМИ и Промыть лунки 1 x 0.5 мл/хорошо, чтобы удалить излишки красителя.
    8. Сохранить клетки в 0,3 мл/хорошо роста средств массовой информации.
  2. Живой клетки образов
    1. Заранее включите Конфокальный микроскоп 30 мин и загрузить камеры 8-Ну блюдо.
      Примечание: LD652 клетки могут быть образы при комнатной температуре, начиная от 20-25 ° C, но для оптимальных условий, температура в помещении должна быть скорректирована с 27 ° C.
    2. Настройте параметры возбуждения соответствующую/выбросов для каждого белка флуоресцентные маркер для записи образа, а также этап настройки контрастности изображения.
    3. Отрегулируйте интенсивность лазера для каждого канала.
      Примечание: Может потребоваться запуск эксперимента для определения диапазона интенсивностей флуоресцентного сигнала, наблюдается на протяжении времени для использования в последний эксперимент.
    4. С помощью 10 X цель, захватить фазы контраст и флуоресценции изображения каждой хорошо каждые 1 – 5 ч в течение инфекции до желаемого времени точки (например., 48 – 72 ИНН).
      Примечание: Важно захватить несколько полей зрения в каждой скважине точно оценить показатели инфицирования во всем культуры.
  3. Анализ изображений
    1. Использовать программное обеспечение для анализа изображений для анализа автоматизированных изображения флуоресцентных надлежащих каналов (например., 405 нм, 488 нм, 568 Нм).
    2. Чтобы вычислить процент клеток, которые инфицированы, разделите общее количество люминесцентные клеток, указывающее VSV инфекции (например., DsRed положительных клеток для лечения инфекций VSV-DsRed), общее количество жизнеспособных клеток, помечены краситель жизнеспособность клеток для Каждое поле зрения во всех процедур.

3. Общие вирусные инфекции протокол для анализов на основе свечения VSV спасения в LD652 клетках

  1. Подготовка посевным материалом
    1. 30 мин перед инфекцией, оттепель запасы VSV-Люк16 (рекомбинантной VSV напрягаться, что выражает свободного Светлячок Люцифераза белка не сливается с любой другой белок VSV). Если опробование VSV-Люк спасения при коинфекции VACV, также оттепели VACV-WR вирус на льду.
      Примечание: Другие вирусы (кроме VACV-WR) может спасти VSV-Люк при коинфекции, но это будет нужно будет определить эмпирически каждым пользователем.
    2. Подготовьте посевным материалом путем разбавления VSV-люк в наличие или отсутствие VACV-WR в УЛП, таким образом, что мои 10 и 25, соответственно, достигается при добавлении всего посевным материалом объемом 0,2 мл/хорошо.
  2. Заражение клетки
    1. Аспирационная зрелых LD652 СМИ тщательно, чтобы не мешать монослоя и прививать с 0,2 мл вирус/скважины. Это время определяется как 0 ХПИ. Добавление дополнительных скважин, чтобы служить в качестве «МОК инфицированных» отрицательный контроль лечения стерильные УЛП.
    2. Инкубировать клетки в посевным материалом для 2 ч при 27 ° C.
    3. На 2 hpi удалите посевным материалом, аспирации и заменить 1 мл/хорошо LD652 роста средств массовой информации.
    4. Разрешить инфекции приступить 24 – 72 Инн.

4. Люцифераза Assay

  1. Подготовка lysates клетки
    1. Тщательно удалить супернатант и добавьте 1 mL Дульбекко фосфат амортизированное saline (DPBS) / хорошо.
    2. С помощью поршень 1 мл шприц, скрип клетки в DPBS.
    3. Передача клетки пробки microcentrifuge и центрифуги на 400 x g 20 мин при 4 ° C.
    4. Тем временем Подготовьте 1 x разрежения 5 x репортер литического буфера (RLB), в стерильной H2O.
    5. После центрифугирования аспирационная DPBS не нарушая Пелле ячейки.
    6. Ресуспензируйте каждой гранулы в 150 мкл 1 x RLB.
    7. Замораживания оттаивания образцов 1 x с использованием 5-мин инкубации в морозильной камере-80 ° C, после быстрого потепления в ванну водой комнатной температуры. Храните лизатов-80 ° c до готовности для анализа.
  2. Люцифераза пробирного
    1. Оттепель лизатов на льду.
    2. Пипетка 20 мкл lysate в колодец сплошной черный или белый 96-луночных микропланшетов.
    3. Добавьте 100 мкл Реагента assay Люцифераза в каждой скважине.
    4. Сразу же измерения интенсивности света, с помощью люминометра (соответствующие параметры для конкретных luminometers придется эмпирически определяемые пользователем).
  3. Люцифераза пробирного анализа
    1. Нормализовать Лу сигналы для каждого лечения Лу показания, полученные от управления лечения (Представитель результаты). После по меньшей мере три независимые эксперименты, означает, что Лу полученные от каждой группы управления обработки могут быть проанализированы на соответствующих статистических тестов.

5. Immunoblot

  1. Используйте лизатов извлек для анализов люк для SDS-PAGE и последующим immunoblotting, используя соответствующие реагенты и оборудование.

6. титр VSV от LD652 клеточных культур

  1. Пластина LD652 ячеек в зависимости от шага 1.1.
  2. Вирусные заразить клетки согласно шаг 3.
  3. В точках желаемое время соберите supernatants в стерильных microcentrifuge трубы.
  4. Пелле клетки, используя 1000 x g 10 мин при температуре 4 ° C и передачи supernatants новые трубы.
  5. Хранить supernatants-80 ° c или продолжить титрование, assay металлической пластинкы на BSC-40 клеток.
    Примечание: Если титрования VSV от LD652 клеточных культур, которые содержали VACV, рекомендуется добавить средства массовой информации культуры BSC-40 в течение 2 hpi, чтобы предотвратить формирование бляшек на BSC-40 монослои13остаточных частиц VACV цитозин арабинозид 100 мкг/мл (AraC). AraC является ингибитор вирусной ДНК-полимеразы, который блокирует репликацию ДНК VACV25 , но не влияет на виллах репликации.

7. вариации на основе свечения VSV спасти анализов в LD652 клетках: RNAi и плазмиды Transfection экспериментов

  1. Подготовка dsRNA опосредованного системой РНК-интерференции нокдаун вирусной или принимающих стенограммы
    1. Джин специфические праймеры дизайн хвост конце 5' с последовательностью промоутер T7 (TAATACGACTCACTATAGGG), либо целевой coinfecting вируса (например, VACV) или стенограммы л dispar mRNA интереса. Эти грунты следует производить продукт PCR 400 – 600 ВР для эффективного нокдаун, опосредованного системой РНК-интерференции. Смотреть "Гаммон" и др. 13 для последовательностей праймера используется ниже нокдаун VACV или L. dispar стенограммы к малым интерферирующим РНК опосредованной РНК-интерференции в клетках LD652.
      Примечание: L. dispar мРНК, которые стенограммы могут быть определены из опубликованных л dispar транскриптом баз данных26,27,28.
    2. Генерировать ДНК шаблон через RT-PCR (синтез cDNA: 1 цикл 50 ° C за 30 мин.; PCR: 40 циклов 94 ° c 15 s, 50 ° C за 30 s и 68 ° C на 45 s каждый).
    3. Очищайте продукт PCR, используя комплект для очистки ПЦР.
    4. Использование очищенного продукта PCR как шаблон, в пробирке транскрибировать и очистить двуцепочечной ДНК с помощью в vitro транскрипция и очистка kit.
  2. Трансфекция двуцепочечной ДНК или плазмидной ДНК в клетки LD652
    1. Семян 1 х 105 клеток/также плиты 24-Ну и пусть клетки останавливаться на по крайней мере 1 час.
    2. Для каждой скважины, котор нужно transfected разбавляют в 100 мкл УЛП 4 мкл Реагента transfection. Инкубируйте до 15 мин при комнатной температуре. Это могут быть расширены чтобы сделать главный микс для всех transfections должны быть выполнены.
    3. Разбавляют до 1 мкг с 100 мкл УЛП для каждой скважины, котор нужно transfected двуцепочечной ДНК или всего плазмидной ДНК. Инкубируйте до 15 мин при комнатной температуре.
      Примечание: Ранее нашли что трансфекции 1 мкг двуцепочечной ДНК/105 LD652 клеток является достаточным для > 80% нокдаун либо вирусной или принимающих стенограммы13, но dsRNA дозы необходимо для изменения экспериментальный набор ups/условия придется определяться эмпирически.
    4. Сочетают Трансфекция реагента и малым интерферирующим РНК/плазмида ДНК разведений с соотношением 1:1 (например, 100 мкл разбавленного dsRNA смешивается с 100 мкл разбавленного трансфекции реагента) и проинкубируйте втечение 20 мин при комнатной температуре.
    5. Тем временем, Промыть лунки с 1 мл/хорошо УЛП, а затем добавьте 500 мкл УЛП в каждой скважине.
    6. Медленно добавьте трансфекции реагент двуцепочечной ДНК (или плазмидной ДНК) смесь прикапывают в каждой скважине.
    7. Инкубируйте реагент transfection клетки для 5 h.
      1. Для RNAi эксперименты с нокдаун стенограммы, закодированные с coinfecting вирусом (например, VACV), заменить трансфекции реагент после инкубационного периода 5-h трансфекции вирус посевным материалом, содержащие VSV-Люк (с или без VACV или еще один coinfecting вирус) (шаг 3). Впоследствии замените посевным материалом вирус, содержащий VSV-люк с hpi СМИ 2 полный рост. Люк анализов (шаг 4) затем может выполняться на извлеченные лизатов в различные моменты времени, чтобы определить, если нокдаун coinfecting вирус стенограммы приводит к потере VSV-Люк спасения.
      2. Для RNAi экспериментов с участием RNAi л dispar стенограмм Замените смесь трансфекции полный рост средств массовой информации и позволяют нокдаун наступить за 24 ч до инфекции с VSV-Люк (шаг 4). Люк анализов (шаг 4) затем может выполняться на извлеченные лизатов в различные моменты времени для определения, если нокдаун л dispar стенограммы способствует спасению VSV-люк.
      3. Для экспериментов с transfections векторов выражения плазмида, выражая кандидат иммуномодуляторы заменить трансфекции реагента и позволяют выражение протеина за 24 ч до инфекции с VSV-Люк (шаг 4). Люк анализов (шаг 4) затем может выполняться на извлеченные лизатов в различные моменты времени, чтобы определить, если выражение кандидата иммуномодулирующих белков способствует спасению VSV-люк.
        Примечание: Трансфекции условий, описанных здесь, используя 1 мкг/хорошо плазмида ДНК результата в эффективность трансфекции 40 – 60%13.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

В качестве примера клеток графических приложений для мониторинга VSV спасения при коинфекции VACV, LD652 клетки были покрытием в камерных блюдо 8-Ну и затем макет зараженных или зараженных с VSV-DsRed (MOI = 1) в наличие или отсутствие VACV-FL-GFP (MOI = 25). Потому что VSV DsRed выражает DsRed как свободный белок и не сливается с структурных белков VSV (рис. 1A), только обнаруживается после инициирует VSV вход и ген выражение. Затем все клетки были помечены с красителем жизнеспособность клеток, что свободно проходит через плазматическую мембрану клеток, где оно преобразуется в мембраны impermeant продукт, который способствует сохранению флуоресцентного сигнала в помеченных клеток. Изображения были приобретены каждые 5 ч до 65 hpi, используя 405 нм, 488 нм, 568 Нм и белый свет фильтры для захвата краситель жизнеспособность клеток, VACV-FL-GFP, VSV-DsRed и каналов фазы контраст (PC), соответственно. В условиях единого инфекции LD652 клетки ограничить репликации VSV-DsRed; Таким образом только небольшое количество клеток экспонат DsRed сигнал. Однако коинфекция VSV-DsRed с VACV-FL-GFP приводит в большинстве клеток, отображение DsRed сигналы к концу время курса (рис. 1B). Изображения, снятые в каждый момент времени были подвергнуты программное обеспечение для анализа изображений, где 405 нм и 568 Нм канал изображения были использованы для автоматического определения общей и DsRed положительные числа клеток, соответственно. Процент клеток, отображение DsRed сигнал для каждого лечения рассчитывается путем деления объекты (клетки) с позитивным сигналом в канале 568 Нм на количество объектов, определенных в 405 нм канал для каждой точке времени, а затем путем умножения на 100% . Как показано на рисунке 1 c, ~ 2% клеток из одной инфекции VSV-DsRed были DsRed позитивных 65 ХПИ. В отличие от ~ 77% ячеек в виллах-DsRed + VACV-FL-GFP коинфекции были DsRed положительным в этот момент времени. Фильмы S1 и S2 показывают прогрессирование инфекции VSV-DsRed в течение всего времени 65-h в одной инфекции и коинфекции условия, соответственно. Важно отметить, что экспрессия гена GFP в VACV-FL-GFP стал обнаружению 10 hpi, до DsRed сигнал, указывающий, что достаточно экспрессии генов VACV требуется до спасения VSV-DsRed (не показан). Вместе эти результаты ясно свидетельствуют спасение VSV-DsRed репликации по коинфекции VACV. Если coinfecting вирус смог спасти VSV-DsRed, мы бы ожидать равные доли DsRed положительных клеток между одной инфекции и коинфекции лечения.

VSV репликации в LD652 клетках в качестве альтернативы могут быть количественно с помощью анализов на основе люминесценции при использовании штаммы виллах-Люк (рис. 2A). Например, Рисунок 2B показывает результаты пробирного люк, используя лизатов подготовлен в течение 72 ч время курс от МОК инфицированные клетки или клетки, зараженные с VSV-Люк (MOI = 10) в наличие или отсутствие VACV-WR (MOI = 25). Позитивные спасения VSV-Люк репликации обозначается логарифмической увеличение произвольных Лу с лизатов, приготовленный из коинфицированных клеток, по сравнению с лизатов от одного VSV-Люк инфекции обнаружены. Отрицательный результат будет указываться в этот assay коинфекции неспособность изменить Лу чтений от тех, кто замечен в одном лечения инфекции VSV-люк. При желании, подготовленный лизатов может также использоваться для immunoblotting, чтобы подтвердить повышение экспрессии генов VSV коинфекции лечения. Например Рисунок 2 c показывает типичный immunoblot результат для VSV-кодировке люк и матрица белков (M) в лизатов подготовил макет-, VSV-люк и VSV-Люк + VACV-WR лечения 72 Инн. Immunoblotting для VACV I3L белка служил маркер инфекции VACV и immunoblotting для сотовых актина был использован в качестве элемента управления загрузки. Четкое повышение VSV-кодировке люк и M белков в коинфекции лизатов далее подтвердить VSV спасения от VACV. Наконец продуктивных VSV репликации могут быть подтверждены сбора supernatants от этих культур клеток LD652 и титрования инфекционных вирусов на BSC-40 монослои (Рисунок 2D). Этот результат показывает, что только во время VACV коинфекции не VSV продуктивно выполнять репликацию.

После coinfecting вирус способен спасать VSV репликации в LD652 клетках, скрининга RNAi может использоваться для выявления факторов, кодируемых вирусом coinfecting, которые способствуют VSV спасения. В этом эксперименте, экран для RNAi условие, которое приводит к фенотип «потеря спасения» при коинфекции VSV-люк с спасательных вируса. Ранее мы определили VACV A51R белка как фактор спасения VSV через скрининга RNAi десятки VACV-кодировке стенограммы13. В качестве примера мы резюмировалась меньшего масштаба версии этого экрана (рис. 3). РНК-интерференции при посредничестве трансфекции ин витро расшифрованный двуцепочечных РНК, что целевые стенограммы, кодируемых вирусом coinfecting. В данных, показанные здесь вирусный стенограммы кодирования белков VACV A50R, A51R и A52R были направлены для RNAi нокдаун. Как отрицательный контроль за потерю спасения клетки были также transfected с двуцепочечных РНК, ориентация GFP-кодирования стенограммы. Как позитивный элемент управления для потери спасения фенотипа клетки были transfected с двуцепочечных РНК против Люк кодирования стенограммы. Это лечение производит сильные потери Лу сигнала при коинфекции и помогает подтвердить, что протоколы трансфекции/RNAi работают исследователи. После 5 h dsRNA transfection клетки были коинфицированы VSV-Люк (MOI = 10) и VACV-WR (MOI = 25). Отдельных инфекций с только VSV-Люк проводились также установить фоновый уровень сигнала Лу. Лизатов были затем собирают 72 Инн и используется в assay люк. Сравнение уровня VSV спасения через dsRNA лечения для лечения управления dsRNA GFP, результаты указывают на нокдаун VACV A51R производит сильные потери спасения фенотипа, тогда как сногсшибательно A50R и A52R дает отрицательный результат (без потери спасение, по сравнению с GFP dsRNA).

Как альтернатива RNAi скрининг для выявления вирусные факторы, влияющие на виллах спасения overexpress кандидат вирусные факторы в LD652 клетках и затем проба для спасения VSV-люк. Это достигается путем клонирования кандидат гены интереса в соответствующее выражение векторов, таких как p16629 и transfecting эти плазмид в LD652 клетки до вызов VSV-люк. Например, на рисунке 4A показывает спасения эксперимент в котором флаг тегами GFP (FGFP) или с тегами Флаг A51R (FA51R) p166 векторов были transfected в LD652 клетки в различных концентрациях, следуют VSV-Люк инфекции (MO = 10) 24 h позже. Как отрицательный контроль для спасения VSV дополнительных культур были макет transfected и не получают плазмида ДНК. Лизатов были собраны из 72 hpi культур и были подвергнуты Люк анализов. FA51R лечения производится положительный результат спасения VSV как продемонстрировано расширение Лу сигналов через макет transfected лечения на несколько доз. В отличие от FGFP лечения были отрицательными для спасения виллах в любой дозе испытания. Immunoblotting лизатов от Рисунок 4A подтвердил подобные выражения FGFP и FA51R белков (рис. 4B).

С помощью скрининга RNAi кандидата л dispar факторов, мы показали, что ограничение виллах в LD652 клетках при посредничестве различных клеточных факторов, относящихся к противовирусным RNAi пути (например, давности2 и Dicer-2), ядерный фактор Каппа B (NF-κB)-связанной с IMD путь (например, Смак)и система убиквитин протеасомы (например., polyubiquitin)13. В качестве примера, мы неоднократно меньшего масштаба версии этих экспериментов интерференции с двуцепочечных РНК, ориентации л dispar стенограмм, которые укрепили VSV-Люк репликации на нокдаун (например., давности2, Dicer-2, приправы, polyubiquitin) или никакого эффекта (AGO1 )13. После 24 ч dsRNA трансфекции клетки были оспорены с VSV-люк для 72 h для определения, если RNAi лечения лучше Лу сигналы отрицательный контроль GFP dsRNA лечения. RNAi лечения, которые улучшают Лу сигналы указывают, что фактор, кодируемых целевых Стенограмма ограничивает VSV репликации. Как позитивный элемент управления для RNAi нокдаун двуцепочечных РНК, ориентация Люк кодирования стенограммы были также transfected в параллельных процедур. Из-за низких фоновых, Лу сигналы обнаружены GFP dsRNA управления процедурами, она была относительно простой способ идентифицировать факторы хост кодированного ограничения с помощью скрининга RNAi, потому что их нокдаун производит ~ 10-кратное увеличение Лу сигналов ( Рисунок 5). Таким образом можно воспользоваться фона, относительно низкий уровень экспрессии генов виллах в LD652 клетках для узла RNAi нокдаун условий, которые снимают ограничения VSV.

Figure 1
Рисунок 1: идентификация VSV спасения по коинфекции вирус LD652 клеток с помощью изображений на основе флуоресценции клеток. (A) Эта панель показывает схематическое генома VSV-DsRed, указывающий местоположение гена DsRed (dR). (B) эти представитель 10 X confocal микроскопии изображений являются захваченные 60 hpi. 405 нм канал показывает пятно для жизнеспособных клеток, канал 488 нм указывает VACV-FL-GFP инфекции, а 568 Нм канала — VSV-DsRed инфекции. Также показаны фазы изображения контрастность (PC). Масштаб баров = 100 µm. (C) Эта группа показывает процент LD652 DsRed положительных клеток в течение времени всего 65 h инфекции. Отображается средняя (SD) процент клеток, показаны DsRed сигнал для каждой точки время. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: Оценка VSV спасения в LD652 клетках с помощью анализов люк. (A) Эта панель показывает схематическое VSV-Люк генома. (B) Эта группа показывает условные единицы легких (Люк) анализов лизатов с макет инфицированные клетки или клетки, зараженные с VSV-люк, в отсутствие или наличие VACV-WR. (C) Эта группа показывает immunoblot люк, VSV М, VACV I3L, и клеточных миозина белков в лизатов от группы A собраны 72 Инн. (D) этой панели отображается VSV-Люк титры в supernatants культуры, полученные от группы B. Количественных данных в панели B и D представляют собой средства (± SD) от эксперименты, проведенные в трех экземплярах. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: определение коэффициента вирусно кодировке VSV спасения через скрининга RNAi при коинфекции клеток LD652. Эта панель показывает раз изменения в Лу, обнаруженные в лизатов от 72 hpi клетки с VSV-люк и VACV-WR после указанных RNAi лечения, по сравнению с Лу, обнаруженных в лизатов от клеток поодиночке инфицированных VSV-люк. Данные представляют собой средства (± SD) от эксперименты, проведенные в трех экземплярах. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4: спасение VSV, гиперэкспрессия вирусный иммуномодулятор в клетках LD652. (A) Эта группа показывает Люк пробирного от hpi VSV-Люк инфицированных клеток 72, которые были transfected макет (макет) или transfected с FGFP или FA51R p166 выражение плазмид. Лу сигналы от каждого лечения были нормализованы сигналы обнаружены в макет transfected контроля лечения. Данные представляют собой средства (± SD) от эксперименты, проведенные в трех экземплярах. (B) Эта группа показывает лизатов от группы A, immunoblotted с флагом и актина антител. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 5
Рисунок 5: Идентификация хоста факторы, ограничивающие VSV репликации в LD652 клетках через скрининга RNAi. Эта панель показывает, что раз изменить в Лу сигналов в указанных RNAi лечения относительно GFP dsRNA контроля лечения 72 hpi с VSV-люк. Данные представляют собой средства (± SD) от эксперименты, проведенные в трех экземплярах. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Фильм S1: представитель 405-нм (краска жизнеспособность клеток) и 568 Нм (DsRed) канала изображения, снятые на протяжении времени 65 h (каждый кадр = 5 h интервал) после заражения VSV-DsRed клеток LD652. Пожалуйста, нажмите здесь, чтобы загрузить этот файл.

Фильм S2: представитель 405-нм (краска жизнеспособность клеток) и 568 Нм (DsRed) канала изображения, снятые на протяжении времени 65 h (каждый кадр = 5 h интервал) после коинфекции LD652 клеток с VSV-DsRed и VACV-FL-GFP. Пожалуйста, нажмите здесь, чтобы загрузить этот файл.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Здесь мы описали простой флуоресценции и люминесценция-на основе анализов для условий, которые спасти VSV репликации в ограничительных спаривающиеся клеточных культур. Неудачная инфекции VSV спаривающиеся клеток создает отличное соотношение сигнал шум при опробование для выражения гена VSV. Например, сигналы Лу, обнаруженные в лизатов от одного VSV-Люк инфекций были ~ Гарибова выше, чем в макет инфицированных лизатов, но эти сигналы только изменилась примерно вдвое за 72-h время курс. В отличие от коинфекции VSV-люк с VACV расширение Лу сигналы ~ 300-fold за сингл VSV-Люк инфекции 72 Инн. Таким образом VSV спасения анализов отображения отличный динамический диапазон, охватывающий несколько порядков.

Одним из важных шагов в создании этих анализов включает решение пробирного VSV спасения с помощью подходов на основе флуоресценции или свечения. Мы показали примеры как VSV-кодированного DsRed сигналы могут быть assayed количественно с помощью клеток методы визуализации и пакеты программного обеспечения, которые облегчают автоматизированного количественного определения DsRed положительных клеток в отсутствие или наличие спасения Коинфицирование. Если исследователи имеют доступ к возможностям тепловизионных клеток, эти анализы являются недорогими и позволяют им захватить широкий спектр моменты времени, которые могут помочь в обнаружении различий в виллах репликации кинетики, которые только наблюдаются в узких время Windows. В противоположность этому подходы на основе свечения являются по существу концевой анализов, которые требуют подготовки lysates клетки в заранее заданное время точках, и lysate подготовка может занять много времени. С другой стороны, на основе свечения анализов не требуют сложных микроскопии оборудования — только плита читатель способны читать свечения сигналов. Кроме того на основе свечения анализов имеют больший динамический диапазон, чем на основе микроскопии анализов, которые вычислить процент инфицированных клеток. Например, в микроскопии анализов, DsRed положительных клеток (с указанием VSV-DsRed инфекции) можно только диапазон от 0-100% проанализированных клеток в поле зрения. В противоположность этому Лу сигналов между одной VSV-люк и коинфекции условий (или других условий спасения) могут варьироваться на несколько порядков.

Ключевым преимуществом использования системы клеток VSV -л dispar , представленные здесь экран для млекопитающих вирусом кодировке иммуномодуляторы является, что она по своей сути выбирает для идентификации вирусные факторы, которые подавляют, каковы могут быть сохранены и древних Противовирусное ответы, которые предшествовали ответ позвоночных животных конкретных интерферона. Действительно предварительные наблюдения предполагают, что A51R белки препятствуют сохранены противовирусное связанных с убиквитин протеасом клеточных реакций (см. Окорок et al. 13 и неопубликованные данные). Открытие VACV A51R спасения от VSV был первым примером гетерологичных вирус спасения вирусом позвоночных в беспозвоночных принимающей13, и вполне вероятно, что эти системы скрининга будет выявить дополнительные позвоночных вирус кодировке иммуномодуляторов . Важно отметить, что ключом к использованию VSV спасения как индикация для условий, которые подавляют иммунитет хост что VSV репликации должен быть сильно ограничены (или несостоявшимися) в тип ячейки, который в настоящее время рассматривается VSV репликации. Таким образом наиболее млекопитающих типы клеток скорее всего будет неподобающе для этих видов анализов, учитывая, что VSV реплицирует хорошо в mammalian клетках. Вот почему л dispar клетки были использованы здесь как естественно ограничительной принимающей ячейки тип VSV.

Предварительное исследование в клетках дрозофилы показал, что вирусный Подавители противовирусное RNAi ответы могли быть идентифицированы cotransfection выражение плазмид кодирования кандидат RNAi супрессоров и самовоспроизводящихся Flock дом геномной РНК вирус, Кодирует GFP вместо B2, ее природных RNAi подавитель30. Репликация геномной РНК стадо дом и продукции КГВ зависело от подавления RNAi на коэффициент cotransfected кандидат, и, таким образом, спасение экспрессия гена GFP указано RNAi подавления30. Наша неопубликованные работы указывает, что гиперэкспрессия вирус кодировке RNAi ингибиторов также спасает VSV-Люк экспрессии генов в клетках л dispar , предполагая, что эта система может также использоваться для выявления Подавители RNAi ответы в контексте инфекции в bona fide вирусного возбудителя в отличие от репликоном. Действительно вносить RNAi-, IMD- и связанных с убиквитин протеасом пути ограничения репликации VSV л dispar клетки13 вывод свидетельствует о том, что вирусный антагонисты несколько противовирусное путей может быть идентифицирована путем VSV спасти анализов, представленные здесь.

Потенциальным ограничением этих методов скрининга относительно идентификации узла противовирусное белков является, что последовательность генома л dispar пока недоступна. Однако, есть публично доступных dispar л transcriptomes, который может использоваться для идентификации цели хост кандидата для RNAi нокдаун26,27,28. Кроме того, нам показали ранее что VSV ограничено в клеточных линий, полученных от других триплоидная13 , которые теперь имеют публично доступных генома (например, Мандука sexta)31. Таким образом линии клеток, полученных от других триплоидная с последовательности геномов может заменить л dispar клетки, указанные в настоящем Протоколе.

Учитывая рост экономического и общественного здравоохранения угрозы арбовирусов32, скрининг анализов, представленные здесь может предоставить новые стратегии для выявления новых возможностей арбовирусных хост взаимодействий, которые могут иметь значение в разработке новых антивирусных терапии. Кроме того, из-за нашего сравнительно ограниченное понимание спаривающиеся механизмов для ограничения репликации РНК вируса, инструменты, представленные здесь предоставить новые возможности зонда механизмы обороны принимающей кодируемых это экономически важных порядок насекомых.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Д.г. была поддержана финансирование от Юго-Западного медицинского центра Университета штата Техас наделены ученых программы. Авторы благодарят Майкл Уитт (центра науки здоровья университета Теннесси) и Шон Уилан (Гарвардской медицинской школы) за предоставление VSV-DsRed и VSV-люк. Авторы также поблагодарить Гэри Luker (Мичиганского университета медицинской школы) за любезное дар штамма VACV-FL-GFP.

Materials

Name Company Catalog Number Comments
6-well tissue culture plates CELLTREAT 229106
24-well tissue culture plates CELLTREAT 229124
10 cm tissue culture dishes Corning C430167
Grace’s Insect Medium Sigma G8142
EX-CELL 420 Sigma 14420C
Fetal Bovine Serum - Optima Atlanta Biologicals S12450
Growth medium 1:1 mixture of Grace's Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1% antibiotic-antimycotic solution and 10% Fetal bovine serum
Antibiotic-Antimycotic Solution (100×) Sigma A5955
Dulbecco’s Phosphate Buffered Saline (DPBS) Sigma D8662
Serum Free Media (SFM) Thermo Fisher 10902096
Cytosine arabinoside Sigma C1768
Transfection reagent Thermo Fisher 10362100
Corning cellgro DMSO (Dimethyl Sulfoxide) Corning 25950CQC
Reporter lysis buffer 5x Promega E3971
Luciferase Assay Reagent Promega E1483
96-Well Microplates Corning 3915
Mouse anti-FLAG antibody Wako 014-22383
Rabbit anti-firefly luciferase antibody Abcam ab21176
Mouse anti-actin antibody Sigma A2066
Mouse anti-VSV M N/A N/A Dr. John Connor (Boston University)
Mouse anti-VACV I3L N/A N/A Dr. David Evans (University of Alberta)
8-well Chambered dish Lab-Tek II 155409
Cell viability dye Thermo Fisher C12881
FLUOstar microplate reader BMG Labtech FLUOstar
Confocal microscope Olympus FV10i-LIV
Image analysis software Olympus v1.18 cellSens software
Eppendorf 5702 ventilated centrifuge Eppendorf 22628102
Odyssey Fc Infrared Imaging System Li-COR Biosciences Odyssey Fc
LD652 cells N/A N/A Dr. Basil Arif (Natural Resources Canada)
BSC-40 cells ATCC CRL-2761
BHK cells ATCC CCL-10
HeLa cells ATCC CCL-2
BSC-1 cells ATCC CCL-26
in vitro transcription and purification kit Thermo Fisher AM1626
PCR purification kit Qiagen 28104

DOWNLOAD MATERIALS LIST

References

  1. Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. Viral tropism. Frontiers in Microbiology. 3, 281 (2012).
  2. Werden, S. J., McFadden, G. The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus. Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784, (1), 228-237 (2008).
  3. McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. Cytokine determinants of viral tropism. Nature Reviews: Immunology. 9, (9), 645-655 (2009).
  4. Silva, J. M., et al. Second-generation shRNA libraries covering the mouse and human genomes. Nature Genetics. 37, (11), 1281-1288 (2005).
  5. Moffat, J., et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell. 124, (6), 1283-1298 (2006).
  6. Ma, D., Liu, F. Genome Editing and Its Applications in Model Organisms. Genomics Proteomics Bioinformatics. 13, (6), 336-344 (2015).
  7. Yin, H., Kauffman, K. J., Anderson, D. G. Delivery technologies for genome editing. Nature Reviews: Drug Discovery. 16, (6), 387-399 (2017).
  8. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, (7206), 890-893 (2008).
  9. Houzet, L., Jeang, K. T. Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis. Experimental Biology and Medicine. 236, (8), Maywood, NJ. 962-967 (2011).
  10. Marceau, C. D., et al. Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens. Nature. 535, (7610), 159-163 (2016).
  11. Savidis, G., et al. Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics. Cell Reports. 16, (1), 232-246 (2016).
  12. Panda, D., Cherry, S. Cell-based genomic screening: elucidating virus-host interactions. Current Opinion in Virology. 2, (6), 784-792 (2012).
  13. Gammon, D. B., et al. A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection. Elife. 3, (2014).
  14. Letchworth, G. J., Rodriguez, L. L., Del cbarrera,, J, Vesicular stomatitis. Veterinary Journal. 157, (3), 239-260 (1999).
  15. Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones. Proceedings of the National Academy of Sciences of the United States of America. 92, (18), 8388-8392 (1995).
  16. Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization. PLoS Pathogens. 5, (4), e1000394 (2009).
  17. Duntsch, C. D., et al. Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model. Journal of Neurosurgery. 100, (6), 1049-1059 (2004).
  18. Li, Y., Yuan, S., Moyer, R. W. The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus. Virology. 248, (1), 74-82 (1998).
  19. Seet, B. T., et al. Poxviruses and immune evasion. Annual Review of Immunology. 21, 377-423 (2003).
  20. Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. Preparation of Cell Cultures and Vaccinia Virus Stocks. Current Protocols in Microbiology. 39, 11-18 (2015).
  21. Andrei, G., et al. Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice. Journal of Virology. 80, (19), 9391-9401 (2006).
  22. Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. Preparation of recombinant vaccinia virus for expression of small GTPases. Methods in Enzymology. 174-188 (1995).
  23. Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection. Bio-Protocol. 7, (22), (2017).
  24. Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread. Virology. 341, (2), 284-300 (2005).
  25. Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. Vaccinia reporter viruses for quantifying viral function at all stages of gene expression. Journal of Visualizes Experiments. (87), e51522 (2014).
  26. Cao, C., et al. Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance. Pesticide Biochemistry and Physiology. 119, 54-61 (2015).
  27. Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis. PloS One. 8, (5), e61190 (2013).
  28. Sparks, M. E., Gundersen-Rindal, D. E. The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts. Viruses. 3, (11), 2339-2350 (2011).
  29. Lin, G., Li, G., Granados, R. R., Blissard, G. W. Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion. In Vitro Cellular & Developmental Biology - Animal. 37, (5), 293-302 (2001).
  30. Li, W. X., et al. Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing. Proceedings of the National Academy of Sciences of the United States of America. 101, (5), 1350-1355 (2004).
  31. Kanost, M. R., et al. Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta. Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).
  32. Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases. BMJ Global Health. 3, (2018).
Арбовирусных инфекций как скрининг инструменты для выявления вирусной иммуномодуляторов и принимающих противовирусное факторов
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).More

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter