Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Araçlar Viral Immunomodulators ve ana bilgisayar Antiviral faktörler tanımlanması için eleme olarak Abdovirüs enfeksiyonlar

doi: 10.3791/58244 Published: September 13, 2018

Summary

Burada, Abdovirüs çoğaltma ve Abdovirüs çoğaltma kısıtlamak 2) ökaryotik ana faktörler teşvik 1) virüs kodlanmış immunomodulators tanımlamak için protokolleri mevcut. Floresan ve ışıldama dayalı yöntemlerin araştırmacılar hızla düşük sinyal noise oranları ile basit deneyleri Abdovirüs çoğaltma nicel veriler elde etmek için izin verir.

Abstract

RNA müdahale - ve genom düzenleme-tabanlı platformlar tarama virüs çoğaltma kısıtlamak konak hücre faktörleri tanımlamak için yaygın olarak kullanılmaktadır. Ancak, bu ekranlar genellikle viral patojen altında eğitim için doğal olarak keyfi olan hücreler yapılmaktadır. Bu nedenle, virüs denetimi koşullarında güçlü çoğaltma bu ekranlar dinamik aralığını sınırlayabilir. Ayrıca, bu ekranlar virüs çoğaltma virüs iyi adapte ana bilgisayara ve antiviral savunma mücadele yeteneğine ise sınırlandıran hücresel savunma yolları kolayca belirleyemiyor olabilir. Bu makalede, biz arboviruses gibi vesicular Stomatit virüs (VSV) tarafından üzerinde doğal olarak başarısız enfeksiyonlar virüs-ana etkileşimler merkezi ekranlar aracılığıyla keşfetmek için yeni bir paradigma tanımlamak. Çeşitli dipteran böcek ve memeli ev sahibi çoğaltmak yeteneği VSV rağmen VSV Lepidoptera böcekler, gypsy moth (Lymantria dispar) gibi türetilmiş hücre hatları çeşitli sonrası giriş, başarısız bir enfeksiyon uğrar. "Ne zaman konak hücre antiviral Savunma virüs olduğundan Ancak, bunlar abes VSV hastalık kurtarıldı". Biz nasıl VSV kodlama uygun reporter genler ve kısıtlayıcı L. dispar suşları tarif hücre hatları ana faktörler Abdovirüs sınırlama içinde katılan tanımlamak için kurulum ekranları için eşleştirilmiş. Ayrıca, biz de bu tarama araçları yarar VSV çoğaltma veya ektopik ifade memeli virüsler tarafından kodlanmış dahil olmak üzere, coinfection sırasında kurtarma virally kodlanmış faktörler tanımlaması gösterir. L. dispar hücrelerdeki VSV çoğaltma doğal sınırlamasının VSV kurtarma, böylece izlemek için basit ışıma ve floresan tabanlı deneyleri kullanımını teşvik koşulları için eleme yüksek sinyal gürültü oranı sağlar VSV çoğaltma değişiklikleri. Bu metodolojileri ana bilgisayar antiviral yanıt ve viral bağışıklık kaçırma faktörler arasındaki etkileşimi anlamak için değerlidir.

Introduction

Bir virüs verimli belirli bir ana çoğaltmak yeteneği kısmen destek viral giriş ve çoğaltma1konak hücre faktörler kullanılabilirlik tarafından yönetilmektedir. Aksi takdirde viral çoğaltma2,3engel olur sayaç hücresel antiviral savunma için bir virüs kapasitesi tarafından virüs ana bilgisayar aralığı da dikte. Sonuçta bir virüs yaşam döngüsünün belirli bir ana içinde tamamlamak mümkün olacak olup olmadığını karar bu karmaşık virüs-ana etkileşimler sonucu olur. Eğer viral çoğaltma ensues ana bilgisayara ilişkin potansiyel patojenik sonuçları göz önüne alındığında, bu abes ve üretken arasındaki dengeyi ipucu anahtar virüs-ana etkileşimler anlayışımız daha fazla için deneysel stratejiler geliştirmek için önemlidir enfeksiyonlar. Virüs ana bilgisayar etkileşimi moleküler özelliklerinin elucidating yeni ve alternatif antiviral tedavi stratejilerinin geliştirilmesi vesile olacaktır.

RNA müdahale (RNAi)4,ve advent ile5 ve genom düzenleme araçları (Örn., CRISPR-Cas9, çinko parmak nükleaz, TALENs)6,7, değiştirmek için deneysel olarak mümkün olmuştur hücresel genom çapında faktörlere ifade ölçekler ve virüs çoğaltma hakkında bu değişiklikleri etkisini keşfedin. Gerçekten de, çok sayıda RNAi ve ekranlar genom-düzenleme-tabanlı virüs-ana etkileşimler8,9,10, yeni esaslarını açıkladı omurgasız ve omurgalı konak hücre tiplerinde yapılmıştır 11 , 12. bu ekranlar genellikle gazetecilere, ateş böceği luciferase (LUC) veya floresan proteinler gibi kodlama virüs istihdam (Örn., GFP, DsRed), bir okuma olarak viral gen ekspresyonu kantitatif değerlendirilmesi uygun aracı sağlayan viral çoğaltma9,12. Bu strateji araştırmacılar ya teşvik veya viral çoğaltma tarafından artar ya da azalır, sırasıyla kanıtlandığı düşman,9,12viral muhabiri sinyalleri ana faktörleri belirlemek için sağlar. Ancak, büyük çoğu durumda, bu ekranlar hangi onlar incelendiği ana hücre tipi iyi adapte virüs kullanılarak yapılmıştır. Bu strateji viral patojenler ve onların doğal ana bilgisayarlar arasında coevolutionary ilişkiler anlamak için önemli olabilir de, açığa çıkarmak ana bilgisayar antiviral faktörleri onların kullanımı ile ilgili temel sorunları teşkil etmez. Bu gibi durumlarda, bir donanım virüs muhabir olarak sinyal RNAi nakavt için baktı ediliyor veya viral çoğaltma normalde engellemektedir hücresel bir faktör inactivation. İlk olarak, bir virüs zaten sağlam kontrol koşullar altında incelenmektedir ana bilgisayar hücredeki çoğaltmak mümkün ise (Örneğin, arka plan ve gelişmiş viral muhabir sinyalleri arasında ayrım yapmak yeteneği) ekranın dinamik alan sınırlı olabilir. İkinci olarak, bu sorun daha fazla virüs iyi adapte konak hücre ve içinde belgili tanımlık perde hedef alınmaktadır konak savunma yolları ortaya koydu, etkili olduğu durumlar tarafından bileşik olduğunu.

Eleme yöntemleri geleneksel virüs-ana bilgisayar etkileşimi ile ilgili yukarıdaki kaygıları nedeniyle doğal olarak başarısız Abdovirüs enfeksiyonlar Lepidoptera böcek hücrelerinde yararlanmak virüs-ana etkileşimler çalışmak için yeni bir paradigma geliştirdik. Bu strateji iyi okudu insan Abdovirüs, VSV, gypsy moth (L. dispar)13türetilmiş hücrelerdeki abes bir enfeksiyon uğrar bir gözlem türetilmiştir. VSV doğal memeli ana dipteran böcekler (yani, kum sinekleri) tarafından iletilir ve deneysel olarak geniş bir omurgasız bulaştırmak için gösterilmiştir ve omurgalı konaklarda her iki14kültür ve in vivohücre. 11-kb olumsuz anlamda tek iplikçikli RNA genomu VSV her saran virion kadar yapmak proteinler çevriliyor beş subgenomic mRNA'ların kodlar. Ancak, VSV ters genetik sistemler çoğaltma yetkili suşları LUC veya floresan proteinler, ek olarak beş doğal VSV gen ürünleri15,16,17kodlama yaratılması için izin. Bu muhabir proteinler VSV virion dahil değil çünkü onlar sonrası giriş oluşur VSV gen ekspresyonu için uygun bir okuma sağlar. VSV suşları GFP veya LUC kodlama kullanarak, biz daha önce VSV gen ekspresyonu ciddi LD652 hücreleri girişte sınırlıdır ve VSV titreleri 72 saat sonrası enfeksiyon (HPI) artırmayın göstermiştir. Buna ek olarak, LD652 hücreleri VSV ve memeli poxvirus, vaksinia virüs (VACV), coinfection VSV gen ekspresyonu ve titreleri Logaritmik artar bu zaman noktası tarafından yol açar. VACV erken gen ekspresyonu, DNA ikileşmesi ve geç gen ekspresyonu LD652 hücre enfeksiyonlar geçer ama VACV çoğaltma döngüsü nedeniyle eksik virion morfogenetik18sonuçta başarısız. Büyük ~ 192 kb DNA genom VACV, bunların çoğu viral çoğaltma ana bilgisayar bağışıklık yanıtı19bastırılması yoluyla teşvik immunomodulatory özelliklerini görüntülemek > 200 protein kodlayan. Bu nedenle, biz bu VACV coinfection tarafından LD652 hücrelerdeki VSV çoğaltma "kurtarma" büyük olasılıkla L. dispar yanıt normalde VSV çoğaltma sınırlama inhibe VACV immunomodulators tarafından aracılı olan. Bu destek, ana bilgisayar RNA polimeraz II inhibitörü actinomycin D LD652 hücrelerle tedavi de LD652 hücrelerde transkripsiyon-bağımlı ana bilgisayar yanıt VSV çoğaltma sonrası giriş13blok gösteren VSV çoğaltma kurtarır.

Yukarıdaki gözlemleri VSV enfeksiyona LD652 hücrelerin doğal olarak kısıtlayıcı doğa nispeten düşük bir arka plan ne zaman muhabir VSV kodlu sinyalleri (yani, bu ana bilgisayar inhibe geliştirmek koşulları için eleme sağlayabilir öneririm Antiviral savunma). Burada, floresan veya LUC tabanlı deneyleri ekrana VSV kısıtlama Lepidoptera hücrelerdeki rahatlatmak koşulları için kullanma yöntemleri sağlamak. İlk olarak, bu deneyleri VSV kısıtlama aday viral etkenler ektopik ifade veya her iki coinfection deneyler sırasında break virally kodlanmış immunomodulatory faktörleri belirlemek için nasıl kullanılabileceğini göstermektedir. Örnek olarak, biz nasıl biz bu tarama teknikleri poxvirus kodlanmış A51R protein diğer poxvirus faktörler13yokluğunda VSV çoğaltma kurtarmak immunomodulatory faktörler yeni bir aile tanımlamak için kullanılan göstermektedir. İkinci olarak, RNAi kısıtlayıcı VSV-LD652 hücre enfeksiyonları eleme doğrudan ökaryotik ana faktörler Abdovirüs kısıtlama13' te katılan tanımlamak için nasıl kullanılabileceğini göstermektedir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. genel Lymantria dispar (LD652) hücre ile virüs kültür

  1. LD652 hücre kültürü çalışmalarının ve kaplama
    1. Kültürüne L. dispar-türetilmiş LD652 hücreleri, normal atmosfer altında 27 ° C'de inkübe bir büyüme orta (Tablo reçetesi) hücrelerinin monolayer korumak. 10 cm doku kültürü tedavi edilen yemekleri hücreleri korumak ve % 80 confluency ulaşan üzerine hücreleri geçiş.
    2. Plaka, plaka yapisan LD652 hücrelerden art arda (Bu hücreler trypsinization çıkarmak için gerekmez) monolayer üzerine medya pipetting tarafından çıkarmak ve örnek 1 x 105 hücre/mL yaklaşık bir yoğunluğunun büyüme medyada sulandırmak için. 1 mL sulandırılmış kültür/iyi bir 24-şey plaka pipet. En az üç Çoğalt kuyu/tedavi türü her zaman noktası (en fazla sekiz tedaviler/plaka) için tohum.
    3. Hücreleri en az 1 h için yerleşmek için izin verir.
  2. Vaksinia virüs hazırlık
    1. VACV hisse senetleri hazırlamak mı, virüs HeLa içinde yükseltmek için20 hücreleri veya Afrika yeşil maymun böbrek hücreleri (lisans-1 veya BSC-40 hücreleri)20,21,22.
      Not: Burada açıklanan deneyleri içinde de VACV zorlanma Western Reserve (VACV-WR) çalışır.
    2. VACV zorlanma ile plak tahlil BSC-1 veya BSC-40 hücreleri20,22titre.
      Not: Tüm VACV çokluğu enfeksiyon (MOI) hücre enfeksiyonlar titreleri BSC-40 plak deneyleri elde edilen temel alan LD652 için burada açıklanan belirtti.
  3. Vesicular Stomatit virüs hazırlık
    1. VSV stokları hazırlamak için virüs BHK hücreleri23yılında yükseltmek.
    2. Plak tahlil BSC-40 veya BHK hücre monolayers13,23tarafından VSV titre.
      Not: Tüm VSV MOIs hücre enfeksiyonlar titreleri BSC-40 plak deneyleri elde edilen temel alan LD652 için burada açıklanan.

2. floresans tabanlı VSV kurtarma tahlil Co enfeksiyon ve canlı hücre düşsel kullanma

  1. Tohum ve enfeksiyon LD652 hücre
    1. 40.000 LD652 hücreler/iyi bir 8-şey odasının plaka.
    2. Floresans tabanlı canlı hücre görüntüsü için VSV suşları floresan protein kodlama kullanmak. Burada sunulan deneyler VSV-DsRed17, diğer VSV protein için erimiş değil ücretsiz DsRed protein ifade eder bir rekombinant VSV yük kullanın.
      Not: VSV enfeksiyon LD652 hücre tarafından 96 HPI cytopathic değildir ve böylece, hücre ölümü bir karıştırıcı faktör bu zaman dilimi içinde VSV çoğaltma değerlendirirken değil.
    3. Serum ücretsiz bir medya (SFM; VSV-DsRed ve VACV-FL-GFP hazırlık Tablo malzeme) 1 ve 25, bir MOI, anılan sıraya göre.
      Not: VACV-FL-GFP LUC ve GFP24arasında bir füzyon ifade eder bir rekombinant VACV yük olduğunu. 25 veya daha büyük bir MOI VACV suşları için kullanarak tüm LD652 hücreleri enfekte13olmasını sağlar. Eğer farklı bir coinfecting virüs istimal, MOI ampirik olarak Kullanıcı tarafından belirlenecektir gerekir. Her enfeksiyon tedavi yinelenen wells ayarlanmalıdır ve sahte enfekte tedavi sadece SFM hücrelere eklenir içerir.
    4. İnoculum 27 ° C'de 2 h için 0.2 mL hücrelerde kuluçkaya
    5. Hücreleri 0.5 mL/büyüme ortamının iyi yıkayın.
    6. Hücre canlılığı boya (Tablo reçetesi) 25 mikron hücrelerde büyüme medya 27 ° C'de 45 dk için kuluçkaya
    7. Medya Aspire edin ve kuyu 1 yıkama x 0.5 mL/de fazla boya kaldırmak için.
    8. 0.3 mL/de büyüme ortamının hücreleri korumak.
  2. Canlı hücre görüntü yakalama
    1. Bir confocal mikroskop 30 dk önceden açmak ve bir 8-şey odası yemek yükleyin.
      Not: Oda sıcaklığında 20-25 ° C arasında değişen LD652 hücreleri görüntüsü, ama optimal koşullar için oda sıcaklığını 27 ° C'ye ayarlanması gerektiğini
    2. Yansıması için uygun uyarma/emisyon ayarları her floresan marker protein için hem de faz kontrast görüntü ayarlarını ayarlayın.
    3. Her kanal için lazer yoğunluğunu ayarlayın.
      Not: Bu son deneyde kullanılacak saat ders boyunca gözlenen floresan sinyal yoğunluklarda aralığını belirlemek için bir pilot deneme gerçekleştirme gerektirebilir.
    4. 10 X objektif kullanarak istediğiniz zaman noktaya kadar enfeksiyon süresince her şey her 1 – 5 h faz kontrast ve floresan görüntülerini yakalamak (Örn., 48-72 HPI).
      Not: Enfeksiyon oranları kültür boyunca doğru bir şekilde tahmin etmek için her iyi görünümünde birden çok alan yakalamak önemlidir.
  3. Görüntü Analizi
    1. Görüntü analiz yazılımı uygun floresan kanalları otomatik görüntü analizi için kullanın (Örn., 405 nm, 488 nm, 568 nm).
    2. Enfekte hücreleri yüzdesini hesaplamak için floresan hücreleri VSV enfeksiyon gösteren toplam sayısına bölün (e.g., DsRed-pozitif hücreler VSV-DsRed enfeksiyonlar için) tarafından hücre canlılığı boya için etiketli hücrelerin toplam sayısına göre tüm tedaviler arasında her alanı elde edersiniz.

3. genel Viral enfeksiyon Protokolü VSV ışıldama tabanlı kurtarma deneyleri LD652 hücrelerdeki için

  1. İnoculum hazırlanması
    1. 30 enfeksiyon önce tezcan stokları VSV-LUC16 (bir rekombinant VSV zorlanma ücretsiz ateş böceği luciferase protein diğer VSV protein için erimiş değil o ifade eder). VSV-LUC kurtarmak için VACV coinfection sırasında raporlaması, ayrıca VACV-WR virüs buz çözme.
      Not: Diğer virüsler (yanında VACV-WR) VSV-LUC coinfection sırasında kurtarmak, ancak bu ampirik olarak her kullanıcı tarafından belirlenecektir gerekir.
    2. Öyle ki bir MOI 10 ve 25, sırasıyla, 0.2 mL toplam inoculum hacmi ekleyerek elde edilir varlığı veya yokluğu VACV-WR SFM içine VSV-LUC sulandrarak inoculum hazırlamak/iyi.
  2. Enfeksiyon hücreleri
    1. Dikkatle monolayer rahatsız edici önlemek için olgun LD652 medya Aspire edin ve virüs/iyi 0.2 mL ile aşılamak. Bu sefer 0 HPI tanımlanır. Steril SFM "sahte-enfekte" negatif kontrol tedaviler hizmet etmek için ek wells ekleyin.
    2. İnoculum 27 ° C'de 2 h için hücrelerde kuluçkaya
    3. 2 HPI, at inoculum aspirasyon tarafından kaldırmak ve 1 mL ile değiştirmek/LD652 büyüme medya iyi.
    4. Enfeksiyon 24-72 HPI devam etmek izin verir.

4. luciferase tahlil

  1. Hücre lysates hazırlanması
    1. Dikkatle süpernatant Aspire edin ve Dulbecco'nın fosfat tamponlu tuz çözeltisi (DPBS) 1 mL ekleyin / iyi.
    2. 1 mL şırınga pistonu kullanarak, hücreleri DPBS kazı.
    3. Microcentrifuge tüp ve 4 ° C'de 20 dk 400 x g , santrifüj hücreleri transfer
    4. Bu arada, 5 gazeteci lizis arabellek (RLB) steril H2o x 1 x seyreltme hazırlamak
    5. Santrifüjü hücre Pelet bozmadan DPBS Aspire edin.
    6. Her pelet 1 150 µL içinde resuspend x RLB.
    7. Donma-çözülme oda sıcaklığında su banyosu içinde hızlı bir çözülme ardından bir-80 ° C dondurucu bir dakika 5 kuluçka kullanarak x örnekleri 1. -80 ° C'de lysates analiz etmek için hazır kadar saklayın.
  2. Luciferase tahlil
    1. Lysates buz çözme.
    2. Bir katı siyah ya da beyaz 96-şey Mikroplaka bir kuyuya lysate, 20 μL pipet.
    3. Luciferase tahlil reaktif 100 μL her şey için ekleyin.
    4. Hemen bir luminometer kullanarak ışık yoğunluğunu ölçmek (belirli Luminometreler için uygun ayarları Kullanıcı tarafından ampirik olarak belirlenecek olacak).
  3. Luciferase tahlil analiz
    1. LU sinyalleri kontrol tedavisi (Temsilcisi sonuçları) elde edilen LU okumalar her tedavi için normalleştirmek. En az üç bağımsız deneyler gerçekleştirdikten sonra LU her tedavi/kontrol grubundan elde edilen ortalama uygun istatistiksel testler tarafından çözümlenebilir.

5. Immunoblot

  1. SDS-sayfa ve uygun reaktifler ve Araçları'nı kullanarak sonraki immunoblotting için LUC deneyleri için çıkarılan lysates kullanın.

6. LD652 hücre kültürlerden VSV titresi

  1. LD652 hücreleri adım 1.1 göre plaka.
  2. Viral enfekte hücreleri göre adım 3.
  3. İstenen saat noktalarda supernatants steril microcentrifuge tüpler içine toplamak.
  4. 4 ° C'de 10 dakika 1000 x g kullanarak hücreleri cips ve supernatants yeni tüpler için transfer.
  5. Supernatants-80 ° C'de depolayın veya plak tahlil BSC-40 hücreleri tarafından titrasyon ile devam edin.
    Not: VACV bulunan LD652 hücre kültürleri VSV titrating Eğer 2 HPI BSC-40 monolayers13tarihinde plaklar artık VACV parçacıklar önleyebilirsiniz, BSC-40 kültür ortamlara 100 μg/mL sitozin arabinoside (araç) eklemek için tavsiye edilir. Araç VACV DNA çoğaltma25 engeller, ancak VSV çoğaltmayı etkilemez bir viral DNA polimeraz engelleyici olduğunu.

7. ışıldama tabanlı VSV varyasyonları kurtarmak LD652 hücrelerdeki deneyleri: RNAi ve plazmid Transfection deneyleri

  1. RNAi aracılı nakavt, viral dsRNA hazırlanması veya ana transkript
    1. Tasarım gene özgü astar kuyruklu T7 organizatörü sıra (TAATACGACTCACTATAGGG) ya da hedef ile 5' sonunda coinfecting virüs (Örneğin, VACV) veya L. dispar mRNA transkript ilgi. Bu astar 400-600 bp etkili RNAi aracılı nakavt için PCR ürünü üretmek gerekir. Tavla ve ark. görmek 13 astar serileri için aşağıda devirme VACV veya L. dispar için transkript dsRNA-aracılı RNAi LD652 hücrelerdeki tarafından kullanılır.
      Not: L. dispar mRNA transkript üzerinden tanımlanabilir L. dispar transcriptome veritabanları26,27,28yayınlandı.
    2. Bir DNA şablon üzerinden RT-PCR oluşturmak (cDNA sentezi: 1 50 ° C çevriminde 30 dk; PCR: 94 ° c 40 devredir 15 s, 30 50 ° C s ve 68 ° C 45 için s her).
    3. PCR arıtma seti kullanarak PCR ürünü arındırmak.
    4. Arıtılmış PCR ürünü bir şablon olarak kullanıp, içinde vitro uyarlamak ve vitro transkripsiyon ve arıtma seti kullanarak dsRNA arındırmak.
  2. Transfection dsRNA veya plazmid DNA LD652 hücre içine
    1. Tohum 1 x 105 hücreleri/bir 24-şey tabak iyi ve en az 1 h için yerleşmek hücreleri izin.
    2. Her şey transfected için transfection reaktif 4 μL SFM 100 μL oranında seyreltin. En fazla 15 dakika oda sıcaklığında kuluçkaya. Bunun yapılması tüm transfections için ana bir karışımını yapmak için ölçeklenebilir.
    3. Transfected için SFM her şey için 100 μL ile dsRNA veya toplam plazmid DNA 1 μg kadar sulandırmak. En fazla 15 dakika oda sıcaklığında kuluçkaya.
      Not: Biz daha önce 1 μg dsRNA/105 LD652 hücre transfection için yeterli olduğunu bulduk > % 80'i devirme ya da viral veya ev sahipliği transkript13, dsRNA doz ama deneysel değişiklik için set ups/koşullar zorunda kalacak ampirik olarak kararlı olmak.
    4. Transfection reaktif ve dsRNA/plazmid DNA dilutions 1:1 oran ile birleştirmek (Örneğin, seyreltilmiş dsRNA 100 μL karıştırılır ile seyreltilmiş transfection reaktif 100 μL) ve oda sıcaklığında 20 dk için kuluçkaya.
    5. Bu arada, kuyu 1 mL/SFM, iyi yıkama ve her şey için SFM 500 μL ekleyin.
    6. Yavaş yavaş transfection reaktif dsRNA (veya plazmid DNA) eklemek karışımı her kuyuya dropwise.
    7. 5 h için hücreler transfection reaktif kuluçkaya.
      1. RNAi için (Örneğin, VACV), coinfecting bir virüs tarafından kodlanmış transkript nakavt içeren deneyler yerine transfection reaktif 5-h transfection kuluçka süresinden sonra virüs inoculum VSV-LUC içeren (veya VACV olmadan veya başka bir coinfecting virüs) (adım 3). Daha sonra VSV-LUC tam büyüme medya 2 HPI ile içeren virüs inoculum değiştirin. LUC deneyleri (adım 4) o zaman hulâsa lysates virüs transkript coinfecting nakavt VSV-LUC kurtarma bir kaybına neden Eğer belirlemek için çeşitli zaman noktalarda gerçekleştirilebilir.
      2. RNAi deneyler, RNAi L. dispar transkript içeren için tam büyüme ortamı ile transfection mix değiştirin ve nakavt VSV-LUC (adım 4) ile enfeksiyon önce 24 h için doğmak izin verir. LUC deneyleri (adım 4) o zaman hulâsa lysates L. dispar transkript nakavt VSV-LUC kurtarma teşvik Eğer belirlemek için çeşitli zaman noktalarda gerçekleştirilebilir.
      3. Plazmid ifade vektörlerin aday immunomodulators ifade transfections içeren deneyler için transfection reaktif değiştirin ve protein ifade VSV-LUC (adım 4) ile enfeksiyon önce 24 h için izin vermek. LUC deneyleri (adım 4) o zaman hulâsa lysates Ifade aday immunomodulatory proteinlerin VSV-LUC kurtarma teşvik olup olmadığını belirlemek için çeşitli zaman noktalarda gerçekleştirilebilir.
        Not: burada 1 μg/iyi plazmid DNA sonucu 40-%6013transfection verimliliği kullanılarak açıklanmıştır transfection koşulları.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Canlı hücre görüntüleme uygulamaları VSV kurtarma VACV coinfection üzerine izlemek için bir örnek olarak, LD652 hücreleri bir 8-şey odacıklı tabak içinde kaplama ve sahte enfekte veya VSV-DsRed ile enfekte (MOI = 1) varlığı veya yokluğu VACV-FL-GFP (MOI = 25). VSV-DsRed DsRed ücretsiz bir protein olarak ifade eder ve yapısal VSV proteinler (Şekil 1A) erimiş değil çünkü, VSV giriş ve gen ifade başlattıktan sonra sadece algılanır. Tüm hücreleri sonra serbestçe nerede etiketli hücreleri floresan sinyalin tutma teşvik membran impermeant bir ürün haline dönüştürülen hücrelerin plazma zarı geçer hücre canlılığı boya etiketlenmiş. Görüntüleri her 5 h 65 HPI, 405 kullanarak kadar elde nm, 488 nm, 568 nm ve beyaz ışık hücre canlılığı boya, VACV-FL-GFP, VSV-DsRed ve faz kontrast (PC) Kanallar, sırasıyla yakalamak için filtreler. Tek enfeksiyon koşullar altında VSV-DsRed çoğaltma LD652 hücreleri kısıtlamak; Bu nedenle, yalnızca az sayıda hücre DsRed sinyal sergi. Ancak, VSV-DsRed VACV-FL-GFP ile coinfection en hücreleri DsRed sinyalleri zaman ders (Şekil 1B) sonuna görünen sonuç. Her zaman noktasında yakalanan görüntüleri tabi görüntü analiz yazılımı için nerede 405 nm ve 568 nm kanal görüntüleri otomatik olarak toplam ve DsRed pozitif hücre sayıları, sırasıyla belirlemek için kullanılmıştır. Her tedavi için bir DsRed sinyal görüntüleme hücre yüzdesi nesneleri (hücreler) 568-nm kanaldaki olumlu bir sinyal ile 405 nm kanal %100 tarafından çarpma tarafından takip her zaman noktası için tanımlanan nesneleri sayısına göre bölünerek hesaplanır . Şekil 1 ciçinde gösterildiği gibi VSV-DsRed tek enfeksiyonlar hücrelerden ~ %2 65 HPI tarafından DsRed-pozitif idi. Buna ek olarak, VSV-DsRed + VACV-FL-GFP coinfections hücrelerde ~ %77 DsRed pozitif bu zaman noktada idi. Filmler S1 ve S2 göster VSV-DsRed enfeksiyon ilerleme tek enfeksiyon ve coinfection koşulları, tüm 65-h saat boyunca anılan sıraya göre. GFP ifade VACV-FL-GFP tarafından yeterli VACV gen ekspresyonu (gösterilmez) VSV-DsRed kurtarma önce gerekli olduğunu belirten DsRed sinyal önce 10 HPI tarafından algılanabilir oldu unutmamak gerekir. Toplu olarak, bu sonuçlar bir kurtarma VSV-DsRed çoğaltma VACV coinfection tarafından açıkça göstermektedir. Coinfecting bir virüs VSV-DsRed kurtarmak mümkün olsaydı, biz DsRed pozitif hücreler tek enfeksiyon ve coinfection tedavileri arasında eşit oranlarda beklenebilir.

VSV çoğaltma LD652 hücrelerdeki alternatif olarak VSV-LUC suşları (Şekil 2A) kullanırken deneyleri ışıldama tabanlı kullanarak sayısal. Örneğin, Şekil 2B 72 h saat dersten sahte enfekte hücreleri veya VSV-LUC ile enfekte hücreleri üzerinde hazırlanan lysates kullanarak bir LUC tahlil sonuçlarını gösterir (MOI = 10) varlığı veya yokluğu VACV-WR (MOI = 25). Bir olumlu kurtarma VSV-LUC çoğaltma rasgele LU coinfected hücreleri, lysates için tek VSV-LUC bulaşan göre hazırlanan lysates ile tespit Logaritmik artış simgesiyle gösterilir. Negatif bir sonuç bu tahlil LU okuma bu tek VSV-LUC enfeksiyon tedavileri gözlenen değiştirmek için bir coinfection hata belirtilen. İstenirse, hazırlanan lysates de immunoblotting için gelişmiş VSV gen ekspresyonu coinfection tedavisine onaylamak için kullanılabilir. Örneğin, Şekil 2C tipik immunoblot sonuç VSV kodlanmış LUC ve matris için (M) proteinler hazırlanan sahte-, VSV-LUC ve VSV-LUC + VACV-WR tedaviler 72 HPI lysates gösterir. Immunoblotting VACV I3L protein VACV enfeksiyon bir işareti olarak hizmet ve immunoblotting hücresel aktin için yükleme denetimi olarak kullanıldı. Coinfection lysates daha fazla VSV kodlanmış LUC ve M proteinlerin açık geliştirme VSV kurtarma VACV tarafından onaylayın. Son olarak, üretken VSV çoğaltma supernatants bu LD652 hücre kültürleri toplama ve BSC-40 monolayers (Şekil 2B) bulaşıcı bir virüs titrating tarafından onaylanabilir. Sadece VACV sırasında VSV verimli Çoğalt coinfection mu bu sonucunu gösterir.

Bir kez coinfecting bir virüs VSV çoğaltma LD652 hücrelerdeki tahlisiye yetenekli gösterilir, RNAi tarama VSV kurtarmak için katkıda coinfecting virüs tarafından kodlanmış etkenleri tanımlamak için kullanılabilir. Bu deneyde, bir "kayıp kurtarma" fenotip VSV-LUC coinfection kurtarmaktan virüs sırasında yol açar bir RNAi koşulu için ekran. Daha önce VACV A51R protein VACV kodlanmış transkript13düzinelerce bir RNAi tarama yoluyla VSV kurtarma faktör olarak tanımlanmış. Örnek olarak, bu ekran (Şekil 3) daha küçük bir ölçek versiyonu recapitulated. RNAi vitro transfection tarafından aracılı transkripsiyonu coinfecting virüs tarafından kodlanmış transkript hedef dsRNAs. Burada gösterilen veri, VACV A50R, A51R ve A52R protein kodlama viral transkript RNAi nakavt için hedef. Bir negatif kontrol kaybı kurtarmak için hücreleri de GFP kodlama transkript hedefleme dsRNAs ile transfected. Kurtarma fenotip kaybı için olumlu bir denetim olarak hücreleri dsRNAs karşı LUC-encoding tutanaklar ile transfected. Bu tedavi sırasında coinfection bir güçlü sinyal kaybı, LU üretir ve araştırmacılar transfection/RNAi protokolleri çalıştığını onaylamak yardımcı olur. DsRNA transfection bir 5 h sonra hücreleri VSV-LUC ile coinfected (MOI = 10) ve VACV-WR (MOI = 25). Sadece VSV LUC ile ayrı enfeksiyonlar da LU sinyal arka plan düzeyini kurmak için yapıldı. Lysates vardı o zaman 72 HPI hasat ve LUC assay olarak kullanılır. Nakavt A50R ve A52R negatif sonuç (kaybı olmaksızın üretir, ancak VSV kurtarma düzeyini GFP dsRNA kontrol tedavi tedavilere dsRNA arasında karşılaştırma, sonuçlar VACV A51R nakavt kurtarma fenotip, güçlü bir kaybı üretir gösterir Kurtarma) GFP dsRNA karşılaştırıldığında.

Alternatif olarak RNAi VSV kurtarmak için katkıda viral etkenler tanımlamak için eleme için aday viral etkenler LD652 hücrelerdeki overexpress ve VSV-LUC kurtarma için tahlil. Bu p16629 gibi uygun ifade vektörel çizimler içine ilgi aday Gen klonlama ve LD652 hücrelere VSV-LUC meydan öncesinde bu Plasmid'ler transfecting tarafından gerçekleştirilebilir. Örneğin, Şekil 4A kurtarma deney hangi bayrak öğesini GFP (FGFP) veya A51R bayrak öğesini gösterir (FA51R) p166 vektörler transfected LD652 hücrelere VSV-LUC enfeksiyon tarafından takip çeşitli konsantrasyonlarda (MO = 10) 24 saat sonra. Bir negatif kontrol VSV kurtarma için olarak ek kültür sahte transfected ve plazmid DNA almadı. Lysates kültürleri 72 HPI toplanmıştır ve LUC deneyleri için tabi tutuldu. FA51R tedaviler sahte transfected tedaviler birden fazla dozda üzerinde gelişmiş LU sinyalleri tarafından gösterildiği gibi olumlu bir VSV kurtarma sonuç üretti. Buna ek olarak, FGFP tedavisi, VSV kurtarma herhangi bir doz test negatifti. Şekil 4A üzerinden lysates Immunoblotting FGFP ve FA51R proteinleri (Şekil 4B) benzer bir ifade doğruladı.

Aday L. dispar faktörler bir RNAi tarama kullanarak, biz LD652 hücrelerdeki VSV sınırlamasının antiviral RNAi yolları ait çeşitli hücresel faktörler tarafından aracılık ettiği göstermiştir (Örneğin, AGO2 ve dilici-2), nükleer faktör Kappa B (NF-κB)-ilgili IMD yolu (Örneğin, zevkle)ve ubiquitin-proteasome sistemi (Örn., polyubiquitin)13. Örnek olarak, biz dsRNAs VSV-LUC çoğaltma nakavt üzerine geliştirilmiş L. dispar transkript hedefleme ile bu RNAi deneyler daha küçük bir ölçek versiyonu tekrarladık (Örn., AGO2, dilici-2, çeşni, polyubiquitin) veya hiçbir etkisi (AGO1 yoktu )13. DsRNA transfection, 24 saat sonra hücreleri VSV-LUC için 72 h RNAi tedaviler LU sinyalleri negatif kontrol GFP dsRNA tedaviler üzerinde gelişmiş Eğer belirlemek için ile meydan. LU sinyalleri geliştirmek RNAi tedaviler hedeflenen çeviren kodlu faktör VSV çoğaltma kısıtlar gösterir. RNAi nakavt için olumlu bir denetim olarak, LUC-encoding transkript hedefleme dsRNAs da paralel tedavilerde transfected. LU sinyalleri tespit GFP dsRNA denetim tedavilerde onların nakavt ~ 10 üretir çünkü RNAi tarama kullanarak ev sahibi olarak kodlanmış kısıtlama faktörler tanımlamak için nispeten basit düşük arka plan-LU sinyaller ( 1000 kat artar Şekil 5). Böylece, nispeten düşük arka plan VSV kısıtlama rahatlatmak ana bilgisayar RNAi devirme koşulları için ekran için LD652 hücrelerdeki VSV gen ifade düzey yararlanmak mümkündür.

Figure 1
Şekil 1: VSV kurtarma virüs coinfection floresan tabanlı canlı hücre Imaging'i kullanma LD652 hücre tarafından tanımlaması. DsRed (dR) gen yerini gösteren VSV-DsRed genom şematik bir (A) Bu panel gösterir. Yakalanan 60 HPI (B) Bu temsilcisi 10 X confocal mikroskobu görüntülerdir. 405 nm kanal bir leke için hücrelerin, 488-nm kanal VACV-FL-GFP enfeksiyon gösterir ve 568 nm kanal VSV-DsRed enfeksiyonu gösterir. Faz kontrast (PC) görüntüleri de gösterilir. Ölçek çubukları = 100 µm. (C) Bu panel tüm 65 h enfeksiyon zaman boyunca DsRed pozitif LD652 hücreleri yüzdesini gösterir. Her zaman noktasının bir DsRed sinyali gösterilen hücrelerin ortalama (SD) yüzdesi gösterilir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Şekil 2: LUC deneyleri kullanarak LD652 hücrelerdeki VSV kurtarma değerlendirilmesi. Şematik bir VSV-LUC genomunun bir (A) Bu panel gösterir. (B) Bu panel (LUC) deneyleri lysates sahte enfekte hücreleri veya yokluğu veya VACV-WR varlığı VSV-LUC ile enfekte hücreleri, rasgele ışık birimleri gösterir. (C) Bu panel bir immunoblot LUC, VSV M, VACV I3L gösterir ve hücresel aktin proteinler lysates A panelinden arasında 72 HPI toplanan. (D) Bu panel VSV-LUC titreleri Masası'ndan Belde edilen kültür supernatants gösterir. Nicel veri panelleri B ve D temsil nüsha gerçekleştirilen deneyler (± SD) anlamına gelir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Resim 3: bir virally kodlanmış VSV kurtarma faktör RNAi tarama sırasında coinfection LD652 hücre aracılığıyla tanımlaması. Bu panel LU LU lysates tek başına VSV-LUC ile enfekte hücreleri tespit göre belirtilen RNAi tedaviden sonra lysates hücreleri 72 HPI VSV-LUC ve VACV-WR üzerinden tespit kat değişiklikleri gösterir. Verileri temsil nüsha gerçekleştirilen deneyler (± SD) anlamına gelir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4: VSV viral Immünomodülatör LD652 hücrelerdeki overexpression tarafından kurtarılması. (A) Bu panel gösterir (sahte) sahte transfected veya FGFP veya FA51R p166 ifade Plasmid'ler ile transfected bir LUC tahlil VSV-LUC-enfekte hücreleri 72 HPI. Her tedavi LU sinyalleri sahte transfected denetim tedavilerde tespit sinyalleri için normalleştirilmiş. Verileri temsil nüsha gerçekleştirilen deneyler (± SD) anlamına gelir. (B) Bu panel lysates Masası'a A, immunoblotted bayrak ve aktin antikorları ile gösterir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 5
Şekil 5: Ana bilgisayar kimliği faktörler kısıtlama VSV çoğaltma RNAi tarama ile LD652 hücrelerde. Bu panel kat LU sinyalleri belirtilen RNAi tedavisine GFP dsRNA denetim tedaviler 72 HPI VSV-LUC ile göre değişim gösterir. Verileri temsil nüsha gerçekleştirilen deneyler (± SD) anlamına gelir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Film S1: temsilcisi 405-nm (hücre canlılığı boya) ve 65 h saat boyunca yakalanan 568 nm (DsRed) Kanal görüntüleri (her çerçeve 5 h aralığı =) LD652 hücre VSV-DsRed enfeksiyon sonra. Bu dosyayı indirmek için buraya tıklayınız.

Film S2: temsilcisi 405-nm (hücre canlılığı boya) ve 65 h saat boyunca yakalanan 568 nm (DsRed) Kanal görüntüleri (her çerçeve 5 h aralığı =) coinfection LD652 hücre VSV-DsRed ve VACV-FL-GFP sonra. Bu dosyayı indirmek için buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Burada basit floresan ışıma-temelli ve deneyleri VSV çoğaltma kısıtlayıcı Lepidoptera hücre kültürlerinde kurtarmak koşulları için ekran anlatmıştık. Mükemmel bir sinyal-gürültü oranı VSV gen ekspresyonu için raporlaması VSV Lepidoptera hücrelerdeki abes enfeksiyon oluşturur. Örneğin, lysates--dan tek VSV-LUC hastalık tespit LU sinyalleri edildi ~ 1000 kat daha fazla daha yüksek lysates, sahte enfekte içinde bu sinyalleri sadece yaklaşık iki kat 72-h saat boyunca değişti. henüz. Buna ek olarak, gelişmiş VSV-LUC VACV ile coinfection LU sinyalleri ~ 300-fold bitti tek VSV-LUC enfeksiyondan 72 HPI tarafından. Böylece, VSV kurtarma deneyleri büyüklükte birkaç emir kapsayan mükemmel bir Dinamik Aralık görüntüler.

Bu deneyleri kurulmasında önemli adımlardan birini floresan veya ışıldama temel yaklaşımlar kullanarak VSV kurtarma için tahlil kararı içerir. Biz nasıl VSV kodlanmış DsRed sinyalleri kantitatif canlı hücre görüntüleme teknikleri ve DsRed pozitif hücrelerinin otomatik miktar yokluğu veya varlığı bir kurtarma kolaylaştırmak yazılım paketleri kullanılarak denenecektir örnekleri göstermiştir coinfection. Araştırmacılar canlı hücre görüntüleme yetenekleri erişiminiz varsa, bu deneyleri ayarlamak ve çok çeşitli VSV kinetik dar sırada tek gözlemlenebilir farklılıkları tespiti yardımcı zaman puan yakalamak izin ucuzdur Windows. Buna ek olarak, ışıma tabanlı yaklaşımlar aslında hücre lysates önceden belirlenmiş zaman noktalarda hazırlık gerektiren son nokta deneyleri, ve lysate hazırlık zaman alıcı olabilir. Öte yandan, ışıma tabanlı deneyleri sofistike mikroskobu ekipman gerekmez — yalnızca bir plaka okuyucu ışıldama sinyalleri okuma yeteneğine sahip. Ayrıca, ışıma tabanlı deneyleri büyük dinamik alanı hücreleri enfekte yüzdesini hesaplamak mikroskobu tabanlı deneyleri daha var. Örneğin, mikroskobu deneyleri (VSV-DsRed enfeksiyon gösteren) DsRed-pozitif hücreler yalnızca 0-100 arasında olabilir analiz görünümünde alan hücrelerde %. Buna ek olarak, tek VSV-LUC ve coinfection koşulları (veya diğer kurtarma koşullar) arasında LU sinyalleri büyüklükte birkaç emir arasında olabilir.

Bu doğal olarak korunmuş muhtemeldir ve antik nedir bastırmak viral etkenler tanımlanması için seçer memeli virüs kodlanmış immunomodulators için ekran için burada sunulan VSV -L. dispar hücre sistemi kullanımının önemli bir avantaj olduğunu omurgalılar özgü interferon yanıtı doğrudan dördüncü adıma geçerler antiviral yanıt. Gerçekten de, A51R proteinler (bkz: tavla ve ark. korunmuş antiviral Ubikuitin-proteasome ile ilgili hücresel yanıt inhibe ön gözlemler öneririm 13 ve yayınlanmamış veri). Kapaklı virüs kurtarma bir omurgasız konak13' te omurgalı bir virüs tarafından ilk örneği VACV A51R kurtarılması VSV keşif, ve bu tarama sistemleri ek omurgalı virüs kodlanmış immunomodulators ortaya çıkarmak olacaktır muhtemelen . Ana bilgisayar dokunulmazlık inhibe koşulları için bir okuma VSV çoğaltma olarak VSV kurtarma kullanarak anahtarı ağır sınırlı (veya başarısız) olması gerektiğini unutmamak gerekir VSV çoğaltma olarak incelendiğinde hücre yazın. Bu nedenle, verilen bu VSV memeli hücrelerinde de çoğaltır en memeli hücre tipleri deneyleri, bu tür için uygun olmayan büyük olasılıkla olurdu. Bu yüzden L. dispar hücreler kullanılmıştır burada VSV için bir doğal olarak kısıtlayıcı konak hücre türü olarak.

Bir önceki çalışma Drosophila hücrelerdeki viral bastırıcılarının antiviral RNAi tepkilerin ifade plazmid aday RNAi bastırıcılarının ve kendi kendini kopyalayan bir sürü ev virüs genomik RNA kodlama cotransfection tarafından teşhis edilebileceğini gösterdi bu GFP B2, onun doğal RNAi bastırıcı30yerine kodlar. Flock House genomik RNA çoğaltılması ve GFP üretimini RNAi bastırma cotransfected aday faktörü bağımlı ve böylece, RNAi bastırma30GFP ifade kurtarma belirtti. Virüs kodlanmış RNAi inhibitörleri overexpression da bu sistem de bastırıcılarının bağlamında RNAi tepkilerin tanımlamak için kullanılabilir düşündüren VSV-LUC gen ekspresyonu L. dispar hücrelerdeki kurtarır yayınlanmamış çalışmalarımız gösterir enfeksiyon bir bona fide viral patojen olarak karşı bir replicon tarafından. Nitekim, birkaç antiviral yollar viral antagonistleri VSV tarafından tespit edilmesi VSV çoğaltma L. dispar hücreleri13 ' te sınırlamasının RNAi, IMD ve ubiquitin proteasome ilgili yolu katkıda bulma öneriyor Burada sunulan kurtarma deneyleri.

Bir potansiyel bu tarama yöntemleri ile ilgili ana bilgisayar antiviral proteinlerin tanımlanması L. dispar genom dizisi henüz kullanılabilir değil kısıtlamasıdır. Ancak, genel kullanıma sunulan L. dispar vardır RNAi devirme26,27,28için aday ana hedefleri tanımlamak için kullanılan transcriptomes. Ayrıca, biz daha önce VSV şimdi kamuya genom (Örneğin, Manduca sexta) olan diğer lepidopterans13 türetilmiş hücre hatlarında sınırlıdır göstermiştir31. Bu nedenle, diğer lepidopterans sıralı genleri ile türetilmiş hücre hatları kuralında burada açıklanan L. dispar hücreler yerine kullanabilir.

Ekonomik büyüme ve Halk Sağlığı tehdit arboviruses32göz önüne alındığında, burada sunulan tarama deneyleri değeri yeni antiviral tasarımında olabilir Abdovirüs ana bilgisayar etkileşimlerin yeni özellikler tanımlamak için yeni stratejiler sağlayabilir tedavi. Ayrıca, Lepidoptera mekanizmaları RNA virüsü çoğaltma kısıtlamak için göreceli olarak sınırlı bizim anlayış nedeniyle bu tarafından kodlanmış konak savunma mekanizmaları incelemek için yeni fırsatlar burada sunulan araçları sağlamak ekonomik açıdan önemli böcekler sırasını.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

D.G. University of Texas Southwestern Tıp Merkezi donatılmış akademisyenler programdan fon tarafından desteklenmiştir. Yazar Michael Whitt (Tennessee Üniversitesi Sağlık Bilimleri Merkezi) ve Sean Whelan (Harvard Medical School) VSV-DsRed ve VSV-LUC sağlanması için teşekkür ederiz. Yazarlar ayrıca Gary Luker (Michigan Üniversitesi Tıp Fakültesi) VACV-FL-GFP zorlanma tür hediye için teşekkür ederiz.

Materials

Name Company Catalog Number Comments
6-well tissue culture plates CELLTREAT 229106
24-well tissue culture plates CELLTREAT 229124
10 cm tissue culture dishes Corning C430167
Grace’s Insect Medium Sigma G8142
EX-CELL 420 Sigma 14420C
Fetal Bovine Serum - Optima Atlanta Biologicals S12450
Growth medium 1:1 mixture of Grace's Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1% antibiotic-antimycotic solution and 10% Fetal bovine serum
Antibiotic-Antimycotic Solution (100×) Sigma A5955
Dulbecco’s Phosphate Buffered Saline (DPBS) Sigma D8662
Serum Free Media (SFM) Thermo Fisher 10902096
Cytosine arabinoside Sigma C1768
Transfection reagent Thermo Fisher 10362100
Corning cellgro DMSO (Dimethyl Sulfoxide) Corning 25950CQC
Reporter lysis buffer 5x Promega E3971
Luciferase Assay Reagent Promega E1483
96-Well Microplates Corning 3915
Mouse anti-FLAG antibody Wako 014-22383
Rabbit anti-firefly luciferase antibody Abcam ab21176
Mouse anti-actin antibody Sigma A2066
Mouse anti-VSV M N/A N/A Dr. John Connor (Boston University)
Mouse anti-VACV I3L N/A N/A Dr. David Evans (University of Alberta)
8-well Chambered dish Lab-Tek II 155409
Cell viability dye Thermo Fisher C12881
FLUOstar microplate reader BMG Labtech FLUOstar
Confocal microscope Olympus FV10i-LIV
Image analysis software Olympus v1.18 cellSens software
Eppendorf 5702 ventilated centrifuge Eppendorf 22628102
Odyssey Fc Infrared Imaging System Li-COR Biosciences Odyssey Fc
LD652 cells N/A N/A Dr. Basil Arif (Natural Resources Canada)
BSC-40 cells ATCC CRL-2761
BHK cells ATCC CCL-10
HeLa cells ATCC CCL-2
BSC-1 cells ATCC CCL-26
in vitro transcription and purification kit Thermo Fisher AM1626
PCR purification kit Qiagen 28104

DOWNLOAD MATERIALS LIST

References

  1. Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. Viral tropism. Frontiers in Microbiology. 3, 281 (2012).
  2. Werden, S. J., McFadden, G. The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus. Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784, (1), 228-237 (2008).
  3. McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. Cytokine determinants of viral tropism. Nature Reviews: Immunology. 9, (9), 645-655 (2009).
  4. Silva, J. M., et al. Second-generation shRNA libraries covering the mouse and human genomes. Nature Genetics. 37, (11), 1281-1288 (2005).
  5. Moffat, J., et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell. 124, (6), 1283-1298 (2006).
  6. Ma, D., Liu, F. Genome Editing and Its Applications in Model Organisms. Genomics Proteomics Bioinformatics. 13, (6), 336-344 (2015).
  7. Yin, H., Kauffman, K. J., Anderson, D. G. Delivery technologies for genome editing. Nature Reviews: Drug Discovery. 16, (6), 387-399 (2017).
  8. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, (7206), 890-893 (2008).
  9. Houzet, L., Jeang, K. T. Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis. Experimental Biology and Medicine. 236, (8), Maywood, NJ. 962-967 (2011).
  10. Marceau, C. D., et al. Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens. Nature. 535, (7610), 159-163 (2016).
  11. Savidis, G., et al. Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics. Cell Reports. 16, (1), 232-246 (2016).
  12. Panda, D., Cherry, S. Cell-based genomic screening: elucidating virus-host interactions. Current Opinion in Virology. 2, (6), 784-792 (2012).
  13. Gammon, D. B., et al. A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection. Elife. 3, (2014).
  14. Letchworth, G. J., Rodriguez, L. L., Del cbarrera,, J, Vesicular stomatitis. Veterinary Journal. 157, (3), 239-260 (1999).
  15. Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones. Proceedings of the National Academy of Sciences of the United States of America. 92, (18), 8388-8392 (1995).
  16. Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization. PLoS Pathogens. 5, (4), e1000394 (2009).
  17. Duntsch, C. D., et al. Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model. Journal of Neurosurgery. 100, (6), 1049-1059 (2004).
  18. Li, Y., Yuan, S., Moyer, R. W. The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus. Virology. 248, (1), 74-82 (1998).
  19. Seet, B. T., et al. Poxviruses and immune evasion. Annual Review of Immunology. 21, 377-423 (2003).
  20. Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. Preparation of Cell Cultures and Vaccinia Virus Stocks. Current Protocols in Microbiology. 39, 11-18 (2015).
  21. Andrei, G., et al. Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice. Journal of Virology. 80, (19), 9391-9401 (2006).
  22. Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. Preparation of recombinant vaccinia virus for expression of small GTPases. Methods in Enzymology. 174-188 (1995).
  23. Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection. Bio-Protocol. 7, (22), (2017).
  24. Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread. Virology. 341, (2), 284-300 (2005).
  25. Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. Vaccinia reporter viruses for quantifying viral function at all stages of gene expression. Journal of Visualizes Experiments. (87), e51522 (2014).
  26. Cao, C., et al. Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance. Pesticide Biochemistry and Physiology. 119, 54-61 (2015).
  27. Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis. PloS One. 8, (5), e61190 (2013).
  28. Sparks, M. E., Gundersen-Rindal, D. E. The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts. Viruses. 3, (11), 2339-2350 (2011).
  29. Lin, G., Li, G., Granados, R. R., Blissard, G. W. Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion. In Vitro Cellular & Developmental Biology - Animal. 37, (5), 293-302 (2001).
  30. Li, W. X., et al. Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing. Proceedings of the National Academy of Sciences of the United States of America. 101, (5), 1350-1355 (2004).
  31. Kanost, M. R., et al. Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta. Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).
  32. Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases. BMJ Global Health. 3, (2018).
Araçlar Viral Immunomodulators ve ana bilgisayar Antiviral faktörler tanımlanması için eleme olarak Abdovirüs enfeksiyonlar
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).More

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter