Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

रिवर्स प्रतिलेखन-पाश-मध्यस्थता इज़ोटेर्माल प्रवर्धन (आरटी-दीपक) Zika वायरस और मूत्र, सीरम में गृह व्यवस्था जीन के लिए परख, और मच्छर के नमूने

doi: 10.3791/58436 Published: September 14, 2018

Summary

इस प्रोटोकॉल एक कुशल और कम लागत विधि मानव मूत्र और सीरम नमूनों में या Zika वायरस या नियंत्रण लक्ष्य का पता लगाने के लिए रिवर्स प्रतिलेखन पाश-मध्यस्थता इज़ोटेर्माल प्रवर्धन (आरटी-चिराग) द्वारा प्रदान करता है । इस विधि आरएनए अलगाव की आवश्यकता नहीं है और 30 मिनट के भीतर किया जा सकता है ।

Abstract

Zika वायरस (ZIKV) के साथ संक्रमण वयस्कों में स्पर्शोन्मुख किया जा सकता है, हालांकि, गर्भावस्था के दौरान संक्रमण गर्भपात और गंभीर स्नायविक जन्म दोष के लिए नेतृत्व कर सकते हैं । इस प्रोटोकॉल के लक्ष्य को जल्दी से दोनों मानव और मच्छर के नमूनों में ZIKV का पता लगाने के लिए है । ZIKV डिटेक्शन के लिए वर्तमान स्वर्ण मानक मात्रात्मक रिवर्स प्रतिलेखन पीसीआर (qRT-पीसीआर); रिवर्स प्रतिलेखन पाश-मध्यस्थता इज़ोटेर्माल प्रवर्धन (आरटी-लैंप) महंगे उपकरणों के लिए आवश्यकता के बिना एक अधिक कुशल और कम लागत के परीक्षण के लिए अनुमति दे सकता है. इस अध्ययन में, आरटी-दीपक पहले नमूना से आरएनए अलग बिना 30 मिनट के भीतर विभिन्न जैविक नमूनों में ZIKV का पता लगाने के लिए प्रयोग किया जाता है । इस तकनीक ZIKV संक्रमित रोगी मूत्र और सीरम, और संक्रमित मच्छर के नमूनों का उपयोग कर प्रदर्शन किया है । 18S राइबोसोमल ribonucleic एसिड और actin क्रमशः मानव और मच्छर के नमूनों में नियंत्रण के रूप में उपयोग किया जाता है ।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

२०१५ में, Zika वायरस (ZIKV) चिंता का एक संक्रामक रोग के रूप में प्रमुख वैश्विक ध्यान प्राप्त किया है क्योंकि गर्भावस्था के दौरान संक्रमण गर्भपात, मृतशिशु, microcephaly सहित गंभीर स्नायविक जंम दोष, साथ ही साथ अंय जंमजात से जुड़ा हुआ था जन्म दोष1. दुर्लभ मामलों में, ZIKV Guillain-Barré सिंड्रोम के साथ जुड़ा हुआ है । ZIKV मुख्यतः एडीज मच्छरों द्वारा फैलता है; हालांकि, यह भी यौन संपर्क1के माध्यम से फैलता जा सकता है । यह देखते हुए कि ZIKV के साथ संक्रमण ज्यादातर लोगों में स्पर्शोन्मुख या हल्के फ्लू जैसे लक्षण है कि अंय arborviruses1के संक्रमण के लक्षणों के साथ ओवरलैप के साथ प्रस्तुत करता है, वहां तेजी से और लागत प्रभावी का पता लगाने के लिए बेहतर तरीकों के लिए एक की जरूरत थी ZIKV दोनों लोगों के साथ ही स्थानीय मच्छर आबादी स्क्रीन करने के लिए ।

मात्रात्मक रिवर्स प्रतिलेखन पीसीआर (qRT-पीसीआर) ZIKV का पता लगाने के लिए एक विश्वसनीय परख है; हालांकि, इस तकनीक महंगा विशेष उपकरण की आवश्यकता है, प्रशिक्षित कर्मियों, और आरएनए अलगाव ब्याज के नमूने से । रिवर्स प्रतिलेखन पाश-मध्यस्थता इज़ोटेर्माल प्रवर्धन (आर टी-लैंप) एक कदम न्यूक्लिक एसिड प्रवर्धन विधि पीसीआर प्रौद्योगिकी पर आधारित है कि केवल एक गर्मी कतरा के साथ एक thermophilic डीएनए पोलीमरेज़ के उपयोग के कारण तापमान की आवश्यकता है विस्थापन गुण । यह एक thermocycler के लिए जरूरत को दरकिनार और परख पूरा करने के लिए आवश्यक समय की लंबाई कम हो जाती है । RT-लैंप के अतिरिक्त लाभ अपने उच्च विशिष्टता और संवेदनशीलता, पीएच स्तर और तापमान की एक सीमा पर मजबूती, और कई पीसीआर अवरोधकों2के लिए प्रतिरोध शामिल हैं । यह एक अपेक्षाकृत कम लागत और एजेंट कमरे के तापमान पर स्थिर हैं । इन विशेषताओं को देखते हुए, आरटी-दीपक एक प्रयोगशाला में या क्षेत्र में तैनात किया जा सकता है । जैसे, दीपक प्रतिक्रियाओं रोगजनकों और संक्रमण के अंय प्रकार के3,4,5की एक सीमा का पता लगाने के लिए विकसित किया गया है । rt-लैंप प्रोटोकॉल का लक्ष्य इस पत्र में वर्णित है कि मानव सीरम और मूत्र के नमूनों में आरएनए अलगाव के साथ-साथ 30 मिनट के भीतर एक भी संक्रमित मच्छर rt-लैंप के माध्यम से ZIKV का पता लगाने के लिए है । इस विधि qRT-पीसीआर की जगह के रूप में यह एक संवेदनशील, तेजी से नैदानिक उपकरण है कि जल्दी से काम करता है और प्रयोगशाला के बाहर सेटिंग्स में इस्तेमाल किया जा सकता है ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

यहाँ वर्णित सभी विधियों को Beaumont स्वास्थ्य के संस्थागत समीक्षा बोर्ड (आईआरबी) द्वारा अनुमोदित किया गया है. सभी प्रयोगों को प्रासंगिक दिशानिर्देशों और विनियमों के अनुसार किया गया था.

चेतावनी: सभी संभावित संक्रामक सामग्री निजी सुरक्षात्मक उपकरणों के उपयोग सहित सुरक्षा स्तर 2 मानकों के अनुसार नियंत्रित किया जाना चाहिए । किसी भी प्रक्रिया है जो एयरोसोल उत्पादन हो सकता है एक सुरक्षा कैबिनेट में प्रदर्शन किया जाना चाहिए । साथ ही, लाइव मच्छरों के साथ काम उचित सन्धिपाद में किया जाना चाहिए स्तर 1-3 की सुविधा । जन्मजात विषमताओं के साथ ZIKV संक्रमण के संघ को देखते हुए, गर्भवती हैं, जो महिलाओं को गर्भ धारण करने की कोशिश कर रहे हैं, या इन महिलाओं के भागीदारों काफी ZIKV करने के लिए अपनी प्रयोगशाला जोखिम को कम करना चाहिए. ZIKV नमूनों का परिवहन परिवहन विभाग खतरनाक सामग्री विनियमों के अनुसार श्रेणी बी जैविक पदार्थों के रूप में संयुक्त राज्य अमेरिका में वर्गीकृत है (४९ CFR Part 171-180) और इसलिए शिपिंग नमूनों का पालन करना चाहिए उन दिशानिर्देश. ZIKV के संयुक्त राज्य अमेरिका में आयात के लिए रोग नियंत्रण और रोकथाम (सीडीसी) आयात परमिट के लिए एक केंद्र की आवश्यकता है । किसी भी arthropods के आयात कि ZIKV संचरण के लिए एक सदिश के रूप में सेवा कर सकता है, भले ही वे संक्रमित नहीं हैं, एक संयुक्त राज्य अमेरिका कृषि विभाग (USDA) की अनुमति की आवश्यकता है । यह जानकारी प्रकाशन के समय चालू है । अप करने की तारीख सिफारिशों https://www.cdc.gov/zika/laboratories/lab-safety.html पर पाया जा सकता है ।

नोट: RT-दीपक प्रतिक्रियाओं झूठी सकारात्मक प्रतिक्रियाओं की उच्च दरों के लिए प्रवण हैं, तो प्रयोगात्मक योजना में सावधानियों लिया जाना चाहिए । सभी सेट अप और RT-लैंप प्रतिक्रियाओं का निष्पादन निर्दिष्ट पिपेट और फिल्टर सुझावों का उपयोग करना चाहिए । आदर्श रूप में, एक पार्श्व कार्य प्रवाह स्थापित किया जाना चाहिए । यदि संभव हो, विश्लेषण और इमेजिंग (खंड 5) एक अलग संलग्न कमरे में होना चाहिए संक्रमण को रोकने के । आरटी-लैंप उत्पादों युक्त परीक्षण ट्यूबों का उद्घाटन एक ंयूनतम करने के लिए रखा जाना चाहिए ।

1. RT-लैंप प्राइमर तैयारी

  1. १०० µ मीटर (1 टेबल) के एक अंतिम एकाग्रता के लिए आणविक ग्रेड पानी में प्रत्येक lyophilized RT-लैंप प्राइमर का पुनर्गठन । संक्षेप भंवर प्राइमर समाधान एक समरूप समाधान सुनिश्चित करने के लिए और संक्षेप में एक तालिका के शीर्ष में अधिकतम गति से समाधान नीचे स्पिन सभी प्राइमर समाधान इकट्ठा करने के लिए ।
  2. तालिका 2में वॉल्यूम का उपयोग करते हुए FIP, बिप, F3, B3, वामो, और पौंड प्राइमरों के एक 10x आरटी-लैंप प्राइमरी मिश्रण तैयार करें । संक्षेप भंवर प्राइमर समाधान के लिए एक समरूप समाधान सुनिश्चित करने के लिए, और संक्षेप में एक तालिका के शीर्ष में अधिकतम गति से समाधान नीचे स्पिन किसी भी नुकसान से बचने के केंद्रापसारक ।
    नोट: आर टी-लैंप प्राइमर के लिए सेट एई. aegypti actin (AEDAE) एक £ प्राइमर शामिल नहीं है (पाश प्राइमरों हमेशा RT-दीपक प्रतिक्रियाओं के लिए आवश्यक नहीं हैं) । इस मामले में, आणविक ग्रेड पानी के साथ पौंड प्राइमरी मात्रा की जगह ।
  3. का उपयोग करता है और मुक्त गल चक्र से बचने के बीच-20 डिग्री सेल्सियस पर प्राइमरों की दुकान ।

2. नमूना तैयारी

  1. मानव मूत्र के नमूनों के लिए: या तो ताजा मूत्र, जमे हुए मूत्र, या परिरक्षक में मूत्र का उपयोग करें । ताजा या जमे हुए नमूने के लिए: तुरंत ७०० x gपर 10 मिनट के लिए संग्रह के बाद नीचे स्पिन नमूना, और विश्लेषण या फ्रीज के लिए supernatant का उपयोग करें-८० ° c भविष्य के उपयोग के लिए । गल प्रयोग से पहले बर्फ पर जमे हुए नमूनों ।
  2. मानव सीरम नमूनों के लिए: या तो ताजा या जमे हुए सीरम नमूने का उपयोग करें ।
  3. ZIKV संक्रमित सेल लाइनों के लिए: या तो वातानुकूलित मीडिया या सेल lysates का उपयोग करें ।
    नोट: सेल के एई से मुक्त वातानुकूलित मीडिया । albopictus सी 6/36 कोशिकाओं 8 दिनों के बाद संक्रमण ZIKV RT-दीपक प्रतिक्रियाओं के लिए सकारात्मक नियंत्रण के रूप में इस्तेमाल किया जा सकता है ।
  4. Ae. aegypti मच्छरों के लिए: या तो पूरे ताजा या जमे हुए मच्छर लावे का उपयोग करें । बर्फ पर गल जमे मच्छर. एक P10 प्लास्टिक टिप (चित्रा 1) के साथ 10 बार मच्छर कुचल द्वारा फॉस्फेट बफर खारा (पंजाब) और homogenize के १०० µ एल में एक व्यक्ति मच्छर रखकर एक कच्चे मच्छर lysate तैयार करें । संक्षेप में कच्चे तेल के लिए किसी भी मलबे गोली lysate । बहाव आरटी-दीपक विश्लेषण के लिए supernatant का प्रयोग करें ।
    नोट: सकारात्मक नियंत्रण मादा मच्छरों के साथ intrathoracic microinjection का उपयोग करके एक प्रयोगशाला की स्थापना में उत्पंन किया जा सकता है लगभग 10 २०० nL की मात्रा में वायरस के3 जीनोम समकक्षों के साथ और 5 दिनों के मच्छर संचयन संक्रमण के बाद ।

3. RT-दीपक मास्टर मिक्स तैयार

  1. 3 तालिकामें मात्रा गाइड का उपयोग करके इस्तेमाल किया जा करने के लिए सेट प्रत्येक प्राइमरी के लिए बर्फ पर एक आरटी दीपक मास्टर मिक्स प्रतिक्रिया तैयार करें ।
    नोट: thermolabile Uracil डीएनए Glycosylase (UDG) का उपयोग झूठी सकारात्मक को रोकने में मदद करता है ।
  2. भंवर संक्षेप में यह सुनिश्चित करना है कि सभी नमूनों अच्छी तरह से मिश्रित कर रहे हैं, तो संक्षेप नीचे स्पिन मात्रा हानि को रोकने के लिए ।

4. आरटी-दीपक परख

  1. प्लास्टिक २३.० µ एल के आर टी-लैंप मास्टर मिश्रण प्रति प्रतिक्रिया में एक २०० µ l पीसीआर ट्यूब. नमूना के २.० µ l जोड़ें (मूत्र, सीरम, या क्रूड मच्छर lysate supernatant चरण 2 में वर्णित के रूप में). यह आर टी-लैंप प्रतिक्रिया प्रति २५.० µ एल करने के लिए कुल मात्रा लाएगा । नकारात्मक नियंत्रण के लिए, आणविक ग्रेड पानी का उपयोग करें । एक सकारात्मक नियंत्रण शामिल हैं ।
    नोट: संक्रमित सेल लाइनों के supernatant से पीसीआर स्टैंडर्ड या वायरस स्टॉक्स को पॉजिटिव कंट्रोल के तौर पर इस्तेमाल किया जा सकता है ।
    1. वैकल्पिक: एक संबंधित arbovirus जैसे डेंगू वायरस (देंव) की एक विशिष्टता नियंत्रण प्रतिक्रिया शामिल करें । नमूना प्रकार के अनुसार चरण 2 में उल्लिखित के रूप में नमूना तैयार करें । विशिष्टता नियंत्रण के २.० µ एल जोड़ें एक २०० µ l पीसीआर ट्यूब में आरटी के दीपक मास्टर मिश्रण के २३.० µ एल ।
  2. एक गर्मी ब्लॉक, जल स्नान, या thermocycler का उपयोग 30 मिनट के लिए ६१ डिग्री सेल्सियस पर नमूनों गर्मी ।
  3. हीट 10 मिनट के लिए ८० ° c करने के लिए हीटिंग द्वारा पोलीमरेज़ निष्क्रिय ।

5. आरटी-दीपक विश्लेषण

नोट: RT-लैंप विश्लेषण एक अलग, संलग्न स्थान में निष्पादित करें ।

  1. बाद में एक रंग परिवर्तन की उपस्थिति के लिए देख द्वारा गर्मी, प्रवेश आरटी-लैंप प्रतिक्रियाओं ।
    1. में फ्लोरोसेंट न्यूक्लिक एसिड डाई 1:10 पतला ताे (४० mm Tris, 20 mm एसिटिक एसिड, 1 mm EDTA) बफर ।
      सावधानी: कोई भी न्यूक्लिक एसिड दाग न्यूक्लिक एसिड को बांधता है और इसलिए यह एक यलो है । हैंडलिंग करते समय दस्ताने पहनें ।
    2. RT-दीपक प्रतिक्रिया के 12 µ एल करने के लिए, फ्लोरोसेंट न्यूक्लिक एसिड डाई कमजोर पड़ने के 2 µ एल जोड़ें ।
      नोट: नकारात्मक प्रतिक्रियाओं रंग में नारंगी हो जाएगा और सकारात्मक प्रतिक्रियाओं पीले रंग में होगा/
    3. वैकल्पिक: एक कैमरा का उपयोग कर एक सफेद पृष्ठभूमि पर आरटी-लैंप प्रतिक्रियाओं की तस्वीरें ले लो ।
  2. प्रतिदीप्ति द्वारा आरटी-लैंप उत्पादों की उपस्थिति की पुष्टि करने के लिए ३०२ एनएम यूवी प्रकाश के तहत नमूनों प्लेस । एक कैमरे का उपयोग कर परिणाम की तस्वीर ले लो ।
    नोट: सकारात्मक आरटी-लैंप प्रतिक्रियाओं एक फ्लोरोसेंट उत्पादन होगा ।
    चेतावनी: यूवी सुरक्षात्मक आंख गूगल या चेहरा ढाल पहनते हैं जब पराबैंगनी प्रकाश के साथ काम कर रहे ।
  3. वैकल्पिक: के नमूनों पर जेल ट्रो प्रदर्शन द्वारा आरटी लैंप उत्पादों की उपस्थिति की पुष्टि करें ।
    1. एक न्यूक्लिक एसिड दृश्य के लिए दाग के साथ 1x ताे बफर में एक 2% agarose जेल डालो ।
      सावधानी: कोई भी न्यूक्लिक एसिड दाग न्यूक्लिक एसिड को बांधता है और इसलिए यह एक यलो है । हैंडलिंग करते समय दस्ताने पहनें ।
    2. आणविक भार की तुलना करने के लिए पहले लेन में एक डीएनए सीढ़ी के 5 µ एल जोड़ें ।
    3. प्रत्येक rt-दीपक प्रतिक्रिया के लिए, डीएनए लोड हो रहा है डाई के 2 µ एल के साथ आरटी-दीपक प्रतिक्रिया मिश्रण के 13 µ एल मिश्रण । 15 µ l डीएनए लोड हो रहा है डाई युक्त मिश्रण लोड ।
    4. ९० मिनट के लिए ९० V पर जेल चलाने के लिए या जब तक बैंड अलग और ३०२ एनएम यूवी प्रकाश के साथ छवि रहे हैं ।
      नोट: सकारात्मक आरटी-दीपक प्रतिक्रियाओं एक सीढ़ी पैटर्न होगा । नकारात्मक RT-लैंप प्रतिक्रियाओं में कोई बैंड नहीं होना चाहिए.

6. निपटान

  1. आरटी के निपटान-डबल सील बैग में लैंप प्रतिक्रियाओं । आटोक्लेव के रूप में इस आरटी-दीपक उत्पादों aerosolize सकता है, भविष्य में झूठी सकारात्मक प्रतिक्रियाओं के लिए अग्रणी नहीं है ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

आर टी-लैंप प्रतिक्रियाओं तीन अलग तरीकों का उपयोग कर विश्लेषण किया जा सकता है । एक फ्लोरोसेंट न्यूक्लिक एसिड डाई के अलावा के साथ सबसे पहले, सकारात्मक प्रतिक्रियाओं पीले रंग में हो जाएगा/जहां नकारात्मक प्रतिक्रियाओं नग्न आंखों के रंग में नारंगी दिखाई देगा । दूसरा, आर टी के लिए फ्लोरोसेंट न्यूक्लिक एसिड डाई के अलावा-दीपक प्रतिक्रिया परिणाम एक फ्लोरोसेंट संकेत में जब नमूने यूवी प्रकाश से उत्साहित हैं । नकारात्मक प्रतिक्रियाओं को नकारात्मक नियंत्रण में छोटी मात्रा में मौजूद हो सकता है कि किसी भी पृष्ठभूमि प्रतिदीप्ति पर एक जासूस फ्लोरोसेंट संकेत नहीं होगा । अंत में, आर टी-लैंप प्रतिक्रियाओं एक agarose जेल पर चलाया जा सकता है । सकारात्मक आरटी-दीपक प्रतिक्रियाओं एक बैंडिंग पैटर्न होगा, जबकि नकारात्मक प्रतिक्रियाओं कोई डीएनए बैंड होगा । यह इन विश्लेषण विधियों के सभी तीन का उपयोग कर के उदाहरण चित्र 2 और 3में प्रदर्शित किए जाते हैं । इन नमूनों में से कोई भी आरएनए-आर टी से पहले पृथक-दीपक था । चित्रा 1 पंजाबियों में एक पूरे मच्छर के कुचल, जो आर टी-लैंप प्रतिक्रिया में उपयोग के लिए पर्याप्त है दर्शाता है । चित्रा 2में, ZIKV आर टी-लैंप प्रतिक्रिया की विशिष्टता का प्रदर्शन किया है: केवल ZIKV आणविक नियंत्रण, नहीं देंव आणविक नियंत्रण या नकारात्मक नियंत्रण, एक सकारात्मक आर टी दीपक प्रतिक्रिया है । इसके अलावा, ZIKV दोनों मूत्र और एक रोगी के सीरम ज्ञात ZIKV संक्रमण के साथ में पता चला है, लेकिन ZIKV संक्रमण के बिना स्पर्शोन्मुख नियंत्रण रोगी में नहीं (चित्रा 2). चित्रा 2बीमें, नमूनों मानव 18s rRNA आरटी-लैंप का उपयोग करने के लिए परीक्षण कर रहे हैं । केवल रोगियों (मूत्र या सीरम) से नमूने, लेकिन नहीं आणविक नियंत्रण या नकारात्मक नियंत्रण, 18s rRNA के लिए सकारात्मक हैं. इसलिए, 18s rRNA rt-दीपक मानव रोगियों से नमूने के लिए आरटी-लैंप प्रतिक्रियाओं के लिए एक गुणवत्ता नियंत्रण के रूप में इस्तेमाल किया जा सकता है । मच्छर के नमूने इसी तरह ZIKV या आरटी-लैंप गुणवत्ता नियंत्रण, AEDAE (चित्रा 3) के लिए परीक्षण किया जा सकता है । इस उदाहरण में, ZIKV के लिए सकारात्मक आणविक नियंत्रण के साथ ही ZIKV से संक्रमित मच्छर ZIKV के लिए सकारात्मक हैं. नकारात्मक नियंत्रण, देंव के लिए आणविक नियंत्रण, नकली संक्रमित मच्छर (कोई वायरस युक्त कोशिका संस्कृति मीडिया के साथ मच्छर microinjected), और देंव संक्रमित मच्छर ZIKV (चित्रा 3) के लिए सभी नकारात्मक हैं. हालांकि, आरटी-लैंप (चित्रा 3बी) द्वारा AEDAE के लिए सभी मच्छर सकारात्मक हैं ।

जब संभव हो, सभी तीन विश्लेषणात्मक तरीके एक सकारात्मक या नकारात्मक प्रतिक्रिया की पुष्टि करने के लिए इस्तेमाल किया जाना चाहिए के रूप में कई बार फ्लोरोसेंट संकेत कमजोर हो सकता है और कुछ व्यक्तियों रंग अंधा हो सकता है, दृश्य रंग परिवर्तन मुश्किल निर्धारित करने के लिए बना । मामलों में जहां नकारात्मक नियंत्रण सकारात्मक है, परीक्षण नमूनों के पूरे सेट संदूषण के रूप में अमान्य है और इसलिए झूठी सकारात्मक से इंकार नहीं किया जा सकता है । जहाँ सकारात्मक नियंत्रण नकारात्मक है मामलों में, RT-लैंप प्रतिक्रिया काम नहीं हो सकता है के रूप में नमूने का पूरा सेट अमान्य है । यह एक गुणात्मक बाहर पढ़ा है, तथापि, वायरस की उच्च प्रतियां आर टी में वृद्धि-लैंप उत्पादों है कि फ्लोरोसेंट तीव्रता या जेल ट्रो द्वारा डीएनए बैंडिंग पैटर्न की तीव्रता से की सराहना की जा सकती में परिणाम होगा ।

Figure 1
चित्रा 1 : मच्छर क्रूड lysate की तैयारी । () एक microcentrifuge ट्यूब में पंजाबियों के १०० µ एल में एक मच्छर प्लेस । () एक P10 प्लास्टिक टिप का उपयोग करना, ट्यूब के पक्ष के खिलाफ मच्छर को कुचलने 10 बार । () यह एक कच्चे तेल की lysate है कि नीचे एक तालिका शीर्ष में संक्षेप में घूमती होना चाहिए उत्पादन के लिए मलबे गोली । केवल supernatant RT-लैंप प्रतिक्रिया के लिए इस्तेमाल किया जाना चाहिए । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2 : ZIKV और 18S rRNA RT-दीपक रोगी मूत्र और सीरम के नमूनों में. मूत्र या सीरम के नमूनों से एक स्पर्शोन्मुख नियंत्रण रोगी (C01) या ZIKV संक्रमित रोगी (Z01) एक ZIKV () या 18S rRNA () विशिष्ट RT-दीपक प्रतिक्रियाओं के अधीन थे. आर टी-लैंप प्रतिक्रियाओं आंख (ऊपरी पैनल), ग्रीन प्रतिदीप्ति (मध्य पैनल), या जेल ट्रो (नीचे पैनल) द्वारा एक फ्लोरोसेंट न्यूक्लिक एसिड डाई के अलावा के बाद visualized थे । लेन एम: डीएनए मास मार्कर; एनटीसी: कोई टेम्पलेट नियंत्रण (नकारात्मक नियंत्रण); ZIKV: ZIKV पीसीआर मानक सकारात्मक नियंत्रण; देंव: देंव सकारात्मक नियंत्रण. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए । 

Figure 3
चित्रा 3 : ZIKV और AEDAE भ-चिराग में Ae. aegypti . एकल एई. aegypti नकली नियंत्रण, ZIKV, या देंव से संक्रमित ZIKV () या AEDAE () विशिष्ट आरटी-दीपक प्रतिक्रियाओं के अधीन थे । आर टी-लैंप प्रतिक्रियाओं आंख (ऊपरी पैनल), ग्रीन प्रतिदीप्ति (मध्य पैनल), या जेल ट्रो (नीचे पैनल) द्वारा एक फ्लोरोसेंट न्यूक्लिक एसिड डाई के अलावा के बाद visualized थे । लेन एम: डीएनए मास मार्कर; एनटीसी: कोई टेम्पलेट नियंत्रण (नकारात्मक नियंत्रण); ZIKV: ZIKV पीसीआर मानक सकारात्मक नियंत्रण; देंव: देंव सकारात्मक नियंत्रण. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए । 

लक्ष्य प्राइमर अनुक्रम (5 '-3 ')
होमो sapien 18S rRNA 18SrRNA-FIP *
18SrRNA-बिप *
18SrRNA-F3
18SrRNA-B3
18SrRNA-पगली
18SrRNA-LB
TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG
GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG
GTTCAAAGCAGGCCCGAG
CCTCCGACTTTCGTTCTTGA
AGAACCGCGGTCCTATTCCATTATT
ATTCCTTGGACCGGCGCAAG
ZIKV ZIKV-FIP *
ZIKV-बिप *
ZIKV-F3
ZIKV-B3
ZIKV-पगली
ZIKV-LB
AACCTGAGGGCATGTGCAAACCGCGGTCAGTGGAGATGACT
CACAGGAGTGGAAACCCTCGACTGAAGTGGTGGGAGCAGAA
GCAGAGCAATGGATGGGATA
CCCATCCTTGAGGTACAGCT
TCGATTGGCTTCACAACGC
GGAGCAATTGGGAAGAAGTCC
Ae. aegypti actin Ae21-FIP *
Ae21-बिप *
Ae21-पगली
Ae21-F3
Ae21-B3
TGCTTGGTCCCTGCCTGGGAGACAGCCCACCAGAACGA
GAGACGAGAACGGCCCAGCGGGTCTGGTGTGTGTCTTTG
ACCGCAAGGCCAAGAACCG
CGGCGCCACCACAAGA
TCGTGCCTGTGTTTGTCG
* प्राइमरों को तेजी से उच्च प्रदर्शन वाले लिक्विड क्रोमैटोग्राफी (HPLC) द्वारा शुद्ध किया जाना चाहिए. अन्य सभी प्राइमरों के लिए, मानक लवण की स्थिति पर्याप्त हैं ।

तालिका 1: आरटी के लिए प्राइमर अनुक्रम-दीपक प्रतिक्रियाओं । प्राइमरी दृश्यों मूल रूप से पिछले प्रकाशन6में वर्णित हैं ।

मात्रा (µ एल) प्राइमर स्टॉक एकाग्रता (µ m) अंतिम एकाग्रता (µ m)
८० फॉरवर्ड इनर प्राइमर (FIP) १०० 16
८० पिछड़े इनर प्राइमर (बिप) १०० 16
10 फॉरवर्ड बाहरी प्राइमर (F3) १०० 2
10 पिछड़े बाहरी प्राइमर (B3) १०० 2
20 लूप फॉरवर्ड (वामो) १०० 4
20 लूप पश्चगामी (LB) १०० 4
२८० आणविक ग्रेड पानी - -
५०० कुल

तालिका 2:10x आरटी-दीपक प्राइमरी मिश्रण की तैयारी । आर टी दीपक प्राइमर के लिए सेट एई. aegypti actin एक BF प्राइमर शामिल नहीं है; इस मात्रा को पानी से बदलें ।

1x मात्रा (µ एल) घटक अंतिम. के लिए 25 µ l Volume
२.५ 10x Isothermic प्रवर्धन बफर 1x
१.८ १०० mM dU/A/T/C/GTPs १.४ एमएम
२.० १०० मिमी MgSO4 6 मिमी + 2 में बफर = 8 मिमी [4-10 mm श्रेणी]
२.५ 10x प्राइमर्स १.६ µ एम FIP/बिप, ०.२ µ m F3/B3, ०.४ µ एम FL/
१.० कतरास विस्थापन के साथ thermophilic डीएनए पोलीमरेज़ (८,००० यू एमएल/ 8 यू
०.५ रिवर्स Transcriptase (१५,००० यू/एमएल) ७.५ यू
०.५ UDG (१,००० यू/एमएल) ०.५ यू
१२.३ आणविक ग्रेड पानी -
२३.० कुल

तालिका 3: RT-लैंप मास्टर मिक्स की तैयारी ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

इस पत्र में वर्णित ZIKV आरटी-लैंप परख दोनों मानव और मच्छर के नमूने का उपयोग कर काम करता है6। पता लगाने की सीमा लगभग 1 जीनोम समतुल्य6, जो एक रोगसूचक ZIKV संक्रमित रोगी के ठेठ वायरल लोड के बाद से पर्याप्त होना चाहिए था 103 से 106 PFU/एमएल7। इसके अतिरिक्त, इस विधि पहले अलग आरएनए के बिना नमूनों में ZIKV का पता लगाने और सेल संस्कृति में वायरस प्रवर्धन के बिना कर सकते हैं. यह काफी समय, लागत, और इस परख के स्वास्थ्य जोखिम qRT-पीसीआर की तुलना में कम हो जाती है ।

इस प्रोटोकॉल में इंगित मात्रा अनुपात में प्रयुक्त मूत्र नमूने एक आरएनए अलगाव के बिना होने के लिए RT-दीपक प्रतिक्रियाओं की अनुमति देनी चाहिए. जबकि एक सैद्धांतिक रूप से एक RT-दीपक प्रतिक्रिया में इस्तेमाल किया नमूना की राशि में वृद्धि कर सकते हैं, देखभाल जब इस नमूने मूत्र है प्रयोग किया जाना चाहिए. मूत्र कई रसायनों कि पीसीआर प्रतिक्रियाओं को बाधित कर सकता शामिल हैं; मूत्र में यूरिया polymerases8 नीचा और एक मूत्र का उपयोग करने के लिए जाना जाता है/आरटी-दीपक प्रतिक्रिया अनुपात है कि बहुत अधिक है आर टी दीपक प्रतिक्रिया को रोकने जाएगा । यदि वायरस की कम राशि की उंमीद है, यह एक आरएनए अलगाव मूत्र के लिए विशिष्ट किट का उपयोग करने के लिए बेहतर होगा । इसी तरह, सीरम एक उच्च मात्रा8पर इस्तेमाल किया जाता है जब आरटी दीपक बाधित हो सकता है कि पीसीआर अवरोधकों में शामिल कर सकते हैं ।

इस प्रोटोकॉल में शामिल RT-लैंप प्रतिक्रियाओं के लिए गुणवत्ता नियंत्रण का समावेश है, पश्चिमी सोख्ता प्रोटोकॉल में एक लोडिंग नियंत्रण के समान । यदि एक नैदानिक नमूना rt-लैंप गुणवत्ता नियंत्रण के लिए नकारात्मक है, तो ZIKV rt-लैंप के लिए एक नकारात्मक प्रतिक्रिया एक झूठी नकारात्मक हो सकता है के रूप में नमूना पीसीआर अवरोधकों या कुल आरएनए की कम मात्रा की एक उच्च राशि शामिल हो सकता है. यह आवश्यक नहीं है के नमूने से पहले आर सी-दीपक परख को आरएनए अलग । इस प्रोटोकॉल में प्रतिनिधि RT-लैंप परिणाम आरएनए अलगाव के बिना प्राप्त किए गए थे । हालांकि, आरएनए अलगाव कम वायरस लोड के साथ नमूनों में पता लगाने में सुधार या कि पीसीआर अवरोधकों के उच्च स्तर को नियंत्रित कर सकते हैं । सीरम सहित अधिकांश नमूना प्रकार के लिए, एक आरएनए आइसोलेशन किट निर्माता के सुझाए गए प्रोटोकॉल के बाद किया जा सकता है । मूत्र के नमूनों के लिए मूत्र के नमूनों के लिए विशिष्ट एक आरएनए आइसोलेशन किट का उपयोग किया जाना चाहिए । मच्छर के नमूनों के लिए यह सिफारिश की जाती है कि आरएनए अलगाव से पहले अधिकतम गति या douncing में 2 मिनट के लिए एक कतरन कॉलम के माध्यम से पंजाब के १०० µ एल में मच्छर को लाइसे चलाकर मच्छरदानी का काम करें । आरएनए 30 µ एल ऑफ रेफरेंस बफर में eluted किया जा सकता है और उपयोग किए जाने तक-८० डिग्री सेल्सियस पर संग्रहित है ।

आरएनए अलगाव तो अंतर्जात पीसीआर अवरोधकों को दूर करने के लिए या आर टी-लैंप से पहले आरएनए ध्यान केंद्रित करने का सुझाव दिया है । यदि RT-लैंप गुणवत्ता नियंत्रण अभी भी नकारात्मक है, तो qRT-पीसीआर ZIKV का पता लगाने के लिए इस्तेमाल किया जाना चाहिए ।

इस प्रोटोकॉल में RT-लैंप प्राइमरों तापमान (57-65 डिग्री सेल्सियस) और मशीन समय (8-60 मिनट), के रूप में के रूप में अच्छी तरह से अपरंपरागत हीटिंग स्रोतों (जैसे, लौ राशन हीटर, जल स्नान) मानक के बाहर का उपयोग कर के एक सीमा पर काम करने की पुष्टि की गई है प्रयोगशाला की स्थिति । सभी तापमान परीक्षण तुलनीय परिणाम दिया । दृश्य रंग अकेले परिवर्तन द्वारा खोज के आधार पर, ZIKV RT-लैंप उत्पादों का पता लगाने के लिए इष्टतम समय 30 मिनट था । हालांकि, जैल पर यूवी प्रकाश उत्तेजना या बैंडिंग पैटर्न द्वारा पता लगाने के रूप में छोटे रूप में 8 मिनट कुल मशीन समय के साथ सकारात्मक थे । कुछ rt-लैंप प्रोटोकॉल DMSO शामिल हैं, लेकिन इस प्रोटोकॉल में, यह आर टी-लैंप प्रतिक्रिया के निषेध में परिणाम कर सकते हैं । कमरे के तापमान पर स्थापित किया जा सकता है कि एक thermophilic डीएनए पोलीमरेज़ का उपयोग कर तेजी से प्रवर्धन संकेतों सहित जंगली प्रकार thermophilic डीएनए पोलीमरेज़ पर लाभ हो सकता है और कमरे के तापमान9,10 पर स्थिरता में वृद्धि हुई है . Ethidium ब्रोमाइड के बजाय 2% agarose जैल में न्यूक्लिक एसिड दृश्य के लिए इस्तेमाल किया जा सकता है, तथापि, न्यूक्लिक जैल के लिए अंय फ्लोरोसेंट agarose एसिड रंजक कम mutagenic उंहें एक सुरक्षित विकल्प बनाने की क्षमता है । हालांकि, दस्ताने पहने के रूप में उचित सुरक्षा सावधानियों अभी भी इस्तेमाल किया जाना चाहिए ।

इस प्रोटोकॉल की एक सीमा है कि यह एक गुणात्मक और नहीं एक मात्रात्मक तकनीक है, तथापि, रिश्तेदार ठहराव6किया जा सकता है । इसके अलावा, आर टी-लैंप प्राइमरों अत्यधिक विशिष्ट है और ZIKV है कि 16 उपभेदों में पाया जाता है की एक अत्यधिक संरक्षित अनुक्रम के खिलाफ डिजाइन किए गए थे और सत्यापित करने में कम से 5 उपभेदों6में काम करते हैं । यह संभव है कि जंगली में ZIKV के लिए व्यापक उत्परिवर्तनों भविष्य में इन प्राइमरों द्वारा detectable नहीं हो सकता है । अंय समूहों ने भी ZIKV का पता लगाने के लिए नई प्रौद्योगिकियों को विकसित किया हैकि ब्याज11,12,13,14,15,16,17 का हो सकता है .

संक्षेप में, इस प्रोटोकॉल ZIKV के लिए एक तेज, सरल, और लागत प्रभावी तरीका है कि विशेष उपकरणों की आवश्यकता नहीं है नमूना प्रकार की एक किस्म में प्रदान करता है । यह ZIKV डिटेक्शन के लिए एक नया नैदानिक उपकरण प्रदान करता है जिसमें आरएनए को RT-लैंप प्रतिक्रिया से पहले अलग-थलग नहीं होना पड़ता है ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

LEL और अति पिछड़ा वर्ग Zika वायरस निदान विधियों पर बौद्धिक संपदा है । शेष लेखकों में कोई प्रतिस्पर्धी रुचि नहीं है ।

Acknowledgments

यह काम मॉरीन और रोनाल्ड हिर्श परिवार परोपकारी योगदान और क्षेत्र के तंत्रिका विज्ञान संस्थान, सेंट मैरी मिशिगन के द्वारा समर्थित किया गया था । funders अध्ययन डिजाइन, डेटा संग्रह और विश्लेषण, प्रकाशित करने का निर्णय, या पांडुलिपि की तैयारी में कोई भूमिका नहीं थी । हम भी Dr. Bernadette Zwaans और एलिय्याह वार्ड पांडुलिपि के उनके महत्वपूर्ण समीक्षा के लिए धंयवाद ।

Materials

Name Company Catalog Number Comments
Bst 2.0 WarmStart DNA polymerase New England Biolabs M0537S
Isothermal Amplification Buffer  New England Biolabs B0537S
WarmStart RTx Reverse Transcriptase New England Biolabs M0380S
Antarctic Thermolabile UDG New England Biolabs M0372S
MgSO4 New England Biolabs B1003S
100 mM dATP Solution New England Biolabs N0440S Deoxynucleotide Set N0446S
100 mM dCTP Solution New England Biolabs N0441S Deoxynucleotide Set N0446S
100 mM dTTP Solution New England Biolabs N0443S Deoxynucleotide Set N0446S
100 mM dGTP Solution New England Biolabs N0442S Deoxynucleotide Set N0446S
100 mM dUTP Solution Thermo Fisher Scientific R0133
SYBR Green I Nucleic Acid Gel Stain Invitrogen S7563
Nancy-520 Sigma Aldrich 01494
Low DNA Mass Ladder Invitrogen 10-068-013
Zika Postive Control Robert Koch Institute, Germany N/A
Agarose Thermo Fisher Scientific BP1600
BlueJuice Gel Loading Buffer Invitrogen 10816015
Primers Integrated DNA Technologies Custom Oligo
Nuclease-Free Water Ambion AM9938
Urine Preservative Norgen Biotek 18126
ZIKV PCR Standard Robert Koch Institute N/A Vero E6 cell supernatants
DENV2 New Guinea C Control Connecticut Agricultural Experiment Station N/A

DOWNLOAD MATERIALS LIST

References

  1. Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. Zika Virus. New England Journal of Medicine. 374, (16), 1552-1563 (2016).
  2. Francois, P., et al. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. Federation of European Microbiological Societies Immunology and Medical Microbiology. 62, (1), 41-48 (2011).
  3. Tomita, N., Mori, Y., Kanda, H., Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols. 3, (5), 877-882 (2008).
  4. Gandasegui, J., et al. The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis. Public Library of Science Neglected Tropical Diseases. 9, (7), 0003963 (2015).
  5. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. The Journal of Visualized Experiments. (96), (2015).
  6. Lamb, L. E., et al. Rapid Detection of Zika Virus in Urine Samples and Infected Mosquitos by Reverse Transcription-Loop-Mediated Isothermal Amplification. Scientific Reports. 8, (1), 3803 (2018).
  7. Faye, O., et al. One-step RT-PCR for detection of Zika virus. Journal of Clinical Virology. 43, (1), 96-101 (2008).
  8. Schrader, C., Schielke, A., Ellerbroek, L., Johne, R. PCR inhibitors - occurrence, properties and removal. Journal of Applied Microbiology. 113, (5), 1014-1026 (2012).
  9. Poole, C. B., Tanner, N. A., Zhang, Y., Evans, T. C., Carlow, C. K. Diagnosis of brugian filariasis by loop-mediated isothermal amplification. Public Library of Science Neglected Tropical Diseases. 6, (12), 1948 (2012).
  10. Tanner, N. A., Zhang, Y., Evans, T. C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques. 53, (2), 81-89 (2012).
  11. Chan, K., et al. Rapid, Affordable and Portable Medium-Throughput Molecular Device for Zika Virus. Scientific Reports. 6, 38223 (2016).
  12. Lee, D., et al. Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays. Analytical Chemistry. 88, (24), 12272-12278 (2016).
  13. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, (5), 1255-1266 (2016).
  14. Song, J., et al. Instrument-Free Point-of-Care Molecular Detection of Zika Virus. Analytical Chemistry. 88, (14), 7289-7294 (2016).
  15. Yaren, O., et al. Point of sampling detection of Zika virus within a multiplexed kit capable of detecting dengue and chikungunya. BioMed Central Infectious Diseases. 17, (1), 293 (2017).
  16. Wang, X., et al. Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification. Journal of Virological Methods. 238, 86-93 (2016).
  17. Priye, A., et al. A smartphone-based diagnostic platform for rapid detection of Zika, chikungunya, and dengue viruses. Scientific Reports. 7, 44778 (2017).
रिवर्स प्रतिलेखन-पाश-मध्यस्थता इज़ोटेर्माल प्रवर्धन (आरटी-दीपक) Zika वायरस और मूत्र, सीरम में गृह व्यवस्था जीन के लिए परख, और मच्छर के नमूने
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).More

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter