Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

הפוך שעתוק לולאה-בתיווך איזותרמי הגברה (RT-המנורה) Assay Zika וירוס, ניקיון בגנים שתן, סרום, ודוגמאות יתוש

doi: 10.3791/58436 Published: September 14, 2018

Summary

פרוטוקול זה מספק שיטה יעילה, בעלות נמוכה לזהות וירוס Zika או שליטה מטרות בדגימות שתן וסרום אנושי או יתושים על ידי שעתוק במהופך בתיווך לולאה איזותרמי הגברה (RT-המנורה). שיטה זו אינה דורשת בידוד RNA והוא יכול להיעשות תוך 30 דקות.

Abstract

זיהום בנגיף Zika (ZIKV) יכול להיות אסימפטומטיים במבוגרים, לעומת זאת, זיהום במהלך ההריון יכול לגרום להפלה מולדים נוירולוגיות חמורות. המטרה של פרוטוקול זה היא לזהות במהירות ZIKV בדגימות האדם והן יתושים. תקן הזהב הנוכחי לגילוי ZIKV הוא שעתוק במהופך כמותיים PCR (לרביעיית-PCR); שעתוק במהופך בתיווך לולאה איזותרמי הגברה (RT-המנורה) עשוי לאפשר לבדיקה יותר יעיל, בעלות נמוכה ללא צורך ציוד יקר. במחקר זה, RT-המנורה שימוש לצורך זיהוי ZIKV בדגימות ביולוגיות שונות בתוך 30 דקות, ללא הראשונה לבודד את הרנ א מדגם. טכניקה זו הוכח שימוש ZIKV נגוע סרום ושתן המטופל ולאחר נגוע דגימות יתושים. חומצה ריבונוקלאית ribosomal 18S אקטין משמשים כפקדי בדגימות האדם וכילה נגד יתושים, בהתאמה.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

בשנת 2015, Zika וירוס (ZIKV) צבר תשומת הלב העולמית בולטים כמו מחלה זיהומית של דאגה מפני זיהום במהלך ההריון היה קשור להפלה, לידות, חמור נוירולוגיות מומים מולדים כולל microcephaly, כמו גם אחרים מולדת מומים מולדים1. במקרים נדירים, ZIKV נמצא קשור תסמונת גיליאן. ZIKV מועבר בעיקר על ידי יתושי אאדס; עם זאת, זה יכול גם להיות להתפשט באמצעות מגע מיני1. בהתחשב בכך הזיהום עם ZIKV ללא תסמינים אצל רוב האנשים, או מציג עם מתון תסמינים דמויי שפעת חופפים עם הסימפטומים של זיהום של אחרים arborviruses1, היה צורך עבור שיפור שיטות גילוי מהירה וחסכונית של ZIKV למסך גם אנשים, כמו גם אוכלוסיות יתוש מקומיים.

שעתוק במהופך כמותיים PCR (לרביעיית-PCR) הוא assay אמין לצורך זיהוי ZIKV; עם זאת, טכניקה זו דורש ציוד מיוחד יקר, צוות מיומן, ובידוד RNA מדגם של ריבית. שעתוק במהופך בתיווך לולאה איזותרמי הגברה (RT-המנורה) היא שיטה הגברה חומצת גרעין בשלב אחד מבוסס על טכנולוגיית ה-PCR הדורש רק בטמפרטורת דגירה אחת עקב השימוש לרום DNA פולימראז עם סטרנד מאפייני העקירה. זה עוקף את הצורך thermocycler, מקטין את משך הזמן הדרוש כדי להשלים את הבדיקה. יתרונות נוספים של RT-המנורה כוללים שלה ירידה לפרטים גבוהה, רגישות, חוסן במגוון של רמות ה-pH, טמפרטורות, והתנגדות PCR רבים מעכבי2. יש יחסית נמוכים, ריאגנטים יציבים בטמפרטורת החדר. לאור מאפיינים אלה, RT-המנורה ניתן לפרוס במעבדה או בשטח. ככזה, המנורה תגובות פותחו כדי לזהות מגוון של פתוגנים וסוגים אחרים של זיהום3,4,5. המטרה של פרוטוקול RT-המנורה המתוארת במאמר זה היא לזהות את ZIKV ללא בידוד RNA בדגימות האנושי סרום ושתן באותה מידה כמו יתוש הנגוע יחיד בתוך 30 דקות באמצעות RT-המנורה. בשיטה זו ניתן להחליף לרביעיית-PCR כפי שהוא כלי אבחון רגיש, מהירה שפועל במהירות ובאופן בהגדרות מחוץ למעבדה.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

כל השיטות המתוארות כאן אושרו על ידי המוסדיים סקירה לוח (IRB) של בריאות בומונט. כל הניסויים בוצעו בהתאם להנחיות הרלוונטיים ולתקנות.

התראה: כל חומר העלול זיהומיות צריך להיות מטופל על פי תקני אבטחה ברמה 2 כולל השימוש של ציוד מגן אישי. כל הנהלים, אשר עשויה לייצר תרסיס צריכה להתבצע בתוך ארון אבטחה. בנוסף, עבודה עם יתושים חיה צריכה להתבצע במתקן המתאים של פרוקי-רגליים הבלימה רמה 1-3.... בהתחשב האגודה של זיהום ZIKV עם מומים מולדים, נשים בהריון, מנסה להרות, או השותפים של נשים אלו צריכים באופן משמעותי לצמצם את חשיפתם מעבדה ZIKV. הובלה של דגימות ZIKV מסווגים בארצות הברית קטגוריה B חומרים ביולוגיים לפי מחלקה של מסוכנים חומרים תקנות התעבורה (49 CFR Part 171-180) ולכן משלוח דוגמאות צריך לדבוק אלה הנחיות. ייבוא לתוך biospecimens ארצות הברית של ZIKV דורשת מרכזי לבקרת מחלות ומניעתן (CDC) להתיר ייבוא. ייבוא של כל פרוקי רגליים זה יכול לשמש כמו וקטור לשידור ZIKV, גם אם הם לא נדבקו, דורש אישור מחלקת החקלאות של ארצות הברית (USDA). מידע זה הוא הנוכחי בזמנו של הפרסום. המלצות עדכניות ניתן למצוא ב- https://www.cdc.gov/zika/laboratories/lab-safety.html.

הערה: RT-המנורה תגובות נוטים שיעור גבוה יותר של תגובות חיוביות כוזבות, ולכן יש לנקוט אמצעי זהירות בתכנון ניסיוני. כל ביצוע של RT-המנורה תגובות הקמה עליך להשתמש פיפטות המיועד וטיפים מסנן. באופן אידיאלי, יש להקים זרם עבודה לרוחב. במידת האפשר, אנליזה והדמיה (סעיף 5) צריך להתרחש בחדר סגור נפרד כדי למנוע זיהום. הפתיחה של מבחנות המכילות מוצרים RT-המנורה צריכה להישמר עד למינימום.

1. RT-המנורה תחל הכנה

  1. לשקם כל פריימר RT-המנורה lyophilized במים ברמה מולקולרית כדי ריכוז סופי של 100 מיקרומטר (טבלה 1). בקצרה מערבולת הפתרון פריימר כדי להבטיח פתרון הומוגני ולסובב בקצרה את הפתרון במהירות המרבית ומפרידה מלמעלה בטבלה כדי לאסוף את כל פתרון פריימר.
  2. הכינו 10 x RT-המנורה תמהיל פריימר של תחל ב- FIP, ביפ, F3, B3, אם ו LB באמצעות אמצעי האחסון בטבלה מס ' 2. בקצרה מערבולת הפתרון פריימר כדי להבטיח פתרון הומוגני, בקצרה ספין למטה הפתרון במהירות המרבית ומפרידה מלמעלה בטבלה כדי למנוע אובדן.
    הערה: פריימר RT-המנורה להגדיר עבור Ae. aegypti אקטין (AEDAE) אינו מכיל פריימר ליברות (primers לופ אינם תמיד הכרחי לתגובות RT-המנורה). במקרה זה, להחליף את אמצעי האחסון פריימר ליברות כיתה מולקולרית מים.
  3. לאחסן את תחל ב-20 ° C בין שימושים ולהימנע מחזורים חינם-הפשרה.

2. הכנת הדוגמא

  1. עבור דגימות שתן: להשתמש שתן טרי, קפוא שתן או שתן חומר משמר. עבור מדגם טרי או קפוא: מיד תוצאה לדגימה אחרי האוסף 10 דקות ב 700 x g, ו השתמש את תגובת שיקוע לניתוח או להקפיא ב-80 מעלות צלזיוס לשימוש עתידי. הפשרת דגימות קפוא בקרח לפני השימוש.
  2. לדגימות בנסיוב אדם: השתמש גם הדוגמאות סרום טרי או קפוא.
  3. עבור ZIKV נגוע שורות תאים: להשתמש במדיה ממוזגים או תא lysates.
    הערה: נטול תאים ממוזגים מדיה Ae. albopictus C6/36 תאים 8 ימים לאחר הפגיעה יכול לשמש כפקדי חיובי לתגובות ZIKV RT-המנורה.
  4. Aegypti Ae. היתושים: להשתמש גם הגוויות יתושים שלם טרי או קפוא. הפשרת יתושים קפוא בקרח. להכין יתוש גולמי lysate על-ידי הצבת של יתוש בודדים µL 100 של באגירה פוספט תמיסת מלח (PBS), homogenize על ידי ריסוק היתוש 10 פעמים עם טיפ pipet P10 (איור 1). בקצרה centrifuge את lysate כדי הצניפה נפולת הגולמי. השתמש את תגובת שיקוע לניתוח RT-המנורה במורד הזרם.
    הערה: בקרת חיובי יכול להיווצר באווירה מעבדה ע י הדבקה הנשי יתושים באמצעות intrathoracic microinjection במקבילות גנום3 כ 10 של וירוס באמצעי אחסון של 200 nL קצירת היתוש 5 ימים לאחר הפגיעה.

3. להכין מיקס מאסטר RT-מנורה

  1. להכין תגובה מיקס מאסטר RT-המנורה על קרח כל פריימר מוגדר לשמש באמצעות מדריך נפח בטבלה3.
    הערה: השימוש של thermolabile אורציל דנ א Glycosylase (UDG) מסייע במניעת תוצאות חיוביות שגויות.
  2. מערבולת בקצרה על מנת להבטיח כי כל דוגמאות מעורבבים היטב, ואז לסובב למטה בקצרה כדי למנוע אובדן נפח.

4. RT-המנורה Assay

  1. Pipet 23.0 µL של המיקס RT-המנורה הראשית לכל תגובה לתוך צינור PCR 200 µL. הוסף µL 2.0 מדגם (שתן, סרום או יתוש גולמי lysate תגובת שיקוע כפי שמתואר בשלב 2). זה יביא את הנפח הכולל µL 25.0 לכל תגובה RT-המנורה. עבור הפקד שלילי, להשתמש במים ברמה המולקולרית. כוללות פקד חיובי.
    הערה: מניות רגיל או וירוס ה-PCR של תגובת שיקוע של שורות תאים נגועים יכול לשמש כפקד חיובי.
    1. אופציונלי: כוללים בקרת ירידה לפרטים תגובה של arbovirus נלווים כגון וירוס דנגה (DENV). הכנת המדגם כמתואר בשלב 2 לפי סוג הדגימה. להוסיף µL 2.0 של הפקד ירידה לפרטים µL 23.0 של המיקס RT-המנורה הראשית לתוך צינור PCR 200 µL.
  2. מחממים את הדגימות ב 61 מעלות צלזיוס למשך 30 דקות באמצעות בלוק חימום, תנורים או thermocycler.
  3. חום לבטל את פולימראז על-ידי חימום עד 80 מעלות צלזיוס למשך 10 דקות.

5. RT-המנורה ניתוח

הערה: לבצע ניתוח RT-המנורה חלל נפרד המצורף.

  1. לאחר הדגירה, לגשת RT-המנורה תגובות ויזואלית על ידי מחפש את הנוכחות של שינוי צבע.
    1. לדלל את חומצת גרעין פלורסנט לצבוע 1:10 במאגר טה (40 מ"מ טריס, חומצה אצטית 20 מ מ 1 מ"מ EDTA).
      התראה: כל כתם חומצת גרעין נקשר חומצות גרעין, ולכן הוא חומר מסרטן. ללבוש כפפות בעת הטיפול.
    2. כדי µL 12 התגובה RT-המנורה, להוסיף 2 µL של דילול צבעי פלורסנט חומצת גרעין.
      הערה: תגובות שליליות יהיה כתום, תגובות חיוביות יהיה צהוב/ירוק בצבע.
    3. אופציונלי: לצלם תמונות של RT-המנורה תגובות על רקע לבן בעזרת מצלמה.
  2. במקום הדגימות תחת 302 nm UV אור לאשר הנוכחות של RT-המנורה מוצרים על-ידי קרינה פלואורסצנטית. לצלם התוצאה בעזרת מצלמה.
    הערה: תגובות חיוביות RT-המנורה יהיה הפלט של פלורסנט.
    התראה: ללבוש מגן גוגל או פנים העין מגן UV בעת עבודה עם אור UV.
  3. אופציונלי: לאשר הנוכחות של מוצרים RT-המנורה על ידי ביצוע בג'ל על הדגימות.
    1. יוצקים 2% agarose ג'ל במאגר x TAE 1 עם כתם חומצת גרעין עבור פריט חזותי.
      התראה: כל כתם חומצת גרעין נקשר חומצות גרעין, ולכן הוא חומר מסרטן. ללבוש כפפות בעת הטיפול.
    2. הוסף µL 5 של סולם הדנ א במסלול הראשון כדי להשוות את המשקולות מולקולרית.
    3. עבור כל תגובה RT-המנורה, מערבבים µL 13 תערובת התגובה RT-מנורה עם 2 µL של ה-DNA בטעינת צבע. לטעון את התערובת 15 µL המכיל את ה-DNA בטעינת צבע.
    4. הפעל את הג'ל על 90 V במשך 90 דקות או עד הלהקות מופרדים ותמונה עם 302 אור UV ננומטר.
      הערה: תגובות חיוביות RT-המנורה יש דפוס laddering. תגובות שליליות RT-המנורה לא להכיל להקות.

6. סילוק

  1. תשליך RT-המנורה תגובות בשקיות חתומות כפול. תעשה לא אוטוקלב זה ייתכן aerosolize המוצרים RT-המנורה, שמוביל תגובות חיוביות כוזבות בעתיד.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

RT-המנורה תגובות ניתן לנתח באמצעות שלוש שיטות שונות. ראשית, עם התוספת של צבע פלורסנט חומצת גרעין, תגובות חיוביות יהיה צהוב/ירוק צבע היכן תגובות שליליות. תופיע כתום בעין בלתי מזוינת. שנית, התוספת של חומצת גרעין פלורסנט לצבוע את התגובה RT-המנורה תוצאות ב אות ניאון כאשר הדגימות שמחים על ידי אור UV. תגובות שליליות לא תהיה אות ניאון לזיהוי מעל כל זריחה רקע שעשויות להופיע בכמויות קטנות של הפקד שלילי. לבסוף, ניתן להפעיל RT-המנורה תגובות על ג'ל agarose. תגובות חיוביות RT-המנורה יש תבנית בעלת רצועות, ואילו תגובות שליליות יהיו להקות ה-DNA. דוגמאות זה בעזרת כל שלושת שיטות ניתוח אלה הם הפגינו איור 2 ו- 3. כל הדוגמאות הללו היה RNA מבודדת לפני RT-המנורה. איור 1 מדגים ריסוק של יתוש שלם ב- PBS, וזה מספיק עבור השימוש ב- RT-המנורה התגובה. איור 2, הוכח יחודיות של התגובה ZIKV RT-המנורה: רק את הפקד מולקולרית ZIKV, לא DENV מולקולרית הפקד או בקרה שלילית, יש תגובה RT-המנורה חיובית. יתר על כן, ZIKV הוא זוהה שתן והן בסרום של חולה עם זיהום ZIKV ידוע, אך לא המטופל אסימפטומטיים שליטה ללא זיהום ZIKV (איור 2א). איור 2B, הדגימות נבדקות כתרופות לבני 18s האנושי rRNA באמצעות RT-המנורה. רק דגימות מן החולים (שתן או סרום), אבל לא את הפקדים מולקולרי או הפקד שלילי, הן חיוביות עבור 18s rRNA. לכן, 18s rRNA RT-המנורה יכולה לשמש של בקרת איכות לתגובות RT-המנורה עבור הדגימות מחולים אנושי. דוגמאות היתוש יכול להיבדק באופן דומה ZIKV או את בקרת האיכות של RT-המנורה, AEDAE (איור 3). בדוגמה זו, הפקד המולקולרי חיובית ZIKV, כמו גם של יתוש נגוע ZIKV הן חיוביות עבור ZIKV. הפקד שלילי, הפקד מולקולרית עבור DENV, זיוף נגוע יתושים (יתוש microinjected עם תא תרבות המדיה המכילה שום וירוס), היתוש DENV נגוע. שלילי עבור ZIKV (איור 3א). עם זאת, כל היתושים הם חיוביים עבור AEDAE מאת RT-המנורה (איור 3ב).

במידת האפשר, כל שלוש שיטות אנליטיות אמור לשמש כדי לאשר תגובה חיובית או שלילית לפעמים האות פלורסנט יכול להיות חלש, אנשים מסוימים עשויים להיות עיוור צבעים, יצירת שינוי הצבע ויזואלי קשה לקבוע. במקרים בהם הפקד שלילי חיובי, הערכה השלמה של הדגימות שנבדקו לא חוקי כמו זיהום, ולכן תוצאות חיוביות שגויות שלא ניתן לשלול. במקרים בהם הפקד חיובי שלילי, כל סידרת דגימות אינה חוקית, מאחר התגובה RT-המנורה עשוי לא עבדו. זהו חומר קריאה איכותי החוצה, עם זאת, גבוה יותר עותקים של וירוס יביא לגידול במספר מוצרים RT-המנורה ניתן להערכה על-ידי עוצמת פלורסנט או האינטנסיביות של ה-DNA פסי צבע דפוס על ידי אלקטרופורזה בג'ל.

Figure 1
איור 1 : הכנת גולמי יתוש lysate. (א) מקום יתוש לתוך µL 100 ל- PBS צינור microcentrifuge. (B) באמצעות טיפ pipet P10, למחוץ היתוש נגד צידי הצינור 10 פעמים. (ג) זה מייצר גסה lysate זה צריך להיות טוו למטה בקצרה ומפרידה מלמעלה בטבלה כדי הצניפה פסולת. RT-המנורה התגובה צריך לשמש רק תגובת שיקוע. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2 : ZIKV ו- 18S rRNA RT-המנורה בדגימות שתן וסרום החולה. דגימות שתן או סרום החולה שליטה ללא תסמינים (C01) או ZIKV נדבק החולה (Z01) היו נתונים של ZIKV (א) או 18S rRNA (B) תגובות RT-מנורה ספציפית. RT-המנורה תגובות היו דמיינו לאחר התוספת של חומצת גרעין פלורסנט לצבוע על-ידי קרינה פלואורסצנטית העין (החלונית העליונה), ירוק (לוח האמצעי), או ג'ל אלקטרופורזה (פאנל התחתונה). ליין m: סמן הדנ א. המונית; NTC: שליטה תבנית (בקרה שלילית); ZIKV: ZIKV PCR סטנדרטי שליטה חיובית; DENV: DENV בקרה חיובית. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת. 

Figure 3
איור 3 : ZIKV, AEDAE RT-מנורה בקבר Aegypti Ae. . יחיד Ae. aegypti נגוע השליטה המדומה, ZIKV או DENV היו נתונים ZIKV (א) או תגובות RT-מנורה ספציפית AEDAE (B). RT-המנורה תגובות היו דמיינו לאחר התוספת של חומצת גרעין פלורסנט לצבוע על-ידי קרינה פלואורסצנטית העין (החלונית העליונה), ירוק (לוח האמצעי), או ג'ל אלקטרופורזה (פאנל התחתונה). ליין m: סמן הדנ א. המונית; NTC: שליטה תבנית (בקרה שלילית); ZIKV: ZIKV PCR סטנדרטי שליטה חיובית; DENV: DENV בקרה חיובית. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת. 

היעד פריימר רצף (5' - 3')
האדם הנבון 18S rRNA 18SrRNA-FIP *
18SrRNA-ביפ *
18SrRNA-F3
18SrRNA-B3
. אם 18SrRNA
18SrRNA-LB
TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG
GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG
GTTCAAAGCAGGCCCGAG
CCTCCGACTTTCGTTCTTGA
AGAACCGCGGTCCTATTCCATTATT
ATTCCTTGGACCGGCGCAAG
ZIKV ZIKV-FIP *
ZIKV-ביפ *
ZIKV-F3
ZIKV-B3
. אם ZIKV
ZIKV-LB
AACCTGAGGGCATGTGCAAACCGCGGTCAGTGGAGATGACT
CACAGGAGTGGAAACCCTCGACTGAAGTGGTGGGAGCAGAA
GCAGAGCAATGGATGGGATA
CCCATCCTTGAGGTACAGCT
TCGATTGGCTTCACAACGC
GGAGCAATTGGGAAGAAGTCC
Ae. aegypti אקטין Ae21-FIP *
Ae21-ביפ *
. אם Ae21
Ae21-F3
Ae21-B3
TGCTTGGTCCCTGCCTGGGAGACAGCCCACCAGAACGA
GAGACGAGAACGGCCCAGCGGGTCTGGTGTGTGTCTTTG
ACCGCAAGGCCAAGAACCG
CGGCGCCACCACAAGA
TCGTGCCTGTGTTTGTCG
* תחל צריך להיטהר על ידי המהירה ביצועים גבוהים כרומטוגרפיה נוזלית (HPLC). עבור כל תחל אחרים מספיקים תנאים desalting סטנדרטיים.

טבלה 1: פריימר רצף לתגובות RT-המנורה. פריימר רצפים מתוארים במקור הפרסום הקודם6.

נפח (µL) פריימר ריכוז מניות (מיקרומטר) ריכוז סופי (מיקרומטר)
80 פריימר לפנים הפנימי (FIP) 100 16
80 פריימר הפנימי לאחור (ביפ) 100 16
10 פריימר לפנים החיצוני (F3) 100 2
10 תחל החיצוני לאחור (B3) 100 2
20 לולאה קדימה (LF) 100 4
20 לולאה לאחור (ליברות) 100 4
280 מים ברמה מולקולרית - -
500 סה

בטבלה 2: הכנת 10 x מיקס פריימר RT-המנורה. RT-המנורה ומהצמיגים להגדיר עבור Ae. aegypti אקטין אינו מכיל פריימר BF; החלף את אמצעי אחסון זה עם מים.

1 x נפח (µL) רכיב סופי conc. עבור אמצעי אחסון µL 25
2.5 10 x מאגר הגברה Isothermic 1 x
1.8 100 מ מ דו/A/T/C/GTPs 1.4 מ מ
2.0 100 מ מ MgSO4 6 מ"מ + 2 מ"מ במאגר = 8 מ"מ [4-10 מ מ טווח]
2.5 תחל x 10 1.6 מיקרומטר FIP/ביפ, 0.2 ΜM F3/B3, FL מיקרומטר 0.4/BL...
1.0 לרום DNA פולימראז עם הזחה סטרנד (8,000 U/mL) 8 U
0.5 רוורס טרנסקריפטאז (15,000 U/mL) 7.5 U
0.5 UDG (1,000 U/mL) 0.5 U
12.3 מים ברמה מולקולרית -
23.0 סה

טבלה 3: הכנת מיקס מאסטר RT-המנורה.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

וזמינותו ZIKV RT-המנורה המתוארת בעלון זה עבודות נייר באמצעות דגימות של האדם והן יתושים-6. המגבלה של זיהוי היה כ 1 גנום שוות ערך6, אשר אמורה להספיק מאז המטען הנגיפי טיפוסי של חולה סימפטומטי ZIKV נגוע הוא 103 כדי 6 10 PFU/mL7. בנוסף, שיטה זו יכול לזהות ZIKV בדגימות ללא RNA בידוד הראשון וללא הגברה וירוס תרבית תאים. פעולה זו מפחיתה באופן משמעותי את זמן, עלות, הסיכונים הבריאותיים של זה וזמינותו בהשוואה לרביעיית-PCR.

דגימות שתן המשמשות את יחס נפח המצוין פרוטוקול זה צריך לאפשר תגובות RT-המנורה להתרחש ללא בידוד ה-RNA. בעוד אחד תיאורטית יכול להגדיל את הכמות להשתמש לתגובה RT-המנורה, טיפול צריך סדרניות כאשר זו דגימת שתן. השתן מכיל כימיקלים מרובים יכולה לעכב תגובות PCR; אוריאה בשתן ידוע כדי להשפיל את polymerases8 והוא באמצעות יחס התגובה שתן/RT-מנורה גבוהה מדי כדי למנוע את תגובת RT-המנורה. אם כמות נמוכה של וירוס צפוי, עדיף לבצע בידוד RNA באמצעות ערכת ספציפי לשתן. באופן דומה, סרום יכול להכיל מעכבי PCR זה עלול לעכב RT-המנורה, כאשר נעשה שימוש בסרום נפח גבוה8.

כלול פרוטוקול זה הוא ההכללה של פקדים איכות לתגובות RT-המנורה, דומה פקד הטעינה בפרוטוקולים סופג המערבי. אם מדגם קליני הוא שלילי לבקרת איכות RT-המנורה, ואז ריאקציה שלילית עבור ZIKV RT-המנורה עשויה להיות תוצאה שלילית שגויה כמו המדגם עשוי להכיל כמות גבוהה של ה-PCR מעכבי או כמויות נמוכות של RNA הכולל. . זה לא הכרחי כדי לבודד את ה-RNA מדגם לפני וזמינותו RT-מנורה התוצאות RT-המנורה נציג של פרוטוקול זה התקבלו ללא בידוד ה-RNA. אולם, בידוד RNA עשוי לשפר את הגילוי בדגימות עם עומס נמוך וירוס או שעשויות להכיל רמות גבוהות של מעכבי ה-PCR. עבור רוב סוגי הדגימה כולל סרום, ערכת בידוד RNA יכול לשמש הפרוטוקול המוצע של היצרן. עבור בדיקות שתן, ערכת בידוד RNA ספציפיים עבור דגימות שתן אמור לשמש. לקבלת דוגמאות יתושים, מומלץ lyse היתוש על-ידי הפעלת היתוש ב 100 µL ל- PBS דרך העמודה גריסה למשך 2 דקות מהירות מירבית או douncing לפני בידוד ה-RNA. RNA יכול להיות eluted ב µL 30 מאגר • תנאי ומאוחסנים ב-80 מעלות צלזיוס עד השימוש.

בידוד ה-RNA הוא הציע אז כדי להסיר את מעכבי PCR אנדוגני או לרכז את הרנ א לפני RT-המנורה. אם בקרת האיכות RT-המנורה עדיין שלילי, אז לרביעיית-PCR אמור לשמש לזיהוי ZIKV.

תחל RT-מנורה ב פרוטוקול זה אושרו לעבוד על טווח טמפרטורות (57-65 ° C), דגירה פעמים (8-60 דקות), כמו גם שימוש לא שגרתי חימום מקורות (למשל., המנה flameless חימום, תנורים) מחוץ תקן תנאי מעבדה. כל הטמפרטורות שנבדקו נתנו תוצאות דומות. על סמך הזיהוי על-ידי שינוי הצבע ויזואלי לבד, הזמן האופטימלי לאיתור מוצרים ZIKV RT-המנורה היה 30 דקות. אולם הזיהוי על ידי עירור אור UV או פסים דפוסי על ג'לים היו חיוביים עם מעט ככל 8 זמן הדגירה סה כ דקות. פרוטוקולים RT-המנורה מסוימים כוללים דימתיל סולפוקסיד, אבל ב פרוטוקול זה, יכול לגרום עיכוב של התגובה RT-המנורה. באמצעות פולימראז לרום של ה-DNA זה ניתן להגדיר בטמפרטורת החדר יכול להיות יתרונות פראי-סוג לרום DNA פולימראז כולל אותות הגברה מהר יותר, הגדילו יציבות בטמפרטורת החדר9,10 . אתידיום ברומיד יכול לשמש במקום להמחשת חומצות גרעין ב 2% agarose ג'לים, עם זאת, אחרים חומצות גרעין פלורסנט צבעני ג'לים agarose יש פוטנציאל מוטגניות התחתון הפיכתם בחירה בטוחה. עם זאת, זהירות מתאימים כגון לבש כפפות עדיין להשתמש.

מגבלה של פרוטוקול זה הוא כי איכותי, לא שיטה כמותית, אולם, כימות יחסית ניתן לעשות6. יתר על כן, תחל RT-המנורה הן מאוד ספציפיות, תוכננו נגד רצף שנשמרת מאוד של החלבון nonstructural 5 של ZIKV נמצאו זנים 16, לאמת לעבוד לפחות 5 זנים6. זה אפשרי כי מוטציות נרחב כדי ZIKV בטבע לא ייתכן לזיהוי על ידי תחל אלה בעתיד. קבוצות אחרות גם פיתחו טכנולוגיות חדשות איתור ZIKV שעשויים להיות עניין11,12,13,14,15,16,17 .

לסיכום, פרוטוקול זה מספק שיטה מהירה, פשוטה וחסכונית עבור ZIKV במגוון סוגי מדגם שלא דורש ציוד מיוחד. זה מספק כלי אבחון חדש לגילוי ZIKV שבו RNA אינה חייבת להיות מבודדת לפני התגובה RT-המנורה.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

ארוחת ליל סדר MBC יש קניין רוחני על שיטות אבחון Zika וירוס. המחברים הנותרים יש אין אינטרסים מתחרים.

Acknowledgments

עבודה זו נתמכה על ידי תרומה פילנתרופית משפחה מורין, רונלד הירש שדה מכון מדעי המח, כנסיית מריה הקדושה של מישיגן. התורמים שחיים היה אין תפקיד תכנון המחקר, איסוף נתונים, ניתוח, ההחלטה לפרסם או אופן ההכנה של כתב היד. אנו מודים גם ד ר ברנדט Zwaans, אליהו וורד עבור שלהם סקירה ביקורתית של כתב היד.

Materials

Name Company Catalog Number Comments
Bst 2.0 WarmStart DNA polymerase New England Biolabs M0537S
Isothermal Amplification Buffer  New England Biolabs B0537S
WarmStart RTx Reverse Transcriptase New England Biolabs M0380S
Antarctic Thermolabile UDG New England Biolabs M0372S
MgSO4 New England Biolabs B1003S
100 mM dATP Solution New England Biolabs N0440S Deoxynucleotide Set N0446S
100 mM dCTP Solution New England Biolabs N0441S Deoxynucleotide Set N0446S
100 mM dTTP Solution New England Biolabs N0443S Deoxynucleotide Set N0446S
100 mM dGTP Solution New England Biolabs N0442S Deoxynucleotide Set N0446S
100 mM dUTP Solution Thermo Fisher Scientific R0133
SYBR Green I Nucleic Acid Gel Stain Invitrogen S7563
Nancy-520 Sigma Aldrich 01494
Low DNA Mass Ladder Invitrogen 10-068-013
Zika Postive Control Robert Koch Institute, Germany N/A
Agarose Thermo Fisher Scientific BP1600
BlueJuice Gel Loading Buffer Invitrogen 10816015
Primers Integrated DNA Technologies Custom Oligo
Nuclease-Free Water Ambion AM9938
Urine Preservative Norgen Biotek 18126
ZIKV PCR Standard Robert Koch Institute N/A Vero E6 cell supernatants
DENV2 New Guinea C Control Connecticut Agricultural Experiment Station N/A

DOWNLOAD MATERIALS LIST

References

  1. Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. Zika Virus. New England Journal of Medicine. 374, (16), 1552-1563 (2016).
  2. Francois, P., et al. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. Federation of European Microbiological Societies Immunology and Medical Microbiology. 62, (1), 41-48 (2011).
  3. Tomita, N., Mori, Y., Kanda, H., Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols. 3, (5), 877-882 (2008).
  4. Gandasegui, J., et al. The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis. Public Library of Science Neglected Tropical Diseases. 9, (7), 0003963 (2015).
  5. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. The Journal of Visualized Experiments. (96), (2015).
  6. Lamb, L. E., et al. Rapid Detection of Zika Virus in Urine Samples and Infected Mosquitos by Reverse Transcription-Loop-Mediated Isothermal Amplification. Scientific Reports. 8, (1), 3803 (2018).
  7. Faye, O., et al. One-step RT-PCR for detection of Zika virus. Journal of Clinical Virology. 43, (1), 96-101 (2008).
  8. Schrader, C., Schielke, A., Ellerbroek, L., Johne, R. PCR inhibitors - occurrence, properties and removal. Journal of Applied Microbiology. 113, (5), 1014-1026 (2012).
  9. Poole, C. B., Tanner, N. A., Zhang, Y., Evans, T. C., Carlow, C. K. Diagnosis of brugian filariasis by loop-mediated isothermal amplification. Public Library of Science Neglected Tropical Diseases. 6, (12), 1948 (2012).
  10. Tanner, N. A., Zhang, Y., Evans, T. C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques. 53, (2), 81-89 (2012).
  11. Chan, K., et al. Rapid, Affordable and Portable Medium-Throughput Molecular Device for Zika Virus. Scientific Reports. 6, 38223 (2016).
  12. Lee, D., et al. Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays. Analytical Chemistry. 88, (24), 12272-12278 (2016).
  13. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, (5), 1255-1266 (2016).
  14. Song, J., et al. Instrument-Free Point-of-Care Molecular Detection of Zika Virus. Analytical Chemistry. 88, (14), 7289-7294 (2016).
  15. Yaren, O., et al. Point of sampling detection of Zika virus within a multiplexed kit capable of detecting dengue and chikungunya. BioMed Central Infectious Diseases. 17, (1), 293 (2017).
  16. Wang, X., et al. Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification. Journal of Virological Methods. 238, 86-93 (2016).
  17. Priye, A., et al. A smartphone-based diagnostic platform for rapid detection of Zika, chikungunya, and dengue viruses. Scientific Reports. 7, 44778 (2017).
הפוך שעתוק לולאה-בתיווך איזותרמי הגברה (RT-המנורה) Assay Zika וירוס, ניקיון בגנים שתן, סרום, ודוגמאות יתוש
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).More

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter