Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Omvendt transkripsjon-Loop-mediert isotermiske forsterkning (RT-lampe) analysen for Zika Virus og Housekeeping gener i urin, Serum og mygg prøver

doi: 10.3791/58436 Published: September 14, 2018

Summary

Denne protokollen gir en effektiv og rimelig metode for å oppdage Zika virus eller kontrollere mål i prøver fra mennesker urin og serum eller mygg av omvendt transkripsjon loop-mediert isotermiske forsterkning (RT-lampe). Denne metoden krever ikke RNA isolasjon og kan gjøres innen 30 min.

Abstract

Zika viruset (ZIKV) kan være asymptomatisk i voksne, men smitte under svangerskapet kan føre til spontanabort og alvorlig nevrologisk fødselsskader. Målet med denne protokollen er å raskt oppdage ZIKV i både menneskelige og mygg. Gjeldende gullstandarden for ZIKV påvisning er kvantitative omvendt transkripsjon PCR (qRT-PCR); omvendt transkripsjon loop-mediert isotermiske forsterkning (RT-lampe) tillate en mer effektiv og rimelig testing uten behov for dyrt utstyr. I denne studien er RT-lampe brukt til ZIKV gjenkjenning i ulike biologiske prøver innen 30 min, uten første isolere RNA fra utvalget. Denne teknikken er demonstrert bruker ZIKV infiserte pasient urin og serum og infisert mygg prøver. 18s ribosomal ribonukleinsyre og utgangen blir brukt som kontroller i menneskelige og mygg prøver, henholdsvis.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I 2015 fikk Zika virus (ZIKV) fremtredende global oppmerksomhet som en smittsom sykdom bekymring fordi smitte under svangerskapet var knyttet til spontanabort, dødfødsel, alvorlig nevrologisk fødselsskader inkludert microcephaly, samt andre medfødt fødselsskader1. I sjeldne tilfeller har ZIKV vært forbundet med Guillain-Barrés syndrom. ZIKV overføres primært av Aedes mygg; men kan det også spres gjennom seksuell kontakt1. Gitt at infeksjonen med ZIKV er asymptomatisk i fleste eller presenterer med mild influensalignende symptomer som overlapper med symptomer på infeksjon av andre arborviruses1, var det behov for bedre metoder for rask og kostnadseffektiv påvisning av ZIKV til skjermen både personer samt lokale mygg populasjoner.

Kvantitativ omvendt transkripsjon PCR (qRT-PCR) er en pålitelig analysen til ZIKV oppdagelse. men krever denne teknikken dyre spesialisert utstyr og opplært personale RNA isolasjon fra utvalget av interesse. Omvendt transkripsjon loop-mediert isotermiske forsterkning (RT-lampe) er en ettrinns nukleinsyre forsterkning metode basert på PCR teknologi som bare krever en inkubasjon temperatur skyldes bruk av en varmekjære DNA polymerase med tråd Forskyvning egenskaper. Dette omgår behovet for en thermocycler og reduserer tiden som kreves for å fullføre analysen. Ekstra fordeler av RT-lampe inkluderer dens høy spesifisitet og følsomhet, robusthet på et spekter av pH nivåer og temperaturer og motstand mot mange PCR hemmere2. Den har en relativt lav kostnad og reagenser er stabile ved romtemperatur. Gitt disse egenskapene, kan RT-lampe distribueres i et laboratorium eller i feltet. Som sådan, er lampe reaksjoner utviklet for å oppdage en rekke patogener og andre typer infeksjon3,4,5. Målet med RT-lampe protokollen beskrevet i denne hvitboken er å oppdage ZIKV uten RNA isolasjon i serum og urin prøver fra mennesker så vel som en enkelt infiserte mygg innen 30 min gjennom RT-lampe. Denne metoden kan brukes til å erstatte qRT PCR som det er en følsom, rask diagnostiske verktøy som fungerer raskt og i innstillinger utenfor laboratoriet.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle metodene som er beskrevet her er godkjent av institusjonelle Review Board (IRB) av Beaumont helse. Alle eksperimentene ble utført i samsvar med relevante retningslinjer og regler.

Advarsel: Alle potensielt smittefarlig materiale skal håndteres i henhold til grad 2 standarder inkludert bruk av personlig verneutstyr. Alle prosedyrer som kan produsere aerosoler skal utføres i en biosafety kabinett. I tillegg skal arbeidet med live mygg utføres i passende leddyr Containment nivå 1-3 anlegget. Gitt association of ZIKV infeksjon med medfødte misdannelser, bør kvinner som er gravide, prøver å bli gravid eller partnere i disse kvinnene betydelig redusere deres laboratorium eksponering for ZIKV. Transport av ZIKV prøver er klassifisert i USA som kategori B biologiske stoffer i samsvar med Department of transport farlige materialer forskriften (49 CFR del 171-180) og derfor frakt prøver skal holde de retningslinjer. Import i USA av ZIKV biospecimens krever en Centers for Disease Control og Prevention (CDC) Import tillatelse. Import av en Leddyr som kan tjene som en vektor for ZIKV overføring, selv om de ikke er infisert, krever USA Department of Agriculture (USDA) tillatelse. Denne informasjonen er gjeldende ved utgivelsestidspunktet. Oppdatert anbefalinger kan finnes på https://www.cdc.gov/zika/laboratories/lab-safety.html.

Merk: RT-lampe reaksjoner er utsatt for høyere priser falske positive reaksjoner, så forholdsregler bør tas i eksperimentell planlegging. Alle oppsett og gjennomføring av RT-lampe reaksjoner bør bruke angitte Pipetter og filter tips. Ideelt sett bør en lateral arbeidsflyten opprettes. Hvis mulig, skal analyse og imaging (del 5) oppstå i et annet innelukket rom å hindre forurensning. Åpningen av reagensglass med RT-lampe produkter bør holdes til et minimum.

1. RT-lampe Primer forberedelse

  1. Rekonstituer hver lyofilisert RT-lampe primer i molekylær klasse vann til en siste konsentrasjon av 100 µM (tabell 1). Kort vortex primer løsningen å sikre en homogen løsning og kort Nedspinning løsningen for topphastigheten i en bordplaten sentrifuge å samle alle primer løsning.
  2. Forberede en 10 x RT-lampe Primer blanding av FIP, BIP, F3, B3, LF og LB primerne bruker volumene i tabell 2. Kort vortex primer løsningen å sikre en homogen løsning, og kort Nedspinning løsningen for topphastigheten i en bordplaten sentrifuge unngå tap.
    Merk: RT-lampe primer satt for Ae. aegypti utgangen (AEDAE) inneholder ikke en LB primer (loop primere er ikke alltid nødvendig for RT-lampe reaksjoner). I dette tilfellet erstatte LB primer volumet med molekylær klasse vann.
  3. Lagre primerne på 20 ° C mellom bruker og unngå gratis tine sykluser.

2. prøven forberedelse

  1. For menneskelig urinprøver: Bruke enten fersk urin, frosne urin eller urin i konserveringsmiddel. Friske eller frosne eksempel: umiddelbart Nedspinning prøven etter kolleksjonen for 10 min 700 x g, og bruke nedbryting for analyse eller fryse-80 ° c for fremtidig bruk. Tine frosne prøvene på is før bruk.
  2. For koagulasjon: Bruk enten friske eller frosne serumprøver.
  3. For ZIKV infisert cellelinjer: bruke betinget media eller celle lysates.
    Merk: Cell-free betinget media fra Ae. albopictus C6/36 celler 8 dager etter smitte kan brukes som positive kontroller for ZIKV RT-lampe reaksjoner.
  4. For Ae. aegypti myggen: bruker enten helt friske eller frosne myggen skrotter. Tine frossen mygg på is. Forberede en grov mygg lysate ved å plassere en personlige mygg i 100 µL fosfat-bufret saltoppløsning (PBS) og homogenize ved å knuse mosquito 10 ganger med P10 Pipetter tips (figur 1). Kort sentrifuge råoljen lysate til pellets alle partikler. Bruk nedbryting for nedstrøms RT-lampe analyse.
    Merk: Positiv kontroller kan genereres i et laboratorium ved å infisere kvinnelige mygg med intrathoracic microinjection med ca. 103 genomet ekvivalenter av virus i et volum på 200 nL og høsting mosquito 5 dager etter infeksjon.

3. forberedelse RT-lampe Master Mix

  1. Forberede en RT-lampe master mix reaksjon på is hver primer angi som skal brukes ved hjelp av kvantum guide i tabell 3.
    Merk: Bruk av thermolabile Uracil DNA Glycosylase (UDG) hjelper hindrer falske positiver.
  2. Vortex kort å sikre at alle prøvene er godt blandet, deretter spinne ned kort for å hindre tap av volumet.

4. RT-lampe analysen

  1. Pipetter 23,0 µL av RT-lampe master mix per reaksjon i en 200 µL PCR rør. Legge til 2.0 µL av prøven (urin, serum eller grov mygg lysate nedbryting som beskrevet i trinn 2). Dette bringer det totale volumet til 25.0 µL per RT-lampe reaksjon. Bruk molekylær klasse vann for negative kontrollen. Inkluder en positiv kontroll.
    Merk: PCR standard eller virus aksjer fra nedbryting av infiserte cellelinjer kan brukes som en positiv.
    1. Valgfritt: Inkluder en spesifisitet kontroll reaksjonen av en relaterte arbovirus som dengue virus (DENV). Forberede prøven som beskrevet i trinn 2 etter eksempel type. Legge til 2.0 µL av kontrollen spesifisitet 23,0 µL av RT-lampe master blandingen inn i et 200 µL PCR rør.
  2. Varme prøvene på 61 ° C i 30 min med en varme blokk, vannbad eller thermocycler.
  3. Varme deaktivere polymerase ved oppvarming til 80 ° C i 10 min.

5. RT-lampe analyse

Merk: Utfør RT-lampe analyse i en separat, lukkede rom.

  1. Etter inkubasjon, tilgang RT-lampe reaksjoner visuelt etter tilstedeværelsen av en fargeendring.
    1. Fortynne fluorescerende nukleinsyre fargestoff 1:10 i TAE (40 mM Tris, 20 mM eddiksyre, 1 mM EDTA) buffer.
      Advarsel: Noen nukleinsyre flekken binder til nucleic syrer og derfor er et karsinogen. Bruk hansker når du håndterer.
    2. 12 µL av RT-lampe reaksjon, legge 2 µL av fluorescerende nukleinsyre fargestoff fortynning.
      Merk: Negative reaksjoner er oransje i farge og positive reaksjoner vil være grønn i fargen.
    3. Valgfritt: Ta bilder av RT-lampe reaksjoner på hvit bakgrunn bruker et kamera.
  2. Sett prøvene under 302 nm UV lys å bekrefte tilstedeværelse av RT-lampe produkter av fluorescens. Ta bilde av resultatet med et kamera.
    Merk: Positiv RT-lampe reaksjoner vil ha en lysrør utdata.
    FORSIKTIG: Bruk UV beskyttende øye googles eller ansikt skjold når du arbeider med UV-lys.
  3. Valgfritt: Bekrefte tilstedeværelse av RT-lampe produkter ved å utføre gel geleelektroforese på prøvene.
    1. Hell en 2% agarose gel 1 x TAE buffer med en nukleinsyre flekk for visualisering.
      Advarsel: Noen nukleinsyre flekken binder til nucleic syrer og derfor er et karsinogen. Bruk hansker når du håndterer.
    2. Legge til 5 µL av en DNA stige i første kjørefelt sammenligne molekylvekt.
    3. Hver RT-lampe reaksjon, blande 13 µL av RT-lampe reaksjonsblandingen med 2 µL av DNA laste fargestoff. Last 15 µL blandingen inneholder DNA laste fargestoff.
    4. Kjør gel på 90 V i 90 minutter eller til feltene er atskilt og bilde med 302 nm UV-lyset.
      Merk: Positiv RT-lampe reaksjoner vil ha et laddering mønster. Negative RT-lampe reaksjoner bør ikke inneholde noen band.

6. ordning

  1. Kast RT-lampe reaksjoner i dobbelt forseglet poser. Gjør ikke autoclave som dette kan aerosolize RT-lampe produktene, fører til false positiv reaksjonene i fremtiden.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

RT-lampe reaksjoner kan analyseres bruke tre forskjellige metoder. Først med tillegg av en fluorescerende nukleinsyre fargestoff, vil positive reaksjoner være grønn farge hvor negative reaksjoner vises oransje i farge for det blotte øye. Andre tillegg av fluorescerende nukleinsyre fargestoff til RT-lampe reaksjon resulterer i et fluorescerende signal når prøvene er begeistret av UV-lyset. Negative reaksjoner vil ikke ha en detectable fluorescerende signal over noen bakgrunn fluorescens som kan finnes i små mengder i kontrollen negative. Til slutt, RT-lampe reaksjoner kan kjøre på en agarose gel. Positive RT-lampe reaksjoner vil ha et stripemønster, mens negative reaksjoner vil ha ingen DNA band. Eksempler på dette ved hjelp av alle tre metodene analyse er vist i figur 2 og 3. Ingen av disse prøvene hadde RNA isolert før RT-lampe. Figur 1 viser knusing av en hel mygg i PBS, som er tilstrekkelig for bruk i RT-lampe reaksjonen. Spesifisiteten av ZIKV RT-lampe reaksjonen er demonstrert i figur 2: bare ZIKV molekylær kontrollen, ikke DENV molekylær kontrollen eller negativ kontroll, har en positiv RT-lampe reaksjon. Videre er ZIKV oppdaget i både urin og serum av en pasient med kjente ZIKV infeksjon, men ikke i asymptomatisk kontroll pasienten uten ZIKV infeksjon (figur 2A). I figur 2Bprøvene er testet for menneskelig 18s rRNA bruker RT-lampe. Bare prøvene fra pasienter (urin eller serum), men ikke molekylær kontrollene eller kontrollen negative er positivt for 18s rRNA. Derfor 18s rRNA RT-lampe kan brukes som en kvalitetskontroll for RT-lampe reaksjoner for prøvene fra menneskelige pasienter. Mygg prøver kan testes tilsvarende for ZIKV eller RT-lampe kvalitetskontroll, AEDAE (Figur 3). I dette eksemplet er positiv molekylær kontrollen for ZIKV samt mosquito infisert med ZIKV positivt på ZIKV. Kontrollen negative molekylær kontrollen for DENV, uekte infisert mygg (myggen microinjected med celle kultur medier som inneholder ingen virus), og DENV infisert mosquito alle negative for ZIKV (Figur 3A). Men er alle mosquitoes positivt for AEDAE av RT-lampen (Figur 3B).

Når alle tre analytiske metoder skal brukes til å bekrefte en positiv eller negativ reaksjon som fluorescerende signalet kan være svak og enkelte personer kan være fargen blind, gjør visuelle fargeendring vanskelig å fastslå. I tilfeller hvor kontrollen negative er positiv, hele settet med prøvene testet er ugyldig som forurensning og derfor falske positiver kan ikke utelukkes. I tilfeller hvor kontrollen positiv er negativ, er hele settet med eksempler ugyldig fordi RT-lampe reaksjonen ikke kan ha jobbet. Dette er en kvalitativ lese ut, men høyere kopier av viruset vil resultere i en økning i RT-lampe produkter som kan bli verdsatt av fluorescerende intensitet eller intensiteten av DNA striper mønster av gel geleelektroforese.

Figure 1
Figur 1 : Forberedelse av mygg råolje lysate. (A) Plasser en mygg til 100 µL av PBS i et microcentrifuge rør. (B) bruker en P10 Pipetter tips, knuse mosquito mot sidene av røret 10 ganger. (C) Dette gir en grov lysate som bør være spunnet ned kort i en bordplaten sentrifuge til pellets rusk. Bare nedbryting bør brukes for RT-lampe reaksjon. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : ZIKV og 18S rRNA RT-lampe i urin og serum pasientprøvene. Urin eller serum-prøver fra en asymptomatisk kontroll pasienten (C01) eller ZIKV infiserte pasient (Z01) ble utsatt for et ZIKV (A) eller 18S rRNA (B) bestemt RT-lampe reaksjoner. RT-lampe reaksjoner var visualisert etter tillegg av en fluorescerende nukleinsyre farge av øyet (øvre panel), grønn fluorescens (midten panel) eller gel geleelektroforese (nedre panelet). Lane M: DNA masse penn; NTC: Ingen mal kontroll (negativ kontroll); ZIKV: ZIKV PCR Standard positiv kontroll; DENV: DENV positive kontroll. Klikk her for å se en større versjon av dette tallet. 

Figure 3
Figur 3 : ZIKV og AEDAE RT-lampen i AE. aegypti . Enkelt Ae. aegypti infisert med uekte kontroll, ZIKV eller DENV ble utsatt for ZIKV (A) eller AEDAE (B) bestemt RT-lampe reaksjoner. RT-lampe reaksjoner var visualisert etter tillegg av en fluorescerende nukleinsyre farge av øyet (øvre panel), grønn fluorescens (midten panel) eller gel geleelektroforese (nedre panelet). Lane M: DNA masse penn; NTC: Ingen mal kontroll (negativ kontroll); ZIKV: ZIKV PCR Standard positiv kontroll; DENV: DENV positive kontroll. Klikk her for å se en større versjon av dette tallet. 

Mål Primer Sekvens (5 - 3')
Homo sapien 18S rRNA 18SrRNA-FIP *
18SrRNA-BIP *
18SrRNA-F3
18SrRNA-B3
18SrRNA-LF
18SrRNA-LB
TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG
GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG
GTTCAAAGCAGGCCCGAG
CCTCCGACTTTCGTTCTTGA
AGAACCGCGGTCCTATTCCATTATT
ATTCCTTGGACCGGCGCAAG
ZIKV ZIKV-FIP *
ZIKV-BIP *
ZIKV-F3
ZIKV-B3
ZIKV-LF
ZIKV-LB
AACCTGAGGGCATGTGCAAACCGCGGTCAGTGGAGATGACT
CACAGGAGTGGAAACCCTCGACTGAAGTGGTGGGAGCAGAA
GCAGAGCAATGGATGGGATA
CCCATCCTTGAGGTACAGCT
TCGATTGGCTTCACAACGC
GGAGCAATTGGGAAGAAGTCC
AE. aegypti utgangen Ae21-FIP *
Ae21-BIP *
Ae21-LF
Ae21-F3
Ae21-B3
TGCTTGGTCCCTGCCTGGGAGACAGCCCACCAGAACGA
GAGACGAGAACGGCCCAGCGGGTCTGGTGTGTGTCTTTG
ACCGCAAGGCCAAGAACCG
CGGCGCCACCACAAGA
TCGTGCCTGTGTTTGTCG
* Primere bør renses rask høy ytelse flytende kromatografi (HPLC). For alle andre primere er avsalting standardvilkår tilstrekkelig.

Tabell 1: Primer sekvenser for RT-lampe reaksjoner. Primer sekvenser er opprinnelig beskrevet i forrige publikasjonen6.

Volum (µL) Primer Lager konsentrasjon (µM) Siste konsentrasjon (µM)
80 Videresende indre Primer (FIP) 100 16
80 Bakover indre Primer (BIP) 100 16
10 Videresende ytre Primer (F3) 100 2
10 Bakover ytre Primer (B3) 100 2
20 Loop frem (LF) 100 4
20 Sløyfe bakover (LB) 100 4
280 molekylær klasse vann - -
500 Totalt

Tabell 2: utarbeidelse av 10 x RT-lampe Primer Mix. RT-lampe primer satt for Ae. aegypti utgangen inneholder ikke en BF primer; erstatte dette volumet med vann.

1 x volum (µL) Komponent Siste Conc. For 25 µL volum
2.5 10 x Isothermic forsterkning Buffer 1 x
1.8 100 mM dU/A/T/C/GTPs 1.4 mM
2.0 100 mM MgSO4 6 mM + 2 mM i bufferen = 8 mM [4-10 mM område]
2.5 10 x primere 1.6 ΜM FIP/BIP, 0,2 ΜM F3/B3, 0.4 ΜM FL/BL
1.0 varmekjære DNA polymerase med strand forskyvning (8000 U/mL) 8 U
0,5 Revers transkriptase (15.000 U/mL) 7.5 U
0,5 UDG (1000 U/mL) 0,5 U
12.3 molekylær klasse vann -
23,0 Totalt

Tabell 3: Utarbeidelse av RT-lampe Master Mix.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ZIKV RT-lampe analysen beskrevet i dette papir fungerer med både menneskelig og mygg prøver6. Grensen for deteksjon var ca 1 genomet tilsvarende6, som bør være tilstrekkelig, siden den typiske viral belastningen for en symptomatisk ZIKV infiserte pasient er 103  106 PFU/mL7. I tillegg finner denne metoden ZIKV i prøver uten første skille RNA og uten virus forsterkning i cellekultur. Dette reduserer betydelig tid, kostnader og helserisikoen av denne analysen sammenlignet qRT PCR.

Urinprøver brukes på volumkontrollen i denne protokollen skal RT-lampe reaksjoner på skje uten en RNA isolasjon. Mens man kunne teoretisk øke mengden av prøven brukt en RT-lampe reaksjon, bør forsiktighet utvises ved dette eksemplet er urin. Urin inneholder flere kjemikalier som kan hemme PCR reaksjoner; urea i urinen er kjent for å redusere polymerases8 , og bruke urin/RT-lampe reaksjon forholdet som er for høyt vil hindre RT-lampe reaksjonen. Hvis en lav mengde virus er forventet, ville det være bedre å utføre en RNA isolasjon bruker en kit bestemt urin. Tilsvarende kan serum inneholde PCR-hemmere som kan hemme RT-lampen når serum brukes på høyere volum8.

Inkludert i denne protokollen er inkluderingen av kvalitetskontroll for RT-lampe reaksjoner, som en lasting kontroll i vestlige blotting protokoller. Hvis en klinisk prøve er negativt for kvalitetskontroll RT-lampe, kan så en negativ reaksjon for ZIKV RT-lampen være en falsk negativt for prøven kan inneholde en høy mengde PCR-hemmere eller små mengder av totalt. Det er ikke nødvendig å isolere RNA fra prøven før RT-lampe analysen. Representant RT-lampe resultatene i denne protokollen ble innhentet uten RNA isolasjon. Imidlertid RNA isolasjon kan forbedre gjenkjenningen i prøver med lav viruset belastning eller som inneholder høye nivåer av PCR-hemmere. For de fleste eksempel typer inkludert serum, kan en RNA isolering kit brukes etter produsentens foreslo protokollen. For urinprøver, bør en RNA isolering kit gjelder urinprøver brukes. For mygg prøver, er det anbefalt å lyse mosquito ved å kjøre mosquito i 100 µL av PBS gjennom en shredding kolonne i 2 minutter på maksimal hastighet eller douncing før RNA isolasjon. RNA kan elut i 30 µL av elueringsbufferen og lagret på-80 ° C før bruk.

RNA isolasjon foreslås deretter fjerne de endogene PCR-hemmere eller konsentrere RNA før RT-lampe. Hvis kontrollen RT-lampe kvalitet er fortsatt negative, bør deretter qRT PCR brukes for gjenkjenning av ZIKV.

RT-lampe primerne i denne protokollen er bekreftet for å arbeide på en rekke temperaturer (57-65 ° C) og inkubasjon ganger (8-60 minutter), samt bruke ukonvensjonelle varme kilder (f.eks., flameless rasjon varmeapparatet, vannbad) utenfor standard laboratorieforhold. Alle temperaturer testet ga sammenlignbare resultater. Basert på deteksjon av visuelle fargeendring alene, var det optimale tidspunktet for oppdagelsen av ZIKV RT-lampe produkter 30 min. Men gjenkjenning av UV lys eksitasjon eller banding mønstre på gels var positive med så lite som 8 min totale inkubasjon tid. Noen RT-lampe protokoller inkluderer DMSO, men i denne protokollen, kan det føre hemming av RT-lampe reaksjonen. Bruker en varmekjære DNA polymerase som kan settes opp ved romtemperatur kan ha fordeler over vill-type varmekjære DNA polymerase inkludert raskere forsterkning signaler og økt stabilitet ved romtemperatur9,10 . Ethidium bromide kan brukes i stedet for nukleinsyre effekt i 2% agarose gels, men andre fluorescerende nukleinsyre fargestoffer for agarose gels lavere mutagene potensial gjør dem en sikrere valg. Imidlertid bør fortsatt nødvendige forholdsregler som iført hansker brukes.

En begrensning av denne protokollen er at det er en kvalitativ og ikke en kvantitativ teknikk, men relative kvantifisering kan gjøres6. Videre RT-lampe primere er svært spesifikke og ble utformet mot en høyt konservert sekvens av nonstructural protein 5 av ZIKV som er funnet i 16 stammer og bekreftet til å arbeide i minst 5 stammer6. Det er mulig at omfattende mutasjoner til ZIKV i naturen ikke kan være synlig av disse veiledningene i fremtiden. Andre grupper har også utviklet ny teknologi for påvisning av ZIKV som kan være av interesse11,12,13,14,15,16,17 .

I sammendraget gir denne protokollen en rask, enkel og kostnadseffektiv metode for ZIKV i en rekke utvalg typer som ikke krever spesialisert utstyr. Dette gir en ny Diagnoseverktøy for ZIKV gjenkjenning som RNA ikke trenger å være isolert før RT-lampe reaksjonen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

LEL og MBC har immaterielle på Zika virus diagnose metoder. Gjenværende forfatterne har ingen konkurrerende interesser.

Acknowledgments

Dette arbeidet ble støttet av Maureen og Ronald Hirsch familie filantropiske bidrag og feltet Neurosciences Institute, St. Marys i Michigan. Fond ikke hadde noen rolle i studien design, innsamling og analyse, beslutningen om å publisere eller utarbeidelse av manuskriptet. Vi takker også Dr. Bernadette Zwaans og Elijah Ward for deres kritisk gjennomgang av manuskriptet.

Materials

Name Company Catalog Number Comments
Bst 2.0 WarmStart DNA polymerase New England Biolabs M0537S
Isothermal Amplification Buffer  New England Biolabs B0537S
WarmStart RTx Reverse Transcriptase New England Biolabs M0380S
Antarctic Thermolabile UDG New England Biolabs M0372S
MgSO4 New England Biolabs B1003S
100 mM dATP Solution New England Biolabs N0440S Deoxynucleotide Set N0446S
100 mM dCTP Solution New England Biolabs N0441S Deoxynucleotide Set N0446S
100 mM dTTP Solution New England Biolabs N0443S Deoxynucleotide Set N0446S
100 mM dGTP Solution New England Biolabs N0442S Deoxynucleotide Set N0446S
100 mM dUTP Solution Thermo Fisher Scientific R0133
SYBR Green I Nucleic Acid Gel Stain Invitrogen S7563
Nancy-520 Sigma Aldrich 01494
Low DNA Mass Ladder Invitrogen 10-068-013
Zika Postive Control Robert Koch Institute, Germany N/A
Agarose Thermo Fisher Scientific BP1600
BlueJuice Gel Loading Buffer Invitrogen 10816015
Primers Integrated DNA Technologies Custom Oligo
Nuclease-Free Water Ambion AM9938
Urine Preservative Norgen Biotek 18126
ZIKV PCR Standard Robert Koch Institute N/A Vero E6 cell supernatants
DENV2 New Guinea C Control Connecticut Agricultural Experiment Station N/A

DOWNLOAD MATERIALS LIST

References

  1. Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. Zika Virus. New England Journal of Medicine. 374, (16), 1552-1563 (2016).
  2. Francois, P., et al. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. Federation of European Microbiological Societies Immunology and Medical Microbiology. 62, (1), 41-48 (2011).
  3. Tomita, N., Mori, Y., Kanda, H., Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols. 3, (5), 877-882 (2008).
  4. Gandasegui, J., et al. The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis. Public Library of Science Neglected Tropical Diseases. 9, (7), 0003963 (2015).
  5. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. The Journal of Visualized Experiments. (96), (2015).
  6. Lamb, L. E., et al. Rapid Detection of Zika Virus in Urine Samples and Infected Mosquitos by Reverse Transcription-Loop-Mediated Isothermal Amplification. Scientific Reports. 8, (1), 3803 (2018).
  7. Faye, O., et al. One-step RT-PCR for detection of Zika virus. Journal of Clinical Virology. 43, (1), 96-101 (2008).
  8. Schrader, C., Schielke, A., Ellerbroek, L., Johne, R. PCR inhibitors - occurrence, properties and removal. Journal of Applied Microbiology. 113, (5), 1014-1026 (2012).
  9. Poole, C. B., Tanner, N. A., Zhang, Y., Evans, T. C., Carlow, C. K. Diagnosis of brugian filariasis by loop-mediated isothermal amplification. Public Library of Science Neglected Tropical Diseases. 6, (12), 1948 (2012).
  10. Tanner, N. A., Zhang, Y., Evans, T. C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques. 53, (2), 81-89 (2012).
  11. Chan, K., et al. Rapid, Affordable and Portable Medium-Throughput Molecular Device for Zika Virus. Scientific Reports. 6, 38223 (2016).
  12. Lee, D., et al. Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays. Analytical Chemistry. 88, (24), 12272-12278 (2016).
  13. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, (5), 1255-1266 (2016).
  14. Song, J., et al. Instrument-Free Point-of-Care Molecular Detection of Zika Virus. Analytical Chemistry. 88, (14), 7289-7294 (2016).
  15. Yaren, O., et al. Point of sampling detection of Zika virus within a multiplexed kit capable of detecting dengue and chikungunya. BioMed Central Infectious Diseases. 17, (1), 293 (2017).
  16. Wang, X., et al. Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification. Journal of Virological Methods. 238, 86-93 (2016).
  17. Priye, A., et al. A smartphone-based diagnostic platform for rapid detection of Zika, chikungunya, and dengue viruses. Scientific Reports. 7, 44778 (2017).
Omvendt transkripsjon-Loop-mediert isotermiske forsterkning (RT-lampe) analysen for Zika Virus og Housekeeping gener i urin, Serum og mygg prøver
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).More

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter