Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Reverter a transcrição Loop-mediada por amplificação isotérmica (RT-lâmpada) ensaio para vírus Zika e Housekeeping Genes em amostras de Mosquito, soro e urina

doi: 10.3791/58436 Published: September 14, 2018

Summary

Este protocolo fornece um método eficiente e de baixo custo para detectar vírus Zika ou controlar alvos em amostras de urina e soro humanas ou em mosquitos por amplificação isotérmica transcrição reversa mediada por laço (RT-lâmpada). Este método não requer isolamento de RNA e pode ser feito dentro de 30 min.

Abstract

Infecção com vírus Zika (ZIKV) pode ser assintomática em adultos, no entanto, a infecção durante a gravidez pode levar a aborto e neurológicos graves defeitos de nascimento. O objetivo do presente protocolo é rapidamente detectar ZIKV em amostras de ambos humanos e mosquito. O atual padrão-ouro para a deteção de ZIKV é quantitativa transcrição reversa PCR (qRT-PCR); amplificação isotérmica transcrição reversa mediada por laço (RT-lâmpada) pode permitir um teste mais eficiente e de baixo custo sem a necessidade de equipamento caro. Neste estudo, RT-lâmpada é utilizada para detecção de ZIKV em diversas amostras biológicas dentro de 30 min, sem primeiro a isolar o RNA da amostra. Esta técnica é demonstrada usando ZIKV infectados, soro e urina de paciente e infectado amostras de mosquito. O ácido ribonucleico ribossomal 18s e actina são usados como controles em amostras de humanos e mosquito, respectivamente.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Em 2015, vírus Zika (ZIKV) ganharam atenção mundial proeminente como uma doença infecciosa de preocupação porque infecção durante a gravidez estava ligada ao aborto, morte fetal, graves defeitos congênitos neurológicos incluindo microcefalia, bem como outras doenças congênitas defeitos de nascimento1. Em casos raros, ZIKV tem sido associado com a síndrome de Guillain-Barré. ZIKV é transmitida principalmente pelo Aedes mosquitos; no entanto, ele também pode ser transmitido através de de contato sexual1. Dado que a infecção com ZIKV é assintomática na maioria das pessoas ou apresenta com gripe-como sintomas leves que se sobrepõem com os sintomas da infecção de outros arborviruses1, havia uma necessidade de métodos aperfeiçoados de detecção rápida e econômica de ZIKV para as pessoas, bem como populações locais mosquito da tela.

A transcrição reversa quantitativa PCR (qRT-PCR) é um ensaio confiável para a deteção de ZIKV; no entanto, esta técnica requer equipamento especializado caro, pessoal treinado e isolamento de RNA da amostra de interesse. Transcrição reversa mediada por laço amplificação isotérmica (RT-lâmpada) é um método de amplificação do ácido nucleico de uma etapa baseado na tecnologia PCR que apenas requer uma temperatura de incubação devido ao uso de uma DNA-polimerase termofílicas com vertente Propriedades de deslocamento. Isso evita a necessidade de um thermocycler e diminui o comprimento de tempo necessário para completar o ensaio. Vantagens adicionais da RT-lâmpada incluem sua alta especificidade e sensibilidade, robustez em uma variedade de níveis de pH e temperatura e resistência a muitos inibidores PCR2. Tem um custo relativamente baixo e os reagentes são estáveis à temperatura ambiente. Tendo em conta estas características, RT-lâmpada pode ser implantada em um laboratório ou no campo. Como tal, as reações de luz foram desenvolvidas para detectar uma gama de patógenos e outros tipos de infecção3,4,5. O objetivo do protocolo de RT-lâmpada descrito neste documento é detectar ZIKV sem isolamento de RNA no soro e urina amostras humanas, bem como em um único mosquito infectado dentro de 30 min por meio de RT-lâmpada. Esse método pode ser usado para substituir o qRT-PCR, que é uma ferramenta de diagnóstico sensível e rápida que funciona rapidamente e em configurações fora do laboratório.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Todos os métodos descritos aqui foram aprovados por institucional Review Board (IRB) de saúde de Beaumont. Todos os experimentos foram realizados em conformidade com os regulamentos e orientações pertinentes.

Atenção: Todos os materiais potencialmente infecciosos devem ser manuseados de acordo com as normas de biossegurança nível 2, incluindo o uso de equipamentos de proteção individual. Quaisquer procedimentos que podem produzir aerossol devem ser executados em uma armário de biossegurança. Além disso, trabalho com mosquitos ao vivo deve ser realizado nas instalações adequadas artrópode contenção nível 1-3. Dada a associação da infecção ZIKV com anomalias congênitas, mulheres grávidas, tentando engravidar, ou os parceiros dessas mulheres devem minimizar significativamente sua exposição laboratorial para ZIKV. Transporte de amostras ZIKV é classificado nos EUA como categoria B substâncias biológicas em conformidade com o departamento de transporte perigosos materiais regulamentos (49 CFR parte 171-180) e, portanto, amostras do transporte devem aderir aos diretrizes. Importação para os Estados Unidos da ZIKV biospecimens requer um centros para controle de doenças e prevenção (CDC) autorização de importação. Importação de qualquer artrópodes que poderia servir como um vetor para a transmissão de ZIKV, mesmo se eles não estão infectados, exige uma autorização do departamento de agricultura dos Estados Unidos (USDA). Esta informação é atual no momento da publicação. Recomendações atualizadas podem ser encontradas em https://www.cdc.gov/zika/laboratories/lab-safety.html.

Nota: RT-lâmpada reações são propensas a taxas mais elevadas de reações falso-positivas, assim que devem ser tomadas precauções no planejamento experimental. Todos os set-up e execução de reações RT-lâmpada devem usar pipetas designadas e filtro dicas. Idealmente, deve ser estabelecido um fluxo de trabalho lateral. Se possível, a análise e imaging (secção 5) devem ocorrer em uma sala fechada para evitar a contaminação. Abertura dos tubos de ensaio contendo produtos de RT-lâmpada deve ser mantida a um mínimo.

1. RT-lâmpada Primer preparação

  1. Reconstitua cada cartilha RT-lâmpada liofilizada em água de grau molecular para uma concentração final de 100 µM (tabela 1). Brevemente o vórtice da solução de primer para garantir uma solução homogénea e brevemente spin para baixo a solução na velocidade máxima em uma centrífuga de mesa para coletar toda solução da primeira demão.
  2. Preparar um 10 x RT-lâmpada Primer Mix dos primers FIP, BIP, F3, B3, se e LB usando os volumes na tabela 2. Brevemente o vórtice da solução de primer para garantir uma solução homogênea e brevemente spin para baixo a solução na velocidade máxima em uma centrífuga de mesa para evitar qualquer perda.
    Nota: O primer RT-lâmpada para actina Ae. aegypti (AEDAE) não contém um primer LB (loop primers nem sempre são necessárias para as reações de RT-lâmpada). Neste caso, substitua o volume da primeira demão LB água molecular da classe.
  3. Armazenar os primers a-20 ° C entre utilizações e evitar ciclos de degelo-livre.

2. preparação da amostra

  1. Para amostras de urina humana: Use a urina fresca, congelada de urina ou urina no conservante. Para amostras frescas ou congeladas: imediatamente girar a amostra após a coleta por 10 min a 700 x ge usar o sobrenadante para análise ou congelar a-80 ° C para uso futuro. Descongele as amostras congeladas no gelo antes de usar.
  2. Para amostras de soro humano: Use também amostras de soro fresco ou congelado.
  3. Para ZIKV infectado linhas celulares: usar mídia condicionadas ou lisados celulares.
    Nota: Sem célula condicionado mídia de Ae. albopictus C6/36 células 8 dias pós infecção pode ser usado como controles positivos para reações ZIKV RT-lâmpada.
  4. Para mosquitos Ae. aegypti : usar carcaças ou mosquito inteiro fresco ou congelado. Descongele os mosquitos congelados no gelo. Preparar um mosquito bruto lisado colocando um mosquito individual em 100 µ l de tampão fosfato salino (PBS) e homogeneizar, esmagando o mosquito 10 vezes com uma ponta da pipeta P10 (Figura 1). Brevemente centrifugar o bruto lisado de quaisquer detritos de Pelotas. Use o sobrenadante para análise de RT-lâmpada a jusante.
    Nota: Controlos positivos podem ser gerados em uma configuração de laboratório infectando mosquitos fêmeas utilizando microinjeção intratorácicos com aproximadamente 103 equivalentes de genoma do vírus em um volume de 200 nL e colheita o mosquito 5 dias pós-infecção.

3. prepare o RT-lâmpada Master Mix

  1. Prepare uma reação de mistura mestre RT-lâmpada no gelo para cada primeira demão definida para ser usado por meio de guia volume na tabela 3.
    Nota: O uso de termolábil Uracil DNA Glycosylase (UDG) auxilia na prevenção de falsos positivos.
  2. Vórtice brevemente para garantir que todas as amostras são bem misturadas, então spin para baixo rapidamente para evitar a perda de volume.

4. ensaio de RT-lâmpada

  1. Pipeta 23,0 µ l do mix mestre RT-lâmpada por reação em um tubo PCR de 200 µ l. Adicione 2,0 µ l de amostra (urina, soro ou sobrenadante lisado de mosquito bruto conforme descrito na etapa 2). Isto trará o volume total a 25,0 µ l por reação de RT-lâmpada. Para o controle negativo, use água de grau molecular. Inclua um controlo positivo.
    Nota: Uma PCR padrão ou vírus as existências do sobrenadante de linhas de células infectadas podem ser usado como controle positivo.
    1. Opcional: Inclua uma reação de controle de especificidade de um arbovírus relacionados tais como o vírus da dengue (DENV). Prepare a amostra conforme descrito na etapa 2 de acordo com o tipo de amostra. Adicione 2,0 µ l de controlo a especificidade a 23.0 µ l do mix mestre RT-lâmpada para um tubo de PCR de 200 µ l.
  2. As amostras a 61 ° C durante 30 minutos usando um bloco de calor, banho de água ou thermocycler do calor.
  3. Calor desactivar o polymerase por aquecimento a 80º C por 10 min.

5. análise de RT-lâmpada

Nota: Execute análise de RT-lâmpada num espaço separado e fechado.

  1. Após a incubação, acessar reações RT-lâmpada visualmente, procurando a presença de uma alteração de cor.
    1. Dilua o fluorescente ácido nucleico tintura 01:10 em tampão TAE (40 mM Tris, ácido acético de 20 mM, 1 mM EDTA).
      Atenção: Qualquer mancha de ácido nucleico vincula aos ácidos nucleicos e, portanto, é uma substância cancerígena. Use luvas ao manusear.
    2. A 12 µ l da reação de RT-lâmpada, adicione 2 µ l da diluição do corante fluorescente do ácido nucleico.
      Nota: Reações negativas será laranja na cor e reações positivas será na cor verde/amarelo.
    3. Opcional: Tirar fotos de reações RT-lâmpada sobre um fundo branco usando uma câmera.
  2. Coloca as amostras sob 302 nm UV luz para confirmar a presença de produtos de RT-lâmpada por fluorescência. Tire foto do resultado usando uma câmera.
    Nota: Reações positivas RT-lâmpada terá uma saída fluorescente.
    Cuidado: Use escudo de googles ou rosto de olho protetor UV quando trabalhar com luz UV.
  3. Opcional: Confirme a presença de RT-lâmpada produtos por meio de eletroforese em gel de amostras.
    1. Despeje um gel de agarose 2% em 1 x TAE buffer com uma mancha de ácidos nucleicos para visualização.
      Atenção: Qualquer mancha de ácido nucleico vincula aos ácidos nucleicos e, portanto, é uma substância cancerígena. Use luvas ao manusear.
    2. Adicione 5 µ l de uma escada de DNA a primeira pista para comparar os pesos moleculares.
    3. Para cada reação de RT-lâmpada, misture 13 µ l da mistura de reação de RT-lâmpada com 2 µ l de DNA tintura de carregamento. Carrega a mistura de 15 µ l contendo o DNA de tintura de carregamento.
    4. Execute o gel em 90 V por 90 min ou até que as bandas são separadas e imagem com a luz de UV 302 nm.
      Nota: Reações positivas RT-lâmpada terá um padrão de laddering. Reações negativas RT-lâmpada não devem conter nenhuma banda.

6. eliminação

  1. Descarte de reações RT-lâmpada em sacos selados duplos. Fazer não Autoclavar o que isso pode aerosolize os produtos RT-lâmpada, levando a reações falso-positivas no futuro.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Reações de RT-lâmpada podem ser analisadas usando três métodos diferentes. Primeiro, com a adição de um corante fluorescente de ácidos nucleicos, reações positivas será na cor verde/amarelo onde reações negativas aparecerão laranja na cor a olho nu. Em segundo lugar, a adição do corante para reação de RT-lâmpada fluorescente de ácidos nucleicos resulta em um sinal fluorescente quando as amostras são excitadas pela luz UV. Reações negativas não terá um sinal fluorescente detectável sobre qualquer fluorescência de fundo que pode estar presente em pequenas quantidades no controle negativo. Por último, as reações de RT-lâmpada podem ser executadas para fora em um gel de agarose. Reações positivas RT-lâmpada terá um padrão de bandas, Considerando que reações negativas terão sem bandas de DNA. Exemplos desta usando todos os três destes métodos de análise são demonstrados na Figura 2 e 3. Nenhuma destas amostras tinha RNA isolado antes da RT-lâmpada. A Figura 1 demonstra o esmagamento de um mosquito inteiro em PBS, que é suficiente para o uso na reação de RT-lâmpada. Na Figura 2, é demonstrada a especificidade da reação ZIKV RT-lâmpada: somente o controle ZIKV molecular, não o controle molecular DENV ou controlo negativo, tem uma reação positiva do RT-lâmpada. Além disso, ZIKV é detectado na urina e soro de um paciente com infecção de ZIKV conhecida, mas não no paciente assintomático controle sem infecção ZIKV(Figura 2). Na Figura 2B, as amostras são testadas para humano 18s rRNA usando RT-lâmpada. Apenas as amostras de pacientes (urina ou soro), mas não os controles moleculares ou o controlo negativo, são positivas para 18s rRNA. Portanto, 18s rRNA RT-lâmpada pode ser usada como um controle de qualidade para reações de RT-lâmpada para as amostras de pacientes humanos. Amostras de mosquito podem ser testadas da mesma forma para o ZIKV ou a RT-lâmpada de controle de qualidade, a AEDAE (Figura 3). Neste exemplo, o controle molecular positivo para ZIKV, bem como o mosquito infectado com ZIKV são positivos para ZIKV. O controle negativo, o controle molecular do DENV, a simulação infectado o mosquito (mosquito injetada com meios de cultura de células que contém nenhum vírus), e o mosquito DENV infectado são todos negativos para ZIKV(Figura 3). No entanto, todos os mosquitos são positivos para AEDAE por RT-lâmpada (Figura 3B).

Quando possível, todos os três métodos analíticos devem ser usados para confirmar uma reação positiva ou negativa, pois às vezes o sinal fluorescente pode ser fraco e alguns indivíduos podem ser daltônico, dificultando a mudança de cor visual determinar. Nos casos em que o controlo negativo positivo, todo o conjunto de amostras testadas é inválido como contaminação e, portanto, não podem ser descartados falsos positivos. Nos casos em que o controlo positivo negativo, todo o conjunto de amostras é inválido, como a reação de RT-lâmpada pode não ter funcionado. Esta é uma leitura qualitativa para fora, no entanto, mais cópias do vírus resultará num aumento dos produtos de RT-lâmpada que pode ser apreciado pela intensidade fluorescente ou pela intensidade do DNA da borda padrão por electroforese em gel.

Figure 1
Figura 1 : Preparação do mosquito crude lisado. (A) Coloque um mosquito em 100 µ l de PBS em um tubo de microcentrifugadora. (B) usando a ponta da pipeta P10, esmagar o mosquito contra os lados do tubo 10 vezes. (C) isto produz um lisado petróleo bruto que deve ser girado para baixo brevemente em uma centrífuga de mesa para detritos de Pelotas. Só o sobrenadante deve ser usado para reação de RT-lâmpada. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 : ZIKV e rRNA 18S RT-lâmpada em amostras de urina e soro pacientes. Amostras de urina ou soro de um paciente controle assintomáticos (C01) ou paciente ZIKV infectado (Z01) foram submetidas a um ZIKV (A) ou reações específicas do RT-lâmpada de 18S rRNA (B). Reações de RT-lâmpada foram visualizadas após a adição de um ácido nucleico fluorescente tintura por fluorescência de olho (painel superior), verde (painel central), ou gel de electroforese (painel inferior). Lane m: marcador em massa de DNA; NTC: Nenhum modelo controle (controle negativo); ZIKV: ZIKV PCR padrão controle positivo; DENV: Controlo positivo do DENV. Clique aqui para ver uma versão maior desta figura. 

Figure 3
Figura 3 : ZIKV e AEDAE RT-lâmpada em Ae. aegypti . Único Ae. aegypti infectados com controle simulado, ZIKV ou DENV foram submetidas à ZIKV (A) ou AEDAE (B) reações de RT-lâmpada específicas. Reações de RT-lâmpada foram visualizadas após a adição de um ácido nucleico fluorescente tintura por fluorescência de olho (painel superior), verde (painel central), ou gel de electroforese (painel inferior). Lane m: marcador em massa de DNA; NTC: Nenhum modelo controle (controle negativo); ZIKV: ZIKV PCR padrão controle positivo; DENV: Controlo positivo do DENV. Clique aqui para ver uma versão maior desta figura. 

Alvo Primeira demão Sequência (5' - 3')
Homo sapiens 18S rRNA 18SrRNA-FIP *
18SrRNA-BIP *
18SrRNA-F3
18SrRNA-B3
18SrRNA-se
18SrRNA-LB
TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG
GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG
GTTCAAAGCAGGCCCGAG
CCTCCGACTTTCGTTCTTGA
AGAACCGCGGTCCTATTCCATTATT
ATTCCTTGGACCGGCGCAAG
ZIKV ZIKV-FIP *
ZIKV-BIP *
ZIKV-F3
ZIKV-B3
ZIKV-SE
ZIKV-LB
AACCTGAGGGCATGTGCAAACCGCGGTCAGTGGAGATGACT
CACAGGAGTGGAAACCCTCGACTGAAGTGGTGGGAGCAGAA
GCAGAGCAATGGATGGGATA
CCCATCCTTGAGGTACAGCT
TCGATTGGCTTCACAACGC
GGAGCAATTGGGAAGAAGTCC
Ae. aegypti actina Ae21-FIP *
Ae21-BIP *
Ae21-se
Ae21-F3
Ae21-B3
TGCTTGGTCCCTGCCTGGGAGACAGCCCACCAGAACGA
GAGACGAGAACGGCCCAGCGGGTCTGGTGTGTGTCTTTG
ACCGCAAGGCCAAGAACCG
CGGCGCCACCACAAGA
TCGTGCCTGTGTTTGTCG
* Primers devem ser purificados por cromatografia líquida de alta performance rápida (HPLC). Para todos os outros primers, condições do desalting padrão são suficientes.

Tabela 1: Primer sequências para reações de lâmpada-RT. Sequências da primeira demão são originalmente descritas no anterior publicação6.

Volume (µ l) Primeira demão Concentração das ações (µM) Concentração final (µM)
80 Encaminhar a cartilha interna (FIP) 100 16
80 Primeira demão interna para trás (BIP) 100 16
10 Encaminhar o Primer exterior (F3) 100 2
10 Primer exterior para trás (B3) 100 2
20 Loop para a frente (LF) 100 4
20 Laço para trás (LB) 100 4
280 água de grau molecular - -
500 Total

Tabela 2: preparação de 10 x RT-lâmpada Primer Mix. O primer de RT-lâmpada para Ae. aegypti actina não contiver uma cartilha BF; Substitua este volume com água.

1 x Volume (µ l) Componente de Conc. final Para 25 µ l Volume
2.5 10 x amplificação Isothermic Buffer 1 x
1.8 100 mM dU/A/T/C/GTPs 1.4 mM
2.0 100mm MgSO4 6 mM + 2mm no buffer = 8 mM [intervalo de 4-10 mM]
2.5 10 x de Primers 1.6 ΜM FIP/BIP, 0,2 ΜM F3/B3, 0,4 ΜM FL/BL
1.0 termofílicas DNA polimerase com deslocamento de vertente (8.000 U/mL) 8 U
0,5 Transcriptase reversa (15.000 U/mL) 7.5 U
0,5 UDG (1.000 U/mL) 0,5 U
12.3 água de grau molecular -
23,0 Total

Tabela 3: Preparação de RT-lâmpada Master Mix.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

O ensaio de ZIKV RT-lâmpada descrito neste papel de trabalhos usando tanto humanos como mosquito amostras6. O limite de detecção foi de aproximadamente 1 genoma equivalente6, que devem ser suficientes, desde que a carga viral típica de um paciente ZIKV infectado sintomático é 103 a 106 PFU/mL7. Além disso, este método pode detectar ZIKV em amostras sem primeiro isolamento de RNA e sem amplificação do vírus em cultura de células. Isso diminui significativamente o tempo, custo e riscos para a saúde deste teste comparado com qRT-PCR.

Amostras de urina usadas na relação do volume indicada no presente protocolo devem permitir que reações de RT-lâmpada ocorrer sem um isolamento de RNA. Enquanto um teoricamente poderia aumentar a quantidade de amostra utilizada em uma reação de RT-lâmpada, deve ter cuidado quando esta amostra é urina. Urina contém várias substâncias químicas que podem inibir as reações de PCR; ureia na urina é conhecida para degradar as polimerases8 e usar uma relação urina/RT-lâmpada reação muito alto irá impedir a reação de RT-lâmpada. Se uma baixa quantidade de vírus é esperada, que seria melhor realizar um isolamento do RNA usando um kit específico para a urina. Da mesma forma, o soro pode conter inibidores PCR que podem inibir RT-lâmpada quando o soro é usado em um maior volume8.

Incluídos neste protocolo é a inclusão de controles de qualidade para reações de RT-lâmpada, semelhante a um controle de carregamento em protocolos mancha ocidentais. Se uma amostra clínica é negativa para o controle de qualidade de RT-lâmpada, uma reação negativa para a RT-lâmpada de ZIKV pode ser um falso negativo, como a amostra pode conter uma quantidade elevada de inibidores do PCR ou baixas quantidades de RNA total. Não é necessário isolar o RNA da amostra antes do ensaio de RT-lâmpada. Os resultados de RT-lâmpada representativos neste protocolo foram obtidos sem isolamento de RNA. No entanto, isolamento de RNA pode melhorar a detecção em amostras com carga baixa vírus ou que podem conter níveis elevados de inibidores da PCR. Para a maioria dos tipos de amostra incluindo soro, um kit de isolamento de RNA pode ser usado a seguir o protocolo sugerido pelo fabricante. Para amostras de urina, deve ser usado um kit de isolamento de RNA específico para amostras de urina. Para amostras de mosquito, é aconselhável lyse o mosquito executando o mosquito em 100 µ l de PBS através de uma coluna de destruição por 2 min em velocidade máxima ou douncing antes de isolamento de RNA. RNA pode ser eluído em 30 µ l de tampão de eluição e armazenado a-80 ° C até o uso.

Isolação do RNA é então sugerida para remover os inibidores endógenos de PCR ou concentrar o RNA antes da RT-lâmpada. Se o controle de qualidade de RT-lâmpada é ainda negativo, qRT-PCR deve ser usado para a deteção de ZIKV.

Os primers RT-lâmpada neste protocolo foram confirmados para trabalhar em uma faixa de temperaturas (57 a 65 ° C) e incubação vezes (8-60 min), bem como usando não convencionais fontes de aquecimento (EG., aquecedor sem chama ração, banho de água) fora padrão condições de laboratório. Todas as temperaturas testadas deram resultados comparáveis. Baseado na detecção de mudança de cor visual sozinha, o tempo ideal para a detecção de produtos de ZIKV RT-lâmpada foi 30 min. No entanto, a deteção por excitação de luz UV ou padrões em geles de borda foram positivos com tão pouco como 8 min tempo de incubação no total. Alguns protocolos de RT-lâmpada incluem DMSO, mas no presente protocolo, pode resultar na inibição da reação de RT-lâmpada. Usando um termofílicas polymerase de ADN que pode ser configurado em temperatura ambiente pode ter vantagens sobre o selvagem-tipo termofílicas DNA polimerase incluindo sinais de amplificação mais rápidos e tem maior estabilidade na temperatura de quarto9,10 . Brometo de etídio pode ser usado em vez disso, para visualização de ácidos nucleicos em gel de agarose 2%, no entanto, outros corantes fluorescentes de ácidos nucleicos para gel de agarose têm menor potencial mutagénico, tornando-os uma escolha mais segura. No entanto, as precauções de segurança adequadas, tais como luvas ainda devem ser usadas.

Uma limitação do presente protocolo é que é um qualitativo e não uma técnica quantitativa, no entanto, a quantificação relativa pode ser feita às6. Além disso, as primeiras demão RT-lâmpada são altamente específicas e foram projetadas contra uma sequência altamente conservada das proteínas nonstructural 5 de ZIKV que é encontrada em 16 cepas e verificado para trabalhar pelo menos 5 estirpes6. É possível que mutações extensas para ZIKV na natureza não podem ser detectáveis por estas primeiras demão no futuro. Outros grupos também desenvolveram novas tecnologias para a detecção de ZIKV que possam ser de interesse11,12,13,14,15,16,17 .

Em resumo, este protocolo fornece um método rápido, simples e econômico para ZIKV em uma variedade de tipos de amostras que não requer equipamento especializado. Isto fornece uma nova ferramenta de diagnóstica para a deteção de ZIKV em que a RNA não tem que ser isolado antes da reação de RT-lâmpada.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

LEL e MBC tem propriedade intelectual sobre os métodos de diagnóstico de vírus Zika. Os restantes autores têm sem interesses concorrentes.

Acknowledgments

Este trabalho foi financiado pelo Instituto de Neurociências de campo, St. Mary de Michigan e Maureen e Ronald Hirsch família contribuição filantrópica. Os financiadores não tinham qualquer papel no projeto de estudo, coleta de dados e análise, a decisão de publicar ou preparação do manuscrito. Agradecemos também Dr. Bernadette Zwaans e Elijah Ward para sua revisão crítica do manuscrito.

Materials

Name Company Catalog Number Comments
Bst 2.0 WarmStart DNA polymerase New England Biolabs M0537S
Isothermal Amplification Buffer  New England Biolabs B0537S
WarmStart RTx Reverse Transcriptase New England Biolabs M0380S
Antarctic Thermolabile UDG New England Biolabs M0372S
MgSO4 New England Biolabs B1003S
100 mM dATP Solution New England Biolabs N0440S Deoxynucleotide Set N0446S
100 mM dCTP Solution New England Biolabs N0441S Deoxynucleotide Set N0446S
100 mM dTTP Solution New England Biolabs N0443S Deoxynucleotide Set N0446S
100 mM dGTP Solution New England Biolabs N0442S Deoxynucleotide Set N0446S
100 mM dUTP Solution Thermo Fisher Scientific R0133
SYBR Green I Nucleic Acid Gel Stain Invitrogen S7563
Nancy-520 Sigma Aldrich 01494
Low DNA Mass Ladder Invitrogen 10-068-013
Zika Postive Control Robert Koch Institute, Germany N/A
Agarose Thermo Fisher Scientific BP1600
BlueJuice Gel Loading Buffer Invitrogen 10816015
Primers Integrated DNA Technologies Custom Oligo
Nuclease-Free Water Ambion AM9938
Urine Preservative Norgen Biotek 18126
ZIKV PCR Standard Robert Koch Institute N/A Vero E6 cell supernatants
DENV2 New Guinea C Control Connecticut Agricultural Experiment Station N/A

DOWNLOAD MATERIALS LIST

References

  1. Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. Zika Virus. New England Journal of Medicine. 374, (16), 1552-1563 (2016).
  2. Francois, P., et al. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. Federation of European Microbiological Societies Immunology and Medical Microbiology. 62, (1), 41-48 (2011).
  3. Tomita, N., Mori, Y., Kanda, H., Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols. 3, (5), 877-882 (2008).
  4. Gandasegui, J., et al. The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis. Public Library of Science Neglected Tropical Diseases. 9, (7), 0003963 (2015).
  5. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. The Journal of Visualized Experiments. (96), (2015).
  6. Lamb, L. E., et al. Rapid Detection of Zika Virus in Urine Samples and Infected Mosquitos by Reverse Transcription-Loop-Mediated Isothermal Amplification. Scientific Reports. 8, (1), 3803 (2018).
  7. Faye, O., et al. One-step RT-PCR for detection of Zika virus. Journal of Clinical Virology. 43, (1), 96-101 (2008).
  8. Schrader, C., Schielke, A., Ellerbroek, L., Johne, R. PCR inhibitors - occurrence, properties and removal. Journal of Applied Microbiology. 113, (5), 1014-1026 (2012).
  9. Poole, C. B., Tanner, N. A., Zhang, Y., Evans, T. C., Carlow, C. K. Diagnosis of brugian filariasis by loop-mediated isothermal amplification. Public Library of Science Neglected Tropical Diseases. 6, (12), 1948 (2012).
  10. Tanner, N. A., Zhang, Y., Evans, T. C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques. 53, (2), 81-89 (2012).
  11. Chan, K., et al. Rapid, Affordable and Portable Medium-Throughput Molecular Device for Zika Virus. Scientific Reports. 6, 38223 (2016).
  12. Lee, D., et al. Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays. Analytical Chemistry. 88, (24), 12272-12278 (2016).
  13. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, (5), 1255-1266 (2016).
  14. Song, J., et al. Instrument-Free Point-of-Care Molecular Detection of Zika Virus. Analytical Chemistry. 88, (14), 7289-7294 (2016).
  15. Yaren, O., et al. Point of sampling detection of Zika virus within a multiplexed kit capable of detecting dengue and chikungunya. BioMed Central Infectious Diseases. 17, (1), 293 (2017).
  16. Wang, X., et al. Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification. Journal of Virological Methods. 238, 86-93 (2016).
  17. Priye, A., et al. A smartphone-based diagnostic platform for rapid detection of Zika, chikungunya, and dengue viruses. Scientific Reports. 7, 44778 (2017).
Reverter a transcrição Loop-mediada por amplificação isotérmica (RT-lâmpada) ensaio para vírus Zika e Housekeeping Genes em amostras de Mosquito, soro e urina
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).More

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter