Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Omvänd Transkription-Loop-medierad isotermiska amplifiering (RT-lampa) analys för Zika Virus och städning gener i urin, Serum och Mosquito Samples

doi: 10.3791/58436 Published: September 14, 2018

Summary

Detta protokoll ger en effektiv och billig metod för att upptäcka zikavirus eller styra mål i mänsklig urin och serum prover eller myggor genom omvänd Transkription loop-medierad isotermiska amplifiering (RT-lampa). Denna metod kräver inte RNA isolering och kan göras inom 30 min.

Abstract

Infektion med zikaviruset (ZIKV) kan vara asymtomatisk hos vuxna, men infektion under graviditet kan leda till missfall och allvarliga neurologiska missbildningar. Målet med detta protokoll är att snabbt upptäcka ZIKV i både mänskliga och mygga prover. Den nuvarande guldmyntfoten för ZIKV upptäckt är kvantitativa omvänd Transkription PCR (qRT-PCR); omvänd Transkription loop-medierad isotermiska amplifiering (RT-lampa) kan möjliggöra en mer effektiv och kostnadseffektiv testning utan behovet av dyrbar utrustning. I denna studie används RT-lampa för ZIKV upptäckt i olika biologiska prover inom 30 min, utan första isolera RNA från provet. Denna teknik demonstreras med ZIKV infekterad patient urin och serum, och infekterad mygga prover. 18s ribosomal ribonukleinsyra och aktin används som kontroller i mänskliga och mygga prover, respektive.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Under 2015 fick zikavirus (ZIKV) framträdande global uppmärksamhet som en infektionssjukdom i oro eftersom infektion under graviditet länkades till missfall, dödfödsel, allvarliga neurologiska missbildningar inklusive mikrocefali, liksom andra medfödda fosterskador1. I sällsynta fall har ZIKV associerats med Guillain-Barrés syndrom. ZIKV överförs huvudsakligen via Aedes myggor; Det kan dock också spridas genom sexuell kontakt1. Med tanke på att infektionen med ZIKV är asymtomatiska i de flesta eller presenterar med milda influensaliknande symtom som överlappar med symtom på infektion i andra arborviruses1, fanns det ett behov av förbättrade metoder för snabb och kostnadseffektiv påvisande av ZIKV till skärmen personer såväl som lokala mygga populationer.

Kvantitativa omvänd Transkription PCR (qRT-PCR) är en pålitlig analys för ZIKV upptäckt; Denna teknik kräver dock dyr specialutrustning, utbildad personal och RNA isolering från provet av intresse. Omvänd Transkription loop-medierad isotermiska amplifiering (RT-lampa) är en one-step nukleinsyra förstärkning metod baserad på PCR-teknik som endast kräver en inkubation temperatur på grund av användning av en termofila DNA-polymeras med strand deplacement egenskaper. Detta kringgår behovet av en termocykler och minskar tiden som krävs för att slutföra analysen. Ytterligare fördelar med RT-lampa inkluderar dess hög specificitet och känslighet, robusthet vid en rad pH-nivåer och temperaturer, och resistens mot många PCR-hämmare2. Den har en relativt låg kostnad och reagenser är stabila i rumstemperatur. Med tanke på dessa egenskaper, kan RT-lampa distribueras i ett laboratorium eller i fält. Som sådan, har lampa reaktioner utvecklats för att upptäcka ett utbud av patogener och andra typer av infektion3,4,5. Målet med det RT-lampa-protokollet som beskrivs i detta dokument är att upptäcka ZIKV utan RNA isolering i humant serum och urin prover samt som i en enda infekterad mygga inom 30 min genom RT-lampa. Denna metod kan användas för att ersätta qRT-PCR eftersom det är en känslig, snabba diagnostiska verktyg som fungerar snabbt och i inställningar utanför laboratoriet.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alla metoderna som beskrivs här har godkänts av den institutionella granskning Board (IRB) av Beaumont hälsa. Alla experimenten utfördes i enlighet med tillämpliga riktlinjer och förordningar.

Varning: Alla potentiellt smittsamt ska hanteras enligt biosäkerhetsnivå 2 standarder inklusive användning av personlig skyddsutrustning. Någon som kan producera aerosol bör utföras i en biosäkerhet skåp. Arbete med levande myggor skall dessutom utföras i lämplig leddjur inneslutning nivå 1-3 anläggningen. Med tanke på anslutningen av ZIKV infektion med medfödda missbildningar, bör kvinnor som är gravid, försöker bli gravid, eller partner för dessa kvinnor avsevärt minimera deras Laboratorieexponering för ZIKV. Transport av ZIKV prover klassificeras i Sverige som kategori B biologiska ämnen enligt Department of transport farliga material Regulations (49 CFR del 171-180) och därför frakt prover ska följa de riktlinjer. Import till de Förenta staterna av ZIKV biospecimens kräver en Centers for Disease Control och Prevention (CDC) importtillstånd. Import av någon leddjur som kunde tjäna som en vektor för ZIKV överföring, även om de inte är infekterade, kräver USA Department of Agriculture (USDA) tillstånd. Denna information är aktuell vid tidpunkten för offentliggörandet. Uppdaterade rekommendationer kan hittas på https://www.cdc.gov/zika/laboratories/lab-safety.html.

Obs: RT-lampa reaktioner är benägna att högre andelen falskt positiva reaktioner, så försiktighetsåtgärder bör vidtas i experimentell planering. Alla uppställning och genomförande av RT-lampa reaktioner bör använda utsedda pipetter och filter tips. Helst bör en lateral arbetsflöde fastställas. Om möjligt, bör analys och imaging (avsnitt 5) ske i ett separat slutna rum att förhindra kontaminering. Öppnandet av provrör innehållande RT-lampa produkter bör hållas till ett minimum.

1. RT-lampa Primer förberedelse

  1. Bered varje frystorkad RT-lampa primer i vatten för molekylär användning till en slutlig koncentration på 100 µM (tabell 1). Kort vortex primer lösningen att säkerställa en homogen lösning och kort snurra ner lösningen vid maximal hastighet i en bordsskiva centrifug att samla alla primer lösning.
  2. Förbereda en 10 x RT-lampa Primer blandning av FIP, BIP, F3, B3, LF och LB primers hjälp volymerna i tabell 2. Kort vortex primer lösningen att säkerställa en homogen lösning, och kort snurra ner lösningen vid maximal hastighet i en bordsskiva centrifug att undvika förlust.
    Obs: RT-lampa primer för Ae. aegypti aktin (AEDAE) innehåller en LB primer (loop primers är inte alltid nödvändigt för RT-lampa reaktioner). I detta fall ersätta LB primer volymen med vatten för molekylär användning.
  3. Lagra primers vid-20 ° C mellan användningar och undvika gratis-tö cykler.

2. provberedning

  1. För mänsklig urinprover: Använd antingen färsk urin, frysta urin eller urin i konserveringsmedel. För färsk eller fryst prov: omedelbart snurra ner provet efter samlingen för 10 min vid 700 x g, och använda supernatanten för analys eller frysa vid-80 ° C för framtida bruk. Tina frysta prover på is före användning.
  2. För humant serumprover: Använd antingen färsk eller fryst serumprov.
  3. För ZIKV smittade cellinjer: använda luftkonditionerade medier eller cell lysates.
    Obs: Cell-free luftkonditionerade media från Ae. Albopictus C6/36 celler 8 dagar efter infektion kan användas som positiva kontroller för ZIKV RT-lampa reaktioner.
  4. För Ae. aegypti myggor: använder antingen hela färska eller frysta mygga slaktkroppar. Tina frysta myggor på is. Förbereda en rå mygga lysate genom att placera en enskilda mygga i 100 µL av fosfatbuffrad saltlösning (PBS) och homogenisera genom krossning mygga 10 gånger med P10 Pipettera spets (figur 1). Kort Centrifugera rå lysate till pellet eventuellt skräp. Använda supernatanten för nedströms RT-lampa analys.
    Obs: Positiva kontroller kan genereras i laboratoriemiljö genom att infektera kvinnliga myggor med intratorakalt Mikroskop med ca 103 genomet medel av virus i en volym på 200 nL och skörd mygga 5 dagar efter infektion.

3. Förbered RT-lampa Master Mix

  1. Förbereda en RT-lampa huvudmixen reaktion på is för varje grundfärg som ska användas genom att använda volym guide i tabell 3.
    Obs: Användningen av termolabila Uracil DNA glykosylas (UDG) hjälper att förhindra falska positiva.
  2. Vortex kort för att säkerställa att alla prover är väl blandade, snurra sedan ner kort för att förhindra volymförlust av.

4. RT-lampa Assay

  1. Pipettera 23,0 µL av RT-lampa huvudmixen per reaktion i en 200 µL PCR-röret. Tillsätt 2,0 µL prov (urin, serum eller rå mygga lysate supernatanten som beskrivs i steg 2). Detta tar den totala volymen till 25,0 µL per RT-lampa reaktion. För den negativa kontrollen, använda vatten för molekylär användning. Inkludera en positiv kontroll.
    Obs: En PCR-standard eller virus bestånd från supernatanten av infekterade cellinjer kan användas som positiv kontroll.
    1. Valfritt: Inkludera en specificitet kontroll reaktion av en relaterade arbovirus såsom denguefeber virus (DENV). Förbereda provet som beskrivs i steg 2 enligt Provtyp. Tillsätt 2,0 µL av kontrollen specificitet till 23,0 µL av RT-lampa huvudmixen i en 200 µL PCR-röret.
  2. Värm proverna vid 61 ° C i 30 min med en värme block, vattenbad eller termocykler.
  3. Värme inaktivera polymerasen genom uppvärmning till 80 ° C i 10 min.

5. RT-lampa analys

Obs: Utföra RT-lampa analys i ett separat, slutna utrymme.

  1. Efter inkubering, åt RT-lampa reaktioner visuellt genom att titta för förekomsten av en färgförändring.
    1. Späd den fluorescerande nukleinsyra dye 1:10 i TAE (40 mM Tris, 20 mM ättiksyra, 1 mM EDTA) buffert.
      Varning: Alla nukleinsyra fläcken binder till nukleinsyror och därför är cancerframkallande. Använd handskar vid hantering.
    2. Till 12 µL av RT-lampa reaktionen, tillsätt 2 µL av fluorescerande nukleinsyra dye utspädning.
      Obs: Negativa reaktioner blir orange i färgen och positiva reaktioner kommer att vara gul/grön färg.
    3. Valfritt: Ta bilder av RT-lampa reaktioner på en vit bakgrund med en kamera.
  2. Placera proverna i 302 nm UV-ljus för att bekräfta förekomsten av RT-lampa produkter genom fluorescens. Ta bild på resultatet med en kamera.
    Obs: Positiva RT-lampa reaktioner kommer att ha en fluorescerande utgång.
    FÖRSIKTIGHET: Bära UV skyddande öga googles eller ansikte sköld när du arbetar med UV-ljus.
  3. Tillval: Bekräfta förekomsten av RT-lampa produkter genom att utföra gelelektrofores på proverna.
    1. Häll en 2% agarosgel i 1 x TAE buffert med en nukleinsyra fläck för visualisering.
      Varning: Alla nukleinsyra fläcken binder till nukleinsyror och därför är cancerframkallande. Använd handskar vid hantering.
    2. Tillsätt 5 µL av en DNA-stege i första körfält att jämföra molekylvikt.
    3. För varje RT-lampa reaktion, blanda 13 µL av RT-lampa reaktionsblandningen med 2 µL av DNA lastning färgämne. Ladda 15 µL blandningen som innehåller DNA lastning färgämne.
    4. Kör gelen vid 90 V 90 min eller tills banden är separerade och bilden med 302 nm UV-ljus.
      Obs: Positiva RT-lampa reaktioner kommer att ha ett laddering mönster. Negativa RT-lampa reaktioner bör inte innehålla någon band.

6. avfallshantering

  1. Kassera RT-lampa reaktioner i dubbla förseglade påsar. Autoklavera inte eftersom detta kan aerosolize RT-lampa produkterna, vilket leder till falskt positiva reaktioner i framtiden.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

RT-lampa reaktioner kan analyseras med hjälp av tre olika metoder. Först, med tillägg av ett fluorescerande nukleinsyra färgämne, positiva reaktioner blir gulgrön färg var negativa reaktioner visas orange färg för blotta ögat. Andra tillägg av fluorescerande nukleinsyra färgämnet till RT-lampa reaktion resulterar i en fluorescerande signal när proverna exciteras av UV-ljus. Negativa reaktioner kommer inte ha en detekterbar fluorescerande signal över någon bakgrund fluorescens som kan finnas i små mängder i den negativa kontrollen. Slutligen kan RT-lampa reaktioner köras på en agarosgel. RT-lampa realitetreaktioner kommer att ha en banding mönster, medan negativa reaktioner kommer att ha någon DNA-band. Exempel på detta med alla tre av dessa analysmetoder demonstreras i figur 2 och 3. Ingen av dessa prover hade RNA isoleras innan RT-lampa. Figur 1 visar krossning av en hela mygga i PBS, vilket är tillräckligt för användning i RT-lampa reaktionen. I figur 2, specificitet ZIKV RT-lampa reaktionen demonstreras: endast ZIKV molekylär kontroll, inte DENV molekylär kontroll eller negativ kontroll, har en positiv reaktion i RT-lampa. Dessutom upptäcks ZIKV i både urin och serum hos en patient med känd ZIKV infektion, men inte hos asymtomatiska kontroll patienten utan ZIKV infektion (figur 2A). I figur 2B, proverna testas för mänskliga 18s rRNA med RT-lampa. Endast proverna från patienter (urin eller serum), men inte de molekylära kontrollerna eller den negativa kontrollen, är positivt för 18s rRNA. Därför 18s rRNA RT-lampa kan användas som en kvalitetskontroll för RT-lampa reaktioner för prover från mänskliga patienter. Mygga prover kan testas på samma sätt för ZIKV eller RT-lampa kvalitetskontroll, AEDAE (figur 3). I det här exemplet är den positiva molekylära kontrollen för ZIKV samt mygga infekterade med ZIKV positivt för ZIKV. Den negativa kontrollen, molekylär kontroll för DENV, mock infekterad mygga (mygga microinjected med cell kultur media som innehåller inget virus), och DENV infekterad mygga är alla negativa för ZIKV (figur 3A). Men är alla myggor positivt för AEDAE av RT-lampan (figur 3B).

När det är möjligt bör alla tre analytiska metoder användas för att bekräfta en positiv eller negativ reaktion som ibland fluorescerande signalen kan vara svag och vissa individer kan vara färgblind, att göra visuella färgen förändras svårt att avgöra. I fall där den negativa kontrollen är positiva, hela den uppsättning av prov är ogiltig som förorening och därför falsklarm kan inte uteslutas. I fall där den positiva kontrollen är negativa, är hela den uppsättning av prover ogiltig eftersom den RT-lampa reaktionen inte kan har fungerat. Detta är en kvalitativ läsning ut, dock högre kopior av viruset kommer att resultera i en ökning av RT-lampa produkter som kan uppskattas av fluorescerande intensitet eller intensiteten i DNA banding mönster med gelelektrofores.

Figure 1
Figur 1 : Beredning av mygga råolja lysate. (A) plats en mygga i 100 µL av PBS i en mikrocentrifug rör. (B) använda en P10 Pipettera spets, krossa mygga mot sidorna av röret 10 gånger. (C) Detta ger en råolja lysat som bör vara spunnen ner kort i en bordsskiva centrifug till pellet skräp. Endast supernatanten bör användas för RT-lampa reaktion. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : ZIKV och 18S rRNA RT-lampa i urin och serum patientprover. Urin eller serum prover från en asymtomatisk kontroll patient (C01) eller ZIKV infekterad patient (Z01) utsattes för en ZIKV (A) eller 18S rRNA (B) särskilda RT-lampa reaktioner. RT-lampa reaktioner var visualiserat efter tillägg av en fluorescerande nukleinsyra färga av ögat (övre panel), grön fluorescens (mellersta panelen) eller gel elektrofores (nedre panelen). Lane M: DNA massa markör; NTC: Ingen mall kontroll (negativ kontroll); ZIKV: ZIKV PCR Standard positiv kontroll; DENV: DENV positiv kontroll. Klicka här för att se en större version av denna siffra. 

Figure 3
Figur 3 : ZIKV och AEDAE RT-lampa i AE. aegypti . Enda Ae. aegypti infekterade med mock kontroll, ZIKV eller DENV utsattes för ZIKV (A) eller AEDAE (B) särskilda RT-lampa reaktioner. RT-lampa reaktioner var visualiserat efter tillägg av en fluorescerande nukleinsyra färga av ögat (övre panel), grön fluorescens (mellersta panelen) eller gel elektrofores (nedre panelen). Lane M: DNA massa markör; NTC: Ingen mall kontroll (negativ kontroll); ZIKV: ZIKV PCR Standard positiv kontroll; DENV: DENV positiv kontroll. Klicka här för att se en större version av denna siffra. 

Mål Primer Sekvens (5' - 3')
Homo sapiens 18S rRNA 18SrRNA-FIP *
18SrRNA-BIP *
18SrRNA-F3
18SrRNA-B3
18SrRNA-LF
18SrRNA-LB
TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG
GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG
GTTCAAAGCAGGCCCGAG
CCTCCGACTTTCGTTCTTGA
AGAACCGCGGTCCTATTCCATTATT
ATTCCTTGGACCGGCGCAAG
ZIKV ZIKV-FIP *
ZIKV-BIP *
ZIKV-F3
ZIKV-B3
ZIKV-LF
ZIKV-LB
AACCTGAGGGCATGTGCAAACCGCGGTCAGTGGAGATGACT
CACAGGAGTGGAAACCCTCGACTGAAGTGGTGGGAGCAGAA
GCAGAGCAATGGATGGGATA
CCCATCCTTGAGGTACAGCT
TCGATTGGCTTCACAACGC
GGAGCAATTGGGAAGAAGTCC
AE. aegypti aktin Ae21-FIP *
Ae21-BIP *
Ae21-LF
Ae21-F3
Ae21-B3
TGCTTGGTCCCTGCCTGGGAGACAGCCCACCAGAACGA
GAGACGAGAACGGCCCAGCGGGTCTGGTGTGTGTCTTTG
ACCGCAAGGCCAAGAACCG
CGGCGCCACCACAAGA
TCGTGCCTGTGTTTGTCG
* Primers bör renas genom snabba högpresterande vätskekromatografi (HPLC). För alla andra grundfärger är avsaltning standardvillkor tillräckliga.

Tabell 1: Primer sekvenser för RT-lampa reaktioner. Primer-sekvenser är ursprungligen beskrevs i föregående publikation6.

Volym (µL) Primer Beståndet koncentration (µM) Slutlig koncentration (µM)
80 Fram inre Primer (FIP) 100 16
80 Bakåt inre Primer (BIP) 100 16
10 Fram yttre Primer (F3) 100 2
10 Bakåt yttre Primer (B3) 100 2
20 Loop framåt (LF) 100 4
20 Loop bakåt (LB) 100 4
280 vatten för molekylär användning - -
500 Totalt

Tabell 2: beredning av 10 x RT-lampa Primer Mix. RT-lampa primer för Ae. aegypti aktin innehåller inte en BF primer; ersätta denna volym med vatten.

1 x volym (µL) Komponent Slutliga konc. För 25 µL volym
2.5 10 x Prolab förstärkning buffert 1 x
1.8 100 mM dU/A/T/C/GTPs 1.4 mM
2.0 100 mM MgSO4 6 mM + 2 mM i buffert = 8 mM [4-10 mM sortiment]
2.5 10 x grundfärger 1.6 ΜM FIP/BIP, 0,2 ΜM F3/B3, 0,4 ΜM FL/BL
1.0 Termofila DNA-polymeras med strand deplacement (8000 U/mL) 8 U
0,5 Omvänt transkriptas (15.000 U/mL) 7,5 U
0,5 UDG (1000 U/mL) 0,5 U
12.3 vatten för molekylär användning -
23,0 Totalt

Tabell 3: Beredning av RT-lampa Master Mix.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ZIKV RT-lampa analysen beskrivs i detta papper fungerar med både mänskliga och mygga prover6. Detektionsgränsen var cirka 1 genome motsvarande6, som bör vara tillräcklig eftersom den typiska virusmängden av en symtomatisk ZIKV infekterad patient är 103 till 106 PFU/mL7. Denna metod kan dessutom upptäcka ZIKV i prover utan första isolera RNA och utan virus amplifiering i cellkultur. Detta minskar avsevärt den tid, kostnad och hälsorisker av denna analys jämfört med qRT-PCR.

Urinprov används på volymförhållandet anges i detta protokoll bör tillåta att RT-lampa reaktioner sker utan en RNA isolering. Medan man kan teoretiskt öka mängden prov som används i en RT-lampa reaktion, bör försiktighet iakttas när detta prov är urin. Urin innehåller flera kemikalier som skulle kunna hämma PCR reaktioner; urea i urinen är känt att försämra polymeraser8 och använda förhållandet urinen/RT-lampa reaktion som är för hög kommer att förhindra RT-lampa reaktion. Om en låg mängd virus förväntas, skulle det vara bättre att utföra en RNA isolering med ett kit för urin. Likaså kan serum innehåller PCR-hämmare som kan hämma RT-lampa när serum används vid en högre volym8.

I detta protokoll ingår införandet av kvalitetskontroller för RT-lampa reaktioner, besläktad med en lastning kontroll i western blotting protokoll. Om en klinisk provet är negativt för RT-lampa kvalitetskontroll, kan då en negativ reaktion för ZIKV RT-lampan vara ett falskt negativa provet kan innehålla höga halter av PCR-hämmare eller låga mängder total-RNA. Det är inte nödvändigt att isolera RNA från provet före RT-lampa analysen. Representativa RT-lampa resultaten i detta protokoll erhölls utan RNA isolering. Men RNA isolering kan förbättra upptäckten i prover med låga viruset laddar eller som kan innehålla höga halter av PCR-hämmare. För de flesta provtyper inklusive serum, kan ett RNA isolering kit användas efter tillverkarens föreslagna protokollet. För urinprov, bör ett RNA isolering kit specifika för urinprov användas. För mygga prover rekommenderas det att lysera mygga genom att köra mygga i 100 µL av PBS via en fragmentering kolumn för 2 min på högsta hastighet eller douncing innan RNA isolering. RNA kan elueras i 30 µL eluering buffert och lagras vid-80 ° C fram till användning.

RNA isolering föreslås sedan att ta bort de endogena PCR-hämmare eller koncentrera RNA före RT-lampa. Om RT-lampa kvalitetskontroll är fortfarande negativt, bör sedan qRT-PCR användas för identifiering av ZIKV.

RT-lampa primers i detta protokoll har bekräftats för att arbeta vid olika temperaturer (57-65 ° C) och inkubation gånger (8-60 min), samt att använda okonventionella värme källor (t.ex., Flamlös ranson värmare, vattenbad) utanför standard laboratorieförhållanden. Alla de temperaturer som testades gav jämförbara resultat. Den optimala tiden för detektion av ZIKV RT-lampa produkter bygger på detektion av visuella färgförändring ensam, och var 30 min. Påvisande av UV ljus excitation eller banding mönster på geler var dock positiv med så lite som 8 min totala inkubationstiden. Vissa RT-lampa protokoll inkluderar DMSO, men i detta protokoll, det kan leda till hämning av RT-lampa reaktionen. Med en termofila DNA-polymeras som kan sättas upp vid rumstemperatur kan ha fördelar jämfört med vildtyp termofila DNA-polymeras inklusive snabbare förstärkning signaler och har ökad stabilitet vid rumstemperatur9,10 . Etidiumbromid kan användas i stället för nukleinsyra visualisering i 2% agaros gel, andra fluorescerande nukleinsyra färgämnen för agaros gel har dock lägre mutationsframkallande egenskaper vilket gör dem ett säkrare val. Lämpliga säkerhetsåtgärder såsom handskar bör dock fortfarande användas.

En begränsning av detta protokoll är att det är en kvalitativ och inte en kvantitativ teknik, dock relativ kvantifiering kan göras6. Dessutom RT-lampa primers är mycket specifika och utformades mot en mycket sekvens av proteinet ickestrukturella 5 av ZIKV som finns i 16 stammar och verifierade för att arbeta i minst 5 stammar6. Det är möjligt att omfattande mutationer till ZIKV i vilt inte kan upptäckas av dessa grundfärger i framtiden. Andra grupper har också utvecklat ny teknik för detektion av ZIKV som kan vara av intresse11,12,13,14,15,16,17 .

Sammanfattningsvis ger det här protokollet en snabb, enkel och kostnadseffektiv metod för ZIKV i en mängd olika typer av prov som inte kräver specialutrustning. Detta ger ett nytt diagnostiskt verktyg för ZIKV upptäckt där inte behöver RNA isoleras innan RT-lampa reaktionen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

LEL och MBC har immateriella på Zika virus diagnos metoder. Återstående författarna har inga konkurrerande intressen.

Acknowledgments

Detta arbete stöds av Maureen och Ronald Hirsch familjen filantropiska bidrag och fältet neurovetenskap Institute, St Marys Michigan. Finansiärerna hade ingen roll i studiedesign, datainsamling och analys, beslut om att offentliggöra eller beredning av manuskriptet. Vi tackar också Dr Bernadette Zwaans och Elijah Ward för kritisk granskning av manuskriptet.

Materials

Name Company Catalog Number Comments
Bst 2.0 WarmStart DNA polymerase New England Biolabs M0537S
Isothermal Amplification Buffer  New England Biolabs B0537S
WarmStart RTx Reverse Transcriptase New England Biolabs M0380S
Antarctic Thermolabile UDG New England Biolabs M0372S
MgSO4 New England Biolabs B1003S
100 mM dATP Solution New England Biolabs N0440S Deoxynucleotide Set N0446S
100 mM dCTP Solution New England Biolabs N0441S Deoxynucleotide Set N0446S
100 mM dTTP Solution New England Biolabs N0443S Deoxynucleotide Set N0446S
100 mM dGTP Solution New England Biolabs N0442S Deoxynucleotide Set N0446S
100 mM dUTP Solution Thermo Fisher Scientific R0133
SYBR Green I Nucleic Acid Gel Stain Invitrogen S7563
Nancy-520 Sigma Aldrich 01494
Low DNA Mass Ladder Invitrogen 10-068-013
Zika Postive Control Robert Koch Institute, Germany N/A
Agarose Thermo Fisher Scientific BP1600
BlueJuice Gel Loading Buffer Invitrogen 10816015
Primers Integrated DNA Technologies Custom Oligo
Nuclease-Free Water Ambion AM9938
Urine Preservative Norgen Biotek 18126
ZIKV PCR Standard Robert Koch Institute N/A Vero E6 cell supernatants
DENV2 New Guinea C Control Connecticut Agricultural Experiment Station N/A

DOWNLOAD MATERIALS LIST

References

  1. Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. Zika Virus. New England Journal of Medicine. 374, (16), 1552-1563 (2016).
  2. Francois, P., et al. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. Federation of European Microbiological Societies Immunology and Medical Microbiology. 62, (1), 41-48 (2011).
  3. Tomita, N., Mori, Y., Kanda, H., Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols. 3, (5), 877-882 (2008).
  4. Gandasegui, J., et al. The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis. Public Library of Science Neglected Tropical Diseases. 9, (7), 0003963 (2015).
  5. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. The Journal of Visualized Experiments. (96), (2015).
  6. Lamb, L. E., et al. Rapid Detection of Zika Virus in Urine Samples and Infected Mosquitos by Reverse Transcription-Loop-Mediated Isothermal Amplification. Scientific Reports. 8, (1), 3803 (2018).
  7. Faye, O., et al. One-step RT-PCR for detection of Zika virus. Journal of Clinical Virology. 43, (1), 96-101 (2008).
  8. Schrader, C., Schielke, A., Ellerbroek, L., Johne, R. PCR inhibitors - occurrence, properties and removal. Journal of Applied Microbiology. 113, (5), 1014-1026 (2012).
  9. Poole, C. B., Tanner, N. A., Zhang, Y., Evans, T. C., Carlow, C. K. Diagnosis of brugian filariasis by loop-mediated isothermal amplification. Public Library of Science Neglected Tropical Diseases. 6, (12), 1948 (2012).
  10. Tanner, N. A., Zhang, Y., Evans, T. C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques. 53, (2), 81-89 (2012).
  11. Chan, K., et al. Rapid, Affordable and Portable Medium-Throughput Molecular Device for Zika Virus. Scientific Reports. 6, 38223 (2016).
  12. Lee, D., et al. Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays. Analytical Chemistry. 88, (24), 12272-12278 (2016).
  13. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, (5), 1255-1266 (2016).
  14. Song, J., et al. Instrument-Free Point-of-Care Molecular Detection of Zika Virus. Analytical Chemistry. 88, (14), 7289-7294 (2016).
  15. Yaren, O., et al. Point of sampling detection of Zika virus within a multiplexed kit capable of detecting dengue and chikungunya. BioMed Central Infectious Diseases. 17, (1), 293 (2017).
  16. Wang, X., et al. Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification. Journal of Virological Methods. 238, 86-93 (2016).
  17. Priye, A., et al. A smartphone-based diagnostic platform for rapid detection of Zika, chikungunya, and dengue viruses. Scientific Reports. 7, 44778 (2017).
Omvänd Transkription-Loop-medierad isotermiska amplifiering (RT-lampa) analys för Zika Virus och städning gener i urin, Serum och Mosquito Samples
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).More

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter