Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Immunisering af Alpaka (Lama pacos) med Protein antigener og produktion af Antigen-specifikke enkelt domæne antistoffer

doi: 10.3791/58471 Published: January 26, 2019

Summary

En metode til fremstilling af enkelt domæne antistoffer fra Alpaka, herunder vaccination, indsamling, B-celle isolation og udvælgelse er beskrevet.

Abstract

I dette manuskript, er en metode til immunisering af alpaca og brugen af molekylærbiologiske metoder til fremstilling af antigen-specifikke enkelt domæne antistoffer beskrevet og vist. Camelids, er såsom Alpaka og lamaer, blevet en værdifuld ressource for biomedicinsk forskning da de frembringer en roman type af tunge kæde-only antistof, som kan bruges til at producere enkelt domæne antistoffer. Fordi immunsystemet er yderst fleksibel, gøres enkelt domæne antistoffer til mange forskellige protein antigener, og endda forskellige konformationer af antigen, med en meget høj grad af specificitet. Disse funktioner, blandt andet gøre enkelt domæne antistoffer et uvurderligt værktøj for biomedicinsk forskning. En metode til fremstilling af enkelt domæne antistoffer fra Alpaka er rapporteret. En protokol for immunisering, indsamling og B-celle isolation er beskrevet. B-celler anvendes til opførelse af en immuniseret bibliotek, som bruges i forbindelse med udvælgelsen af specifikke enkelt domæne antistoffer via panorering. Formodede specifikke enkelt domæne antistoffer opnået via panorering bekræftes af pull-down, ELISA eller gel-Skift assays. De resulterende enkelt domæne antistoffer kan derefter bruges, enten direkte eller som en del af en manipuleret reagens. Anvendelser af enkelt domæne antistof og enkelt domæne antistof-baserede regents omfatter strukturelle, biokemiske, cellulære, in vivo og terapeutiske applikationer. Enkelt domæne antistoffer kan produceres i store mængder, som rekombinante proteiner i prokaryote udtryk systemer, renset, og anvendes direkte eller kan være konstrueret til at indeholde specifikke mærker eller mærker, der kan bruges som journalister i cellular undersøgelser eller i diagnosticering.

Introduction

Alpaka, og andre medlemmer af familien camelid, er blevet en populær kilde til generering af antistoffer til biomedicinsk forskning1,2,3. Camelids har en unik immunsystemet, idet de producerer både normale antistoffer samt heavy-kæden kun antistoffer, der tillader produktion af meget mindre enkelt domæne antistoffer, samtidig bevare høj specificitet og høj affinitet. Således give camelid antistoffer en alsidig reagens nyttigt til en række forskellige formål. En metode til at immunisere alpaca og producere enkelt domæne antistoffer mod en række forskellige protein antigener er her beskrevet. Disse antistoffer kan fremstilles i camelids via en relativt enkel proces, der kun kræver immunisering via små injektioner af target proteinet (antigen) og en blod uafgjort4. Efterfølgende er bibliotek byggeri, M13 phage display5 og panorering versus rekombinante antigener6 brugt til at isolere og producere enkelt domæne antistoffer med de ønskede egenskaber. Fordi processen udnytter kraften i phage display teknologi, fem eller flere antigener kan udnyttes samtidig pr. dyr, hvilket reducerer antallet af dyr brugt og dermed forbundne udgifter.

Typiske pattedyr antistoffer eller immunoglobuliner er store molekyler bestående af to typer af kæder (2 tunge kæder og 2 lette kæder), der er forbundet med hinanden gennem disulfid obligationer. Disse antistoffer er relativt store, udstiller Molekylær vægt ~ 140-190 kDa til mere rigelige IgG arterne fra mennesker, mus, geder og kaniner. På grund af deres multi subunit struktur, høj molekylvægt, og disulfid obligationer, kan immunoglobuliner være temmelig udfordrende at producere i store mængder, hvilket gør deres høje omkostninger. I 1990 ' erne, blev det opdaget, at camelids, som omfatter kameler, lamaer og alpakaer gøre, ud over den typiske pattedyr type immunoglobulin, en roman form af immunglobulin, der er enklere i struktur, besidde kun tunge kæder7. Disse unikke camelid antistoffer besidder den samme evne til at binde specifikt fremmede stoffer med høj affinitet men kun består af ét protein kæde8. Derudover kan camelid antistoffer afkortes eksperimentelt til en mindre enhed VHH fragment, også kaldet et enkelt domæne antistof9. På grund af deres lille størrelse, enkelt domæne antistoffer er nyttige for en bred vifte af biomedicinsk forskning applikationer og er tilgængelig fra en række forskellige akademiske og kommercielle kilder1,10. En undtagelse synes at være Western blotting eftersom enkelt domæne antistoffer er mere ofte rettet mod kropsbygning afhængige epitoper, der er normalt tabt denaturering betingelser anvendes i Western blotting.

Da de er lavet af en enkelt polypeptid kæde, kan specifikke enkelt domæne antistoffer valgt og let produceres i store mængder som rekombinante proteiner i bakterier. Enkelt domæne antistoffer kan også være genetisk manipuleret til at indeholde specifikke mærker eller mærker, der kan bruges som "reporter grupper" til at diagnosticere sygdomme11. Denne lethed af manipulation kombineret med deres fleksibel anvendelse gør enkelt domæne antistoffer en vigtig ressource for forskere på universiteter og andre steder.

Som en del af en National Institutes of Health støttet core, er eksisterende metoder blevet tilpasset til at producere enkelt domæne antistoffer fra Alpaka3,4. Alpaka har betydelige fordele i både nem håndtering i forhold til større camelid familiemedlemmer samt tilgængelighed. Alpaka er bredt rejst til fiber og kød og dermed kan opnås regionalt fra lokale alpaca landmænd, der kan identificeres via deres hjemmesider eller stat opdrætter foreninger. To racer af Alpaka findes, Suri og Huacaya. Huacaya er mere almindelige og blev brugt til denne protokol, men protokollen er generelt gælder for enten racer og mere bredt gælder også for andre camelids.

Protocol

Alle procedurer med Alpaka blev udført i henhold til protokoller (2017-2627 og 2018-2925) godkendt af University of Kentuckys institutionelle Animal Care og brug udvalg (IACUC).

1. generation af Antigen-specifikke Alpaca antistoffer

  1. Alpaca håndtering og generelle betragtninger
    1. Indhente passende institutionelle og/eller regulerende godkendelse.
    2. Få voksne Alpaka, mindre end 10 år med en body condition score på mindst 3,0 (skala 1-5)12. Fordi de er flokdyr, Parlamentet mindst to, men helst tre dyr sammen.
      Bemærk: Mænd anbefales, fordi, generelt, de har en mere jævn temperament og er lettere at arbejde med.
    3. Kontrollere sundhedsstatus for dyr gennem en veterinær undersøgelse, herunder gennemgang af kost, bolig, vaccination og parasit kontrol programmer13. Sikre, at dyrene er ajour med vaccinationer passende til den lokale geografiske område baseret på professionelle veterinære anbefalinger. Udvikle en ecto- og endoparasite Kontrolprogram i samråd med en dyrlæge, der er baseret på en gennemgang af historien om oprindelsesbesætningen og specifikke lokale forhold13.
    4. Akklimatisere i mindst en uge, herunder halterneck uddannelse og eksponering til tilbageholdenhed.
    5. Indsamle en 4 mL blodprøve for at få serum til brug som en kontrol, præ immunisering (Se trin 1.4). Fryse seraene og opbevares ved-20 ° C i 0,5 mL alikvoter.
      Bemærk: På dette tidspunkt, kan yderligere blod tages for en komplet blodlegemer (CBC) analyse at overvåge dyrenes oprindelige sundhedsstatus.
  2. Antigen forberedelse
    1. Forberede oprenset protein antigener i fosfatbufferet saltopløsning (PBS) eller HEPES-bufferet saltvand (HBS) og koncentrere sig til ≥ 1 mg/mL. Ca. 3 mg protein er nødvendig for den komplette protokol, herunder vaccination, panorering og bekræftelse af kloner.
      Bemærk: Camelid antistoffer vise høj specificitet og selektivitet imod protein antigener, men er generelt ikke godt egnet til ustrukturerede proteiner eller peptid antigener, som er generelt ustruktureret.
    2. Etablere antigen renhed, med renhed > 90% ønskes. Udnytte en analytisk metode som SDS-PAGE.
      Forsigtighed: Betydelig forurening med andre proteiner kan føre til problemer under udvælgelsen hvor enkelt domæne antistoffer kan isoleres til forurenende stoffer i stedet target proteinet.
    3. Forberede frosne delprøver af antigen, der indeholder ialt 100 µg antigen. 50 µL af en 2 mg/mL forberedelse er ideel. 100 µL af 1 mg/mL er den mest fortyndede protein løsning egnet til vaccination. Alternativt, hvis antigenet ikke kan gennemgå fryse/tø og er kendt for at være stabil løsning lang sigt, kan det være opbevares ved 4 ° C.
      Bemærk: For at sikre, at antigenerne kan undergå en fryse/tø cyklus, walled test en 20 µL alikvot af antigenet skal udleveres i en tynd PCR rør og snap frosset i flydende kvælstof. Tø røret, udføre høj hastighed centrifugering, og kontroller den kvantitative inddrivelse ved at sammenligne UV/VIS absorption før og efter frysning eller ved at køre en SDS-PAGE gel. Hvis det er muligt, bør antigenet også testes for opbevaring af biologiske aktivitet. Hvis fryse tø cyklus er vellykket, er de resterende antigen snap frosset i 100 µL alikvoter og opbevaret ved-80 ° C. Hvis der er problemer med den fryse/tø cyklus, protokollen kan gentages med tilsætning af op til 20% glycerol.
  3. Immunisering
    1. Mix op til fem antigener, 200 µg hver, med adjuverende i en endelige mængden af mellem 300 til 1.000 µL. Adjuvans bør udgøre ≥50% af det endelige rumfang ved hjælp af vand som fortyndingsmiddel.
      Bemærk: Hvis bufferen er nødvendigt, brug HEPES, MOPS eller glycin. En pH-værdi mellem 5 og 6 har ofte vist sig for at være mere gunstig end strengt neutral. Undgå polyvalente ioner som fosfat eller citrat, da de kan provokere koagulation.
    2. Trim af alpaca hår med elektrisk trimming, i en halvmåne mønster langs bunden af halsen fra skulder til skulder til at afsløre de regioner, der støder op til bow lymfeknuder.
    3. Holde alpaca ved halsen, langsomt injicere antigen subkutant langs bunden af halsen nær bue lymfeknuder ved hjælp af en 22 G nål. Udføre fem injektioner af ~ 200 µL (eller mindre) ~ 5 cm fra hinanden.
      Bemærk: Dyrene skal fastholdes af en anden medarbejder under injektioner. Indsprøjtning og blødning Alpaka opfordrer til forsigtighed, da de er tilbøjelige til at sparke, ikke bare bagfra men sidelæns. At have dyr tæt på hinanden, i en gruppe under procedurerne, der er optimal. Eftersom der er flokdyr, de er roligere i en gruppe og mindre insisterende tilbageholdenhed er nødvendig under procedurerne.
    4. Overvåge dyr for ~ 20 min post injektion for tegn af anafylaksi (Se trin 1,6). Skærm for lokaliseret betændelse på injektionssteder ugentligt, der ikke forventes, når du bruger de anbefalede adjuvans. Sikre, at blod lækage fra injektionsstedet ikke er overdreven.
    5. Udføre fem efterfølgende øge injektioner hver uge bruger 100 µg hvert antigen i blandingen. Klipning hår på injektionssteder kan kraeves ugentligt afhængigt af årstiden. I efteråret og vinteren, kan dyrenes hår vokse hurtigt.
  4. Tegning blod
    1. Klip og desinficere indsamling site med alkohol svaberprøver.
    2. Dy dyret forsigtigt med halsen opbevares oprejst og straight.
      Bemærk: Dyr kan være tilbageholdende manuelt som vist i videoen. Hvis rådighed, brug af en alpaca chute for at tøjle Alpaka under afblødningen og injektioner kan lette håndtering. For at bruge en alpaca sliske, er haltered Alpaka ført ind i tuden og tilbageholdende med hals barer og remme med quick releases. Versioner af alpaca chute er tilgængelige fra kommercielle leverandører.
    3. Ved hjælp af den ventrale projektionen af den tværgående proces af ryghvirvler som et vartegn, occlude venen ved at anvende pres bare mediale til den ventrale proces.
      Bemærk: Der er ingen særskilt jugularis fure i voksen alpaca. Jugularis vener er beskyttet af ventrale fremskrivninger af de tværgående vertebrale processer. Denne tyk hud (f.eks. 1 cm tyk "fighting plade" over den midterste 1/3 af hals hos mænd) og nakke muskulaturen gør det svært at visualisere eller palpere halsfedt selv. Efterfølgende, er brugen af vertebrale vartegn jugularis placering mest nyttige indikatorer.
    4. Indsætte nålen i en 45° vinkel lidt mediale (~ finger bredde) til projektion ind mod midten af halsen. Manipulere nålen indtil blodet flyder.
      Bemærk: Halsfedt og halspulsåren er tæt på hinanden. Venøse blod kan være helt rød i farven men er stadig mørkere end arterielt blod. Efter samlingen, pres bør anvendes til webstedet for 0,5-1 min. (eller længere, hvis carotis er tilgået) indtil hæmostase er sikret.
    5. Trække 4-10 mL af blod til analytiske formål. Udnytte en 1,5 tommer, 20 G kanyle typisk i forbindelse med en passende størrelse sprøjte eller blod collection tube. Udnytte lavendel top K2EDTA rør til opsamling af fuldblod når rensning af lymfocytter. Udnytte guld top serum adskillelse rør (BD), når at indsamle blod til fremstilling af antiserum.
    6. Trække 50-100 mL blod til produktionsformål. Brug filtypenavnet yderligere 12-tommer infusion sæt med en 19-20 G bevingede "butterfly" infusionssæt.
      Bemærk: En forlængelse sæt konfiguration giver mulighed for en assistent til at fylde flere blod indsamling rør, tillader venipuncturist at fokusere på stabilisering samling nålen. Tilføjelsen af infusionssæt rummer potentielle flytning af dyr (3-5 min procedure) og giver en komfortabel arbejde afstand for operatørerne.
  5. Immun overvågning
    1. Tre til fire dage efter de 3rd og 5th injektioner, udføre en lille test bløder fra hvert dyr at få sera til prøvning. Fryse og gemme seraene i 0,5 mL alikvoter. Anskaffe yderligere blodprøver på samme tid at overvåge sundheden for dyr, som diskuteret ovenfor.
    2. Bekræfte tilstedeværelsen af antigen-specifikke antistoffer af ELISA med anvendelse af sera fra test beskæringer på forhånd immun, tre-ugers, og fem-ugers tid point. Det er bedst at tage en sidste bløder mens antistof titer er stadig stigende.
    3. Generere antigen affinitet plader ved hjælp af overflade behandlede 96-brønd plader. Fortynd 0,1 µg antigen i 100 mM natriumcarbonat buffer, pH 9,0. Tilsæt 100 µL af opløsningen til hver brønd og Inkuber natten over ved 4 ° C. Ti fortyndinger af hvert antigen testes i duplikat. Et tomt kontrolelement er godt forberedt, er belagt med karbonat buffer kun.
    4. Efter natten inkubation, vendes pladen for at fjerne indholdet af brøndene vaskes tre gange med 0,1 mL PBS, 0,1% Tween 20 (PBS-T).
    5. Blokere brøndene ved at tilføje 0,1 mL af BSA (5 mg/mL) i PBS-T og inkubere plade i 1 time ved stuetemperatur.
    6. Vask pladen tre gange med PBS-T af pipettering Vaskeopløsningen i brønden og derefter fjerne Vaskeopløsningen ved inversion af pladen.
    7. Udarbejde dobbelt serielle fortyndinger af 0,3 mL hver af pre immun og immun sera i PBS-T buffer ved hjælp af en start fortynding på 1/100 og op til 1/102, 400.
    8. Tilsættes 100 µL af hver fortynding brønde og Inkuber i 2 timer ved stuetemperatur.
    9. Fjerne serum fra hver brønd og vask med 0,2 mL PBS-T tre gange.
    10. Inkuber hver godt med 0,1 mL af HRP-konjugerede ged anti-Lama IgG antistof på en fortynding af 1:20,000 for 1 h.
      Bemærk: Immunresponset målt omfatter både konventionelle og heavy-kæden kun antistoffer, som er til stede i omtrent samme nøgletal i omløb3,14.
    11. Fjerne antistof løsning og vaske hver godt med 0,2 mL PBS-T tre gange.
    12. Tilsæt 100 µL af kromogent peroxidase substrat til brønden og Inkuber ved stuetemperatur indtil intensiteten af de to højeste koncentration punkter er blevet mættet, som normalt tager 5-10 min.
    13. Tilsæt 100 µL af 0,1 M svovlsyre til hver brønd reaktionen standses.
    14. Absorbansen af hver brønd ved 450 nm med en pladelæseren.
    15. Plot absorbans som funktion koncentration.
  6. Alpaca overvågning og potentielle komplikationer
    1. Sikre passende alpaca overvågning under hele proceduren.
      Bemærk: Procedurerne, der forventes ikke at medføre betydelige negative virkninger. Dyrs velfærd og sundhed bør overvåges dagligt af dyrehold og/eller forskning personale under fodring og vanding. Dyr med unalleviated eksperimentelt inducerede, eller spontan naturlig sygelighed bør henvises til evaluering af veterinære tjenester med behandling(er) leveres som relevant, Human eutanasi, hvis nødvendigt.
      Potentielle negative konsekvenser forbundet med tapning er blødning, blå mærker og hæmatom. Dyrene bør overvåges for 20 min post blod draw til at lede efter tegn på blødning. Yderligere pres på webstederne bør anvendes. Hvis blødningen ikke standser, skal en dyrlægen kontaktes.
      Andre potentielle negative konsekvenser forbundet med injektioner og blødning omfatter granuloma dannelse og betændelse. Granuloma dannelse forventes ikke og er ikke blevet observeret på University of Kentucky. Injektion site inflammation (rødme eller hævelse) kan opstå og bør bringes til opmærksomheden af en dyrlæge. Produktion bløder repræsenterer et potentielt betydelige mængde blod, og dyrene bør overvåges for at sikre, at de er stabile og aktive efter samlingen blod.
      Anafylaksi og pyrogen svar er de to mest sandsynlige alvorlige negative konsekvenser, men er meget sjældent observeret. Hvis det skulle ske, anafylaksi ville forekomme kort efter antigen injektioner og blive manifesteret ved en forøgelse af rektal temperatur, svaghed, opkastning, vejrtrækningsproblemer og diarré. Rektal temperatur kan kontrolleres efter hver injektion til at opdage enhver stigning i kropstemperaturen. Hvis disse er anerkendt, meddele en dyrlæge straks for en høring. Derudover en nødsituation "Crash Kit" (f.eks. adrenalin, kortikosteroider, og antihistamin) udarbejdet i samråd med en dyrlæge bør være tilgængelige til behandling af dyr, som mistænkes for at have en bivirkning.

2. rensende lymfocytter til enkelt domæne antistof bibliotek opbygning

  1. Indsamle 50 mL blod tre til fem dage efter den sidste injektion (Se trin 1.4).
    Bemærk: Hurtig behandling af blod og isolering af RNA er vigtigt at opnå en passende bibliotek størrelse15,3, hvilket er meget vigtigt for succesen med panorering.
  2. Fortynd med 5 mL PBS 15 mL af det indsamlede blod.
  3. Udnytte en lymfocyt adskillelse røret for at isolere perifere blod-lymfocytter (PBLs) af tæthed gradient centrifugering ifølge fremstiller forslag.
    Forsigtighed: Producentens instruktioner viser, at op til 25 mL af blodet kan bruges, men det kan mætte systemet og forhindre, at opnå en ren lymfocyt forberedelse.
  4. Der tilsættes 5 mL PBS prechilled til 4 ° C til PBL.
  5. Spin i 20 min. på 800 x g ved 4 ° C.
  6. Vaskes to gange ved tilsætning af 5 mL PBS prechilled til 4 ° C til PBL efterfulgt af centrifugering i 20 min. ved 800 x g ved 4 ° C.
  7. Isolere total RNA ved hjælp af en spin-kolonne baseret system, ifølge producentens anvisninger. Homogeniseres cellerne ved vertexing i passende buffer og anvende til en polymer-makulering system. Bruge et passende antal mini eller maxi-kolonner baseret på den celle input.
  8. Syntetisere cDNA ved hjælp af reverse transkriptase ved at kombinere 10 µg af RNA med en blanding af 0,1 µg for Oligo (dT) 12-18 primere.
  9. Generere en bacteriophage biblioteket ved hjælp af etablerede metoder4. Dette indebærer kloning med restriktionsenzymer til phage display vektor pMES4 efterfulgt af smeltet gen III af filamentøs phage til produktion af phage løsning insertets ekspression.

3. enkelt domæne antistof panorering

  1. Producere antigen affinitet plader ved hjælp af overflade behandlet 96-brønd plader. Fortynd 0,25 µg antigen i 100 mM natriumcarbonat buffer, pH 9,0. Tilsæt 100 µL af denne løsning til hver brønd og Inkuber natten over ved 4 ° C. Coat to brønde pr. antigen. Forberede en blindkontroller godt, der er belagt med karbonat buffer kun.
    Bemærk: Plader kan produceres og opbevares i op til en uge på 4 ° C, hvis flere runder af udvalg vil blive udført. Også udnytter denne metode direkte absorption, som ikke kræver mærkning mens andre metoder bruger biotinylation eller andre typer af mærkning strategier.
  2. Inkuber pladen natten over. Inverter for at fjerne indholdet af brøndene vaskes tre gange med 0,1 mL PBS-T.
  3. Blokere brøndene ved at tilføje 0,1 mL af BSA (20 mg/mL) i PBS og inkubere plade i 2 timer ved stuetemperatur.
  4. Vask pladen tre gange med PBS-T efterfulgt af tre gange med PBS. Antigener kan også være kovalent mærket og anvendes i capture systemer som for eksempel streptavidin/biotin systemer.
  5. Pre behandle phage løsning (100 µL) med 100 µL af 40 mg/mL BSA i PBS på en vibrerende platform ved stuetemperatur i 30 min.
  6. Tilføje phage løsning til antigenet coatede brønde og Inkuber med blid agitation i 2 timer ved stuetemperatur. Bruge flere brønde for at sikre alt af 1011 phage for hvert antigen.
  7. Kassér den ubundne phage ved inversion og derefter vaske wells fem gange med 200 µL af PBS-T efterfulgt af fem gange med PBS.
  8. Elueres den bundne phage ved at tilføje 0,1 mL 0,25 mg/mL trypsin i PBS og inkubere i 30 min. ved stuetemperatur på de vibrerende platform på 700 omdrejninger i minuttet.
  9. Opløsningen overføres til en hætteglas indeholdende 5 µL af 4 mg/mL 4-benzenesulfonyl fluorid hydrochloride(AEBSF) løsning til at slukke trypsin aktivitet.
  10. Vokse TG1 phage display kompetente celler ved 37 ° C under omrystning indtil OD600 = 0,5.
  11. Tilsættes 50 µL af elueret phage 3 mL TG1 celler.
  12. Der inkuberes ved 37 ° C uden rystning i 30 min.
  13. Tilføje 7 mL af LB media suppleret med 100 µg/mL ampicillin, 2% glukose.
  14. Omrystes natten over ved 37 ° C.
    Bemærk: For at opnå de mest forskelligartede enkelt domæne antistoffer, kan kloner blive sekventeret, testet for ønskede egenskaber og udnyttet efter en runde af panorering. For at opnå det højeste affinitet enkelt domæne antistoffer, bør to runder af panorering udnyttes.
  15. Plade bakterier, efter natten vækst på LB agar plader suppleret med 100 µg/mL ampicillin, 2% glukose. Flere serielle fortyndinger skal testes, startende med to fortyndinger, plating 100 µL 1/10.000 og 1/100.000 fortyndinger.
  16. Inkuber plade natten over ved 37 ° C.
  17. Vælge kolonierne og podes wells af en steril 96-brønd plade der indeholder 100 µL af 2XYT med 100 µg/mL ampicillin, 2% glukose, 10% v/v glycerol pr. brønd.
  18. Der inkuberes natten over ved 37 ° C uden rystelser.
  19. Den næste dag, ryste på 170 rpm ved 37 ° C i 60 min.
  20. Fjern 2 µL af medierne i PCR rør. De resterende løsning kan venstre i pladen og opbevares ved 4 ° C i 1-2 dage eller frosset og opbevares ved-80 ° C til senere brug.
  21. Udføre PCR reaktion ved hjælp af primere passende for vektoren udnyttet. PCR screening af positive kloner bruger primere, der flankerer den flere kloning site er for pMES4, CCTATTGCCTACGGCAGCCGCTGGATTGTTATTAC og GGTGGTGTGAGGAGACGGTGACCTG. Udnytte cykling betingelser passende for polymerasen anvendes, en udgloedning temperatur på 57 ° C og 30 cykler.
  22. Analysere PCR reaktion ved at køre en 1% (w/v) agarosegel. Kolonier, der er positive har enkelt domæne antistof gen skær ~ 500 bp. sikre at positive kloner er 20-50% af prøven.
    Bemærk: Denne metode giver et middel til klon udvælgelse og analyse, der kan udføres i de fleste forskningslaboratorier. Alternativt, næste generation sequencing kan anvendes og giver store datasæt, som giver mulighed for statistiske og sammenlignende analyse16.
  23. Podes de positive kloner fra pladen ind i friske rør indeholdende 7 mL LB med 100 µg/mL ampicillin.
  24. Vokse med ryster for natten over ved 37 ° C.
  25. Udføre en miniprep på kultur til at opnå plasmid DNA.
  26. Sekvens positive kloner ved hjælp af standard sekventering primer pEX-Rev (CAGGCTTTACACTTTATGCTTCCGGC).
  27. Udføre beregningsmæssige analyse på resulterende enkelt domæne antistof sekvenser. Sikre, at der er ingen stop kodon eller ramme skifter.
  28. Klassificere de resulterende sekvenser for lighed og mangfoldighed. De sekvenser, der er gentagne gange blevet identificeret er mest sandsynligt at være høj affinitet bindende sekvenser, især efter to runder af udvalg.
  29. Udtrykke det enkelte domæne antistof ved hjælp af en BL21-afledte udtryk stamme af E. coil. Inducere udtryk gennem tilsætning af IPTG, vokser natten over ved 22 ° C.
  30. Rense enkelt domæne antistof ved hjælp af immobiliserede metal affinitet kromatografi (IMAC).
  31. Validere enkelt domæne antistof/antigen bindende ved hjælp af en direkte interaktion assay som pull-down, native gelelektroforese, eller ELISA.
  32. Kontrollere programspecifikke enkelt domæne antistof præstation, som ønskede for den specifikke eksperiment.

Representative Results

Protokollen præsenteres her blev udnyttet til at generere enkelt domæne antistoffer mod en række af protein antigener. Fem antigener blev udnyttet pr. alpaca. Immun overvågning tilkendegivet, at fleste af antigener viste robuste svar begyndelsen på tre uger (figur 1). Produktion beskæringer og bibliotek byggeri efter cirka seks uger giver den bedste balance for dyr, der har flere antigener injiceres. To runder af panorering blev udført for hvert antigen, og isolerede kolonier screenet (figur 2). Sekventering af positive kolonier identificeret forskellige enkelt domæne antistof sekvenser for de forskellige antigener. For eksempler var tre unikke kloner isoleret til reference antigen Maltose bindende Protein (MBPS) (figur 3A). Som er ofte observeret, indeholder enkelt domæne antistoffer betydelige sekvens mangfoldighed og meget varierende CDR3 længde (figur 3). Disse funktioner er særlig vigtig i enkelt domæne antistof/antigen interaktioner som ses i den reference enkelt domæne antistof/CX3CL1 komplekse17 (figur 3B).

Størstedelen af fuld længde enkelt domæne antistof sekvenser kan udtrykkes og renset på 1-10 mg/L af kulturen (figur 4A). På grund af mangfoldigheden i CDR3 længden vise forskellige enkelt domæne antistoffer mindre variation i molekylvægt. Bekræftelse af direkte bindende og programmets specifikke ydeevne er kritisk. For eksempel, efter to runder af udvælgelse imod Antigen B identificeret et panel af enkelt domæne antistoffer var (figur 2). Flere identiske sekvenser blev identificeret, og enkelt domæne antistof blev produceret og renset. Det blev derefter testet via direkte trække ned med antigen affinitet harpiks og viste robust dosis-afhængige bindende (figur 4B). Vigtigere, viste enkelt domæne antistof ingen binding til styre harpiks. Disse data viser en direkte bindende interaktion, og det er velegnet til affinitet opsamling i både pull-down og ELISA-baseret formaters.

Figure 1
Figur 1 : Repræsentant immun overvågning af to særskilte antigener viser betydelig specifikke immunrespons til forskellige antigener i samme dyr. Mange antigener Vis robuste svar så tidligt som tre uger efter begyndende immunisering, med de fleste viser maksimal svar efter seks uger. Seks uger også giver mulighed for affinitet modning og er den anbefalede tid for produktion beskærings- og B-celle isolation. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : PCR-baserede bekræftelse af positive kloner. Primere span MCS af vektoren, pMES4, og en positiv nanobody klon producerer en amplikon ~ 500 bp (markeret med *). Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 : Antigen-specifikke sekvenser fremhæve alpaca enkelt domæne antistof mangfoldighed. (A) justering af Vælg enkelt domæne antistof sekvenser isoleret til MBP med en reference enkelt domæne antistof 4XT1, rammer og komplementaritet-bestemmende områder (Kabat) fremhævet nedenfor. (B) struktur af alpaca enkelt domæne antistof 4XT1 bundet til CX3CL1 (FBF 4XT1), som understreger den afgørende rolle af variable CDR sløjfer i specifikke antigen bindende. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4 : Oprensning og validering af enkelt domæne antistoffer. (A) SDS-PAGE IMAC renset enkelt domæne antistoffer, sammenligne forskellige enkelt domæne antistoffer. Forskellige Molekylær vægt er primært på grund af varierende længde af CDR3 sløjfen. Forskellige niveauer af udtryk er også observeret, med et mindretal af enkelt domæne antistoffer viser dårlig udbyttet af oprenset protein. (B) kontrol af direkte bindende ved hjælp af et antigen affinitet pull-down. Robust dosisafhængig enkelt domæne antistof bindende er observeret med antigen-kombineret harpiks, men ikke med kontrol harpiks. Venligst klik her for at se en større version af dette tal.

Discussion

Som bemærket, høj affinitet og specificitet af enkelt domæne antistoffer, kombineret med deres facile udtryk og stabilitet, gør dem ideelle reagenser til programmer i biomedicinsk forskning, som kritiske biokemiske reagenser, diagnostiske værktøjer, eller terapeutiske agenter18. For kommercielle programmer er der nogle spørgsmål relateret til intellektuel ejendom, der skal overvejes. Derudover kan enkelt domæne antistoffer være udviklet til at indeholde bestemte mærker eller mærker, der kan bruges som journalister i cellulære assays eller i diagnostik. Nøglen til disse anvendelser er evnen til at producere specifikke enkelt domæne antistoffer mod antigener af interesse. En metode er beskrevet her til at producere enkelt domæne antistoffer ved hjælp af Alpaka, der producerer en robust immunrespons mod en bred vifte af protein antigener. Overvejelser i forbindelse med dyrs håndtering og overholdelse af lovgivningen er beskrevet. Disse er nøglen til succes i denne del af processen.

Der er andre strategier for at producere enkelt domæne antistoffer, der ikke kræver vaccination, men i stedet bruge semisyntetisk biblioteker med forskellige systemer for udvælgelse og iterativ optimering af tilhørsforhold19,20 . Men fordelen ved at bruge biblioteker fra immuniseret dyr er evnen til at pålideligt isolere yderst højberiget, forskelligartede og høj-affinitet enkelt domæne antistoffer. Derudover ikke kun er betydelig sekvens variationer observeret, men et stort flertal af specifikke enkelt domæne antistoffer isoleret havde unikke indsættelser og sletninger, især i CDR3.

Yderligere, enkelt domæne antistoffer kan produceres via en enkel proces, der kun kræver små injektioner af antigenet, og efter denne proces, at dyrene kan returneres for husdyrbestand. Bemærk, dyret kan anvendes frit til fremstilling af fibre, men bør udelukkes fra anvendelse som kød (fødekæden) anvendelse af test antigener og ikke-FDA godkendte adjuverende for enkelt domæne antistof produktion. Når proceduren er afsluttet, kan dyrene bør overvåges for en uge, givet en endelige veterinære eksamen, og derefter enten vendte tilbage til deres hjem gård eller hvilede i seks måneder forud for anden runde af enkelt domæne antistof produktion.

Disclosures

DRs. Whiteheart og Hersh er på University of Kentucky og drive en kerne i Center for Molekylær medicin, der producerer enkelt domæne antistoffer i alpaca som et gebyr for service.

Acknowledgments

Dette arbejde blev støttet af National Institutes of Health (P30GM103486).

Materials

Name Company Catalog Number Comments
GERBU FAMA adjuvant Biotechnik, Heidelberg, Germany  3003,6001
Serum collection tube Becton Dickinson 367983
Blood collection tube Becton Dickinson 366643
Vacutainer blood collection set Becton Dickinson 368652
Maxisorp Immuno plates Nunc 439454
BSA Sigma-Aldrich A7906
HRP-conjugated goat anti-llama IgG antibody  Bethyl Labs A160-100P
TMB reagent chromogenic peroxidase substrate  KPL 50-76-03
Plate Reader Spectramax M5 Any UV/VIS capable reader is acceptable
Uni-SepMAXI+ lyphocyte separation tube Novamed U-17
RNeasy Mini Kit Qiagen 74104
QIAshredder column Qiagen 79654
Superscript IV reverse transcriptase   Invitrogen 18064014
AEBSF solution Biosynth A-5440
TG1 phage display competent cells Lucigen 60502

DOWNLOAD MATERIALS LIST

References

  1. Krah, S., et al. Single-domain antibodies for biomedical applications. Immunopharmacology and Immunotoxicology. 38, (1), 21-28 (2016).
  2. Rothbauer, U., et al. Targeting and tracing antigens in live cells with fluorescent nanobodies. Nature Methods. 3, (11), 887-889 (2006).
  3. Maass, D. R., Sepulveda, J., Pernthaner, A., Shoemaker, C. B. Alpaca (Lama pacos) as a convenient source of recombinant camelid heavy chain antibodies (VHHs). Journal of Immunological Methods. 324, (1-2), 13-25 (2007).
  4. Pardon, E., et al. A general protocol for the generation of Nanobodies for structural biology. Nature Protocols. 9, (3), 674-693 (2014).
  5. Hertveldt, K., Belien, T., Volckaert, G. General M13 phage display: M13 phage display in identification and characterization of protein-protein interactions. Methods in Molecular Biology. 502, 321-339 (2009).
  6. Kushwaha, R., Schafermeyer, K. R., Downie, A. B. A protocol for phage display and affinity selection using recombinant protein baits. Journal of Visualized Experiments. (84), e50685 (2014).
  7. Hamers-Casterman, C., et al. Naturally occurring antibodies devoid of light chains. Nature. 363, (6428), 446-448 (1993).
  8. Muyldermans, S., et al. Camelid immunoglobulins and nanobody technology. Veterinary Immunology and Immunopathology. 128, (1-3), 178-183 (2009).
  9. Muyldermans, S. Nanobodies: natural single-domain antibodies. Annu Rev Biochem. 82, 775-797 (2013).
  10. Muyldermans, S., Cambillau, C., Wyns, L. Recognition of antigens by single-domain antibody fragments: the superfluous luxury of paired domains. Trends in Biochemical Sciences. 26, (4), 230-235 (2001).
  11. Wang, Y., et al. Nanobody-derived nanobiotechnology tool kits for diverse biomedical and biotechnology applications. International Journal of Nanomedicine. 11, 3287-3303 (2016).
  12. Van Saun, R. J. Nutritional requirements and assessing nutritional status in camelids. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 265-279 (2009).
  13. Jones, M., Boileau, M. Camelid herd health. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 239-263 (2009).
  14. Daley, L. P., Gagliardo, L. F., Duffy, M. S., Smith, M. C., Appleton, J. A. Application of monoclonal antibodies in functional and comparative investigations of heavy-chain immunoglobulins in new world camelids. Clinical and Diagnostic Laboratory Immunology. 12, (3), 380-386 (2005).
  15. Romao, E., et al. Identification of Useful Nanobodies by Phage Display of Immune Single Domain Libraries Derived from Camelid Heavy Chain Antibodies. Current Pharmaceutical Design. 22, (43), 6500-6518 (2016).
  16. Henry, K. A., et al. Isolation of TGF-beta-neutralizing single-domain antibodies of predetermined epitope specificity using next-generation DNA sequencing. Protein Engineering, Design and Selection. 29, (10), 439-443 (2016).
  17. Burg, J. S., et al. Structural biology. Structural basis for chemokine recognition and activation of a viral G protein-coupled receptor. Science. 347, (6226), 1113-1117 (2015).
  18. Wesolowski, J., et al. Single domain antibodies: promising experimental and therapeutic tools in infection and immunity. Medical Microbiology and Immunology. 198, (3), 157-174 (2009).
  19. Harmsen, M. M., De Haard, H. J. Properties, production, and applications of camelid single-domain antibody fragments. Applied Microbiology and Biotechnology. 77, (1), 13-22 (2007).
  20. McMahon, C., et al. Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nature Structural & Molecular Biology. 25, (3), 289-296 (2018).
Immunisering af Alpaka (<em>Lama pacos</em>) med Protein antigener og produktion af Antigen-specifikke enkelt domæne antistoffer
Play Video
PDF DOI

Cite this Article

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).More

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter