Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Immunisatie van alpaca's (Lama pacos) met eiwit antigenen en productie van antigeen-specifieke enkel domein antilichamen

doi: 10.3791/58471 Published: January 26, 2019

Summary

Een methode voor de productie van één domein antilichamen van alpaca's, met inbegrip van immunisatie, bloedinzameling, B-cel isolatie en selectie wordt beschreven.

Abstract

In dit manuscript, is een methode voor de immunisatie van alpaca en het gebruik van moleculaire biologiemethodes om één domein van antigeen-specifieke antilichamen te produceren beschreven en gedemonstreerd. Kameelachtigen, zoals alpacas en lamas, zijn uitgegroeid tot een waardevolle bron voor biomedisch onderzoek aangezien zij produceren een nieuwe soort zware alleen-keten antilichamen die kan worden gebruikt om enkel domein antilichamen te produceren. Omdat het immuunsysteem zeer flexibel is, kunnen één domein antilichamen aan vele verschillende eiwit antigenen, en zelfs verschillende conformaties van het antigeen, worden gemaakt met een zeer hoge mate van specificiteit. Deze functies, o.a. maken enkel domein antilichamen een waardevol instrument voor biomedisch onderzoek. Een methode voor de productie van één domein antilichamen van alpaca's is gemeld. Een protocol voor immunisatie, bloedinzameling, en isolatie van de B-cel wordt beschreven. De B-cellen worden gebruikt voor de bouw van een geïmmuniseerde library, die wordt gebruikt bij de selectie van specifieke enkel domein antilichamen via de pannen. Vermeende specifieke enkel domein antilichamen verkregen via pannen worden bevestigd door de pull-down, ELISA, of gel-shift testen. De resulterende enkel domein antilichamen kunnen vervolgens rechtstreeks of als onderdeel van een gemanipuleerde reagens worden gebruikt. Het gebruik van één domein antilichaam en enkel domein antilichamen gebaseerde regenten bevatten structurele, biochemische, cellulaire, in vivo en therapeutische toepassingen. Enkel domein antilichamen kunnen in grote hoeveelheden worden geproduceerd zoals recombinante eiwitten in prokaryotische expressiesystemen, gezuiverd, en direct gebruikt of kan worden ontworpen om specifieke markers of tags die kunnen worden gebruikt als verslaggevers in cellulaire studies of bevatten diagnostiek.

Introduction

Alpaca's, en andere leden van de familie kameelachtige geworden een populaire bron voor het genereren van antilichamen voor biomedisch onderzoek1,2,3. Kameelachtigen hebben een unieke immuunsysteem dat zij produceren zowel normale antilichamen evenals de enige antilichamen zware-keten, waardoor de productie van veel kleinere enkel domein antilichamen, met behoud van hoge specificiteit en hoge affiniteit. Dus, kameelachtige antistoffen bieden een veelzijdige reagens nuttig is voor allerlei doeleinden. Een methode om te immunizeren alpaca en enkel domein antilichamen aan een verscheidenheid van eiwit antigenen produceren wordt hier beschreven. Deze antilichamen kunnen worden geproduceerd in kameelachtigen via een relatief eenvoudig proces dat alleen de immunisatie via kleine injecties van de doel-eiwitten (antigeen) en een bloed trekken4 vereist. Vervolgens wordt bibliotheek bouw, M13 phage display5 en panning versus de recombinante antigeen6 gebruikt om te isoleren en enkel domein antilichamen met de gewenste kenmerken te produceren. Omdat het proces maakt gebruik van de kracht van de technologie van de vertoning van de bacteriofaag, vijf of meer antigenen kunnen gelijktijdig worden gebruikt per dier, waardoor het aantal dieren gebruikt en daarmee verband houdende kosten.

Typische zoogdieren antilichamen of immunoglobulinen zijn grote moleculen bestaande uit twee soorten kettingen (2 zware kettingen en 2 lichte kettingen), die met elkaar zijn verbonden via disulfide bindingen. Deze antilichamen zijn relatief groot, exposeren molecuulgewicht van ~ 140-190 kDa voor de meer overvloedig IgG-soorten van mensen, muizen, geiten en konijnen. Als gevolg van hun meerdere subeenheid structuur ultrahoog moleculair gewicht en disulfide bindingen kunnen immunoglobulinen vrij uitdagend om te produceren in grote hoeveelheden, waardoor hun hoge kosten. In de jaren negentig, werd ontdekt dat kameelachtigen, waaronder kamelen, Lama's en Alpaca's maken, naast de typische zoogdieren type immunoglobuline, een nieuwe vorm van immunoglobuline dat is eenvoudiger in structuur, bezitten alleen zware kettingen7. Deze unieke kameelachtige antilichamen beschikken over het zelfde vermogen te specifiek vreemde stoffen met hoge affiniteit binden, maar slechts zijn samengesteld uit één eiwit ketting8. Bovendien kunnen kameelachtige antilichamen experimenteel worden afgekapt tot een nog kleinere eenheid de VHH-fragment, een afkorting voor een enkel domein antilichamen9. Vanwege hun kleine omvang, enkel domein antilichamen zijn nuttig voor een brede waaier van toepassingen van biomedisch onderzoek en zijn verkrijgbaar bij verschillende academische en commerciële bronnen1,10. Een uitzondering schijnt te zijn westelijke bevlekken aangezien enkel domein antilichamen vaker gericht zijn tegen conformatie afhankelijke epitopes, die meestal onder het denatureren voorwaarden gebruikt in Western blots verloren zijn.

Omdat ze zijn samengesteld uit een één polypeptide ketting, kunnen specifieke enkel domein antilichamen worden geselecteerd en gemakkelijk in grote hoeveelheden geproduceerd als recombinant eiwitten bij bacteriën. Enkel domein antilichamen kunnen ook worden genetisch gemanipuleerde bevatten specifieke markers of tags die kunnen worden gebruikt als 'verslaggever groepen' voor de diagnose van ziekten11. Dit gemak van manipulatie in combinatie met hun flexibiliteit van gebruik maakt enkel domein antilichamen een belangrijke hulpbron voor onderzoekers aan universiteiten en elders.

Als onderdeel van een National Institutes of Health ondersteund kern, zijn bestaande methoden aangepast om enkel domein antilichamen van alpaca's3,4te produceren. Alpaca's hebben aanzienlijke voordelen in beide gebruiksgemak ten opzichte van grotere kameelachtige familieleden evenals toegankelijkheid. Alpaca's zijn sterk verhoogd voor vezels en vlees en aldus kunnen regionaal worden verkregen van lokale alpaca boeren, die kunnen worden geïdentificeerd via hun websites of via staat Fokker verenigingen. Twee rassen van alpaca's zijn beschikbaar, Suri en Huacaya. Huacaya komen vaker voor en werden gebruikt voor dit protocol, maar het protocol is algemeen toepasbaar voor beide rassen en ook meer algemeen van toepassing op andere kameelachtigen.

Protocol

Alle procedures met de alpaca's werden verricht overeenkomstig de protocollen (2627-2017 en 2018-2925) goedgekeurd door de Universiteit van Kentucky institutionele Animal Care en gebruik Comité (IACUC).

1. generatie van antigeen-specifieke Alpaca antilichamen

  1. Alpaca handling en algemeneoverwegingen
    1. Passende institutionele en/of wettelijke goedkeuring te verkrijgen.
    2. Verkrijgen van volwassen Alpaca's, minder dan 10 jaar oud met een lichaam conditie score van ten minste 3.0 (schaal 1-5)12. Omdat ze kuddedieren zijn, huis minimaal twee maar bij voorkeur drie dieren samen.
      Opmerking: Mannetjes worden aanbevolen, omdat, in het algemeen, ze hebben een meer gelijkmatige temperament en zijn gemakkelijker mee kunt werken.
    3. Controleer de gezondheidsstatus van dieren door middel van een veterinair onderzoek met inbegrip van de herziening van de voeding, huisvesting, vaccinatie en parasiet controle programma's13. Ervoor zorgen dat de dieren up to date met vaccinaties worden de geografische streek op basis van professionele veterinaire aanbevelingen zijn. Ontwikkelen van een besturingsprogramma ecto- en endoparasite in overleg met een dierenarts die is gebaseerd op een beoordeling van de geschiedenis van het beslag van oorsprong en de specifieke plaatselijke omstandigheden13.
    4. Acclimatiseren voor ten minste een week, met inbegrip van de halter training en blootstelling aan terughoudendheid.
    5. Verzamelen van een bloedmonster 4 mL om te verkrijgen van serum voor gebruik als een pre immunisatie besturingselement (zie stap 1.4). Bevriezen van de sera en opgeslagen bij-20 ° C in 0,5 mL aliquots.
      Opmerking: Op dit moment kan extra bloed worden genomen voor een analyse van de volledige bloedcel (CBC) om te controleren eerste gezondheidsstatus van de dieren.
  2. Antigeen voorbereiding
    1. Bereiden van gezuiverde eiwit antigenen in-fosfaatgebufferde zoutoplossing (PBS) of HEPES-gebufferde zoutoplossing (HBS) en zich concentreren op ≥1 mg/mL. Ongeveer 3 mg van eiwit is nodig voor het volledige protocol, met inbegrip van de immunisering, pannen en bevestiging van klonen.
      Opmerking: Kameelachtige antilichamen hoge specificiteit en selectiviteit tegen eiwit antigenen worden weergegeven, maar zijn over het algemeen niet geschikt voor ongestructureerde proteïnen of peptide antigenen die over het algemeen ongestructureerde.
    2. Stellen van antigeen zuiverheid, met zuiverheid > 90% gewenst. Gebruik een analytische methode zoals SDS-pagina.
      Let op: Significante besmetting met andere eiwitten kan leiden tot problemen bij de selectie waar enkel domein antilichamen kunnen worden geïsoleerd aan contaminanten in plaats van het target-eiwit.
    3. Bevroren aliquots van het antigeen die een totaal van 100 µg antigen bevat voor te bereiden. 50 µL van een preparaat van 2 mg/mL is ideaal. 100 µL van 1 mg/mL is de meest verdunde oplossing van eiwit geschikt voor immunisatie. Als alternatief, als het antigeen kan niet ondergaan vorst/dooi en is bekend om zijn stabiel op lange termijn van de oplossing, het kan worden opgeslagen bij 4 ° C.
      Opmerking: Om ervoor te zorgen dat het antigeen kan ondergaan een vorst/dooi cyclus, ommuurde test die een aliquot 20 µL van het antigeen moet worden verstrekt in een dunne PCR buis en module ingevroren in vloeibare stikstof. Ontdooien van de buis, hoge snelheid centrifugeren uitvoeren en controleren van het kwantitatieve herstel door het vergelijken van de absorptie van UV/VIS vóór en na de bevriezing of door het runnen van een SDS-pagina gel. Indien mogelijk, moet het antigeen ook voor het behoud van de biologische activiteit worden getest. Als de vries-dooi cyclus geslaagd is, is de resterende antigeen module in 100 µL aliquots bevroren en opgeslagen bij-80 ° C. Als er problemen zijn met de vorst/dooi cyclus, het protocol kan worden herhaald met de toevoeging van maximaal 20% glycerol.
  3. Immunisatie
    1. Maximaal vijf antigenen, 200 µg per stuk, mix met adjuvans in een eindvolume van tussen de 300 tot 1000 µL. De adjuvante moet vormen ≥50% van het uiteindelijke volume, gebruik van water als het oplosmiddel.
      Opmerking: Als buffer nodig is, gebruikt HEPES, MOPS, of glycine. Een pH tussen 5 en 6 is vaak gunstiger dan strikt neutraal gebleken. Vermijd polyvalente ionen zoals fosfaat of citraat, aangezien ze de stolling kunnen provoceren.
    2. Versiering van de alpaca haren met elektrische tondeuse, in een patroon van de wassende maan langs de basis van haar hals vanaf de schouder aan schouder bloot van de regio's grenzend aan de lymfklieren van de boog.
    3. Houd de alpaca door de nek en injecteren langzaam het antigeen subcutaan langs de onderkant van de hals in de buurt van de lymfklieren van de boog met behulp van een naald 22 G. Uitvoeren van vijf injecties van ~ 200 µL (of minder) ~ 5 cm uit elkaar.
      Opmerking: De dieren moeten worden gefixeerd door een tweede personeelslid tijdens de injecties. Injecteren en bloeden Alpaca's oproepen tot voorzichtigheid omdat ze gevoelig zijn voor schoppen, niet alleen van achter maar zijwaarts. Waar de dieren dicht bij elkaar, in een groep, tijdens de procedures is optimaal. Gezien het feit dat ze kuddedieren zijn, ze zijn rustiger in een groep en minder krachtig terughoudendheid nodig is tijdens de procedures.
    4. Controleren van de dieren voor ~ 20 min post injectie voor tekenen van anafylaxie (zie stap 1.6). Monitor voor gelokaliseerde ontsteking op de injectie sites wekelijks, die niet te verwachten is bij het gebruik van de aanbevolen adjuvans. Zorg ervoor dat het lekken van bloed uit de plaats van injectie niet buitensporig.
    5. Uitvoeren van vijf daaropvolgende stimuleren injecties wekelijks met behulp van 100 µg voor elk antigeen in het mengsel. Knippen van de haren op de sites van de injectie kan worden verlangd wekelijks afhankelijk van het seizoen. In de herfst en winter, kan de dieren haren groeien snel.
  4. Tekening bloed
    1. Clip en desinfecteren van de collectie site met alcohol swabs.
    2. Beperken het dier voorzichtig met de nek rechtop gehouden en rechtdoor.
      Opmerking: Dieren kunnen handmatig zoals aangetoond in de video worden gefixeerd. Indien beschikbaar, gebruik van een parachute alpaca de alpaca's beperken tijdens het verbloeden en injecties behandeling kunnen verlichten. Als u een alpaca-parachute zijn, haltered Alpaca's leidde naar de parachute en gefixeerd met nek bars en riemen met snelle releases. Versies van de alpaca parachute zijn beschikbaar via commerciële leveranciers.
    3. Met behulp van de ventrale projectie van de transverse-proces van de wervels als een mijlpaal, occlude de ader door gewoon mediale druk aan het ventrale proces toe te passen.
      Opmerking: Er is geen afzonderlijke jugular furrow in volwassen alpaca. De jugular veins worden beschermd door de ventrale projecties van de dwarse Vertebrale processen. Deze dikke huid (bijvoorbeeld 1 cm dik "fighting plaat" over de middelste 1/3 van de hals bij mannen) en nek spieren maakt het moeilijk om te visualiseren of palperen van de halsslagader zelf. Vervolgens is het gebruik van Vertebrale bezienswaardigheden is de meest nuttige indicatoren voor jugular locatie.
    4. Invoegen van de naald onder een hoek van 45° iets mediaal (~ breedte vinger) naar de projectie naar het midden van de nek. Het manipuleren van de naald tot de stromen van het bloed.
      Opmerking: De halsslagader en de halsslagader liggen dicht bij elkaar. Veneuze bloed kan heel rood in de kleur maar nog steeds donkerder is dan de arteriële bloed. Naar aanleiding van de collectie, druk moet worden toegepast op de site voor 0,5-1 min (of langer indien de halsslagader wordt benaderd) totdat hemostase is verzekerd.
    5. 4-10 mL bloed trekken voor analytische doeleinden. Gebruik maken van een 1,5 inch, 20 G naald meestal in combinatie met een passende formaat spuit of blood collection tube. Gebruik van lavendel top K2EDTA buizen voor het verzamelen van de volbloed wanneer zuiveren van lymfocyten. Gouden top serum scheiding buizen (BD) gebruiken bij het verzamelen van het bloed voor de productie van serum.
    6. Tekenen van 50-100 mL bloed voor productiedoeleinden. Gebruikt u een extensie van de extra 12-inch infusie set een gevleugelde 19-20 G "butterfly" infusie.
      Opmerking: Een extensie instellen configuratie kunt assistent te vullen meerdere bloed collectie buizen, zodat de venipuncturist zich te concentreren op het stabiliseren van de collectie naald. De toevoeging van de infusie set herbergt potentiële verkeer van het dier (3-5 min procedure) en geeft een comfortabele afstand voor de exploitanten.
  5. Immuun toezicht
    1. Drie tot vier dagen na de 3rd en 5th injecties, een kleine test afloop van elk dier te verkrijgen van sera voor het testen uitvoeren. Bevriezen en bewaar de sera op 0,5 mL aliquots. Extra bloedmonsters krijgen op hetzelfde moment te houden op de gezondheid van het dier, zoals hierboven besproken.
    2. De aanwezigheid van antigeen-specifieke antilichamen door ELISA met behulp van de sera test aflopen op vooraf immuun, drie weken durende en vijf weken tijd punten verkregen te bevestigen. Het is best om een definitieve afloop terwijl de antilichaam titer neemt nog steeds toe.
    3. Genereren van antigeen affiniteit platen met behulp van oppervlakte behandelde 96-wells-platen. Verdun 0,1 µg van het antigeen in 100 mM natriumcarbonaat buffer, pH 9.0. Voeg 100 µL van de oplossing aan elk putje en na een nacht bebroeden bij 4 ° C. Tien verdunningen voor elk antigeen worden getest in tweevoud. Een blanco-controle is goed voorbereid dat is bedekt met carbonaat buffer alleen.
    4. Na een incubatieperiode van de overnachting, het omkeren van de plaat om te verwijderen van de inhoud van de putten en was driemaal met 0,1 mL PBS, 0,1% Tween-20 (PBS-T).
    5. Blokkeren de putten door toevoeging van 0,1 mL BSA (5 mg/mL) in PBS-T en de plaat gedurende 1 uur bij kamertemperatuur incuberen.
    6. De plaat driemaal met PBS-T wassen door pipetteren de wash-oplossing in de put en vervolgens het verwijderen van de wash-oplossing door de inversie van de plaat.
    7. Maak van twee-voudige seriële verdunningen van 0.3 mL elk van pre immuun en immuun sera in PBS-T buffer met behulp van een startende verdunning van 1/100, en tot 1/102, 400.
    8. Breng 100 µL van elke verdunning in de putjes en laat gedurende 2 uur bij kamertemperatuur incuberen.
    9. Het serum te verwijderen van elk putje en wassen met 0,2 mL PBS-T driemaal.
    10. Incubeer elk goed met 0,1 mL van HRP-geconjugeerde geit anti-llama IgG antilichamen bij een verdunning 1:20,000 gedurende 1 uur.
      Opmerking: De immuunrespons gemeten omvat zowel conventionele alsmede enige zware-keten antilichamen, die in ongeveer gelijke verhoudingen in omloop3,14aanwezig zijn.
    11. De antilichaam-oplossing verwijderen en wassen elk goed met 0,2 mL PBS-T driemaal.
    12. Voeg 100 µL chromogenic peroxidase substraat naar de waterput en Incubeer bij kamertemperatuur totdat de intensiteit van de twee hoogste concentratie punten hebben verzadigd, wat gewoonlijk duurt 5-10 min.
    13. Voeg 100 µL van 0,1 M zwavelzuur aan elk putje te stoppen met de reactie.
    14. Meet de extinctie van elk putje bij 450 nm met behulp van een afleesapparaat.
    15. Plot de extinctie als de concentratie van een functie.
  6. Alpaca monitoring en mogelijke complicaties
    1. Zorgen voor passende alpaca toezicht gedurende de hele procedure.
      Opmerking: De procedures zijn niet verwacht aanzienlijke schadelijke effecten. Dierlijk welzijn en gezondheid moeten worden toegezien dagelijks door veeteelt en/of onderzoek personeel tijdens het voederen en drenken. Een dier met unalleviated experimenteel-geïnduceerde of spontane natuurlijke morbiditeit moet voorleggen voor de evaluatie veterinaire diensten met treatment(s) verstrekt in voorkomend geval, tot het humane euthanasie, indien nodig.
      Mogelijke negatieve gevolgen phlebotomy gekoppeld zijn bloedingen, kneuzingen en hematoom. De dieren moeten worden gecontroleerd voor 20 min post bloed trekken op zoek naar de tekenen van bloeden. Extra druk op de sites moet worden gebruikt. Als het bloeden niet stopt, kan een dierenarts moet worden gecontacteerd.
      Andere mogelijke negatieve gevolgen die samenhangen met injecties en bloeden omvatten granuloma vorming en ontsteking. Granuloma vorming is niet te verwachten en niet waargenomen aan de Universiteit van Kentucky. Injectie site ontsteking (roodheid of zwelling) kan optreden, en onder de aandacht van een dierenarts moet worden gebracht. De afloop van de productie vertegenwoordigt een potentieel aanzienlijk volume aan bloed, en de dieren moeten worden gecontroleerd om te verzekeren dat ze stabiel en actief na de bloedinzameling zijn.
      Anafylaxie en pyrogene reacties zijn de twee meest waarschijnlijk ernstige nadelige gevolgen, maar zeer zelden in acht worden genomen. Als het zou voordoen, anafylaxie zou optreden kort na de antigeen-injecties en worden geopenbaard door een toename van de rectale temperatuur, zwakte, braken, ademhalingsproblemen en/of diarree. Rectale temperatuur kan worden gecontroleerd na elke injectie te detecteren een stijging in lichaamstemperatuur. Als deze worden herkend, kennis van een dierenarts onmiddellijk voor een consult. Bovendien, moet een noodsituatie "Crash Kit" (bijvoorbeeld adrenaline, corticosteroïden en antihistaminicum) voorbereid in overleg met een dierenarts openstaan voor de behandeling van dieren waarbij een bijwerking waarvan wordt vermoed.

2. het zuiveren van lymfocyten voor één domein antilichaam bibliotheek bouw

  1. 50 mL bloed drie tot vijf dagen na de laatste injectie (zie stap 1.4) verzamelen.
    Opmerking: Snelle verwerking van bloed en isolatie van RNA is belangrijk voor het verkrijgen van een geschikt bibliotheek grootte15,3, dat is heel belangrijk voor het welslagen van de pannen.
  2. Verdun 15 mL van het verzamelde bloed met 5 mL PBS.
  3. Een lymfocyt scheiding buis om te isoleren van perifeer bloed lymfocyten (PBLs) door de kleurovergang centrifugeren dichtheid volgens fabrikanten suggesties gebruiken.
    Let op: Aanwijzingen van de fabrikant aangeven dat tot 25 mL bloed kunnen worden gebruikt, maar dit kan het systeem verzadigen en te voorkomen dat het verkrijgen van een schone lymfocyt voorbereiding.
  4. Voeg 5 mL PBS prechilled tot 4 ° C tot PGO.
  5. Spin gedurende 20 minuten bij 800 x g bij 4 ° C.
  6. Twee keer wassen door toevoeging van 5 mL PBS prechilled tot 4 ° C tot PGO gevolgd door het centrifugeren gedurende 20 minuten bij 800 x g bij 4 ° C.
  7. Isoleren totaal RNA met behulp van een draai-kolom gebaseerd systeem, volgens de instructies van de fabrikant. Meng de cellen door vertexing in passende buffer en toe te passen op een systeem van biopolymeer-Shredder. Gebruik een voldoende aantal mini- of maxi-kolommen op basis van de cel invoeren.
  8. CDNA met behulp van reverse-transcriptase door het combineren van 10 µg van RNA met een mix van 0,1 µg Oligo (dT) 12-18 inleidingen synthetiseren.
  9. Het genereren van een bacteriofaag-bibliotheek met behulp van gevestigde methoden4. Dit impliceert dat klonen met restrictie-enzymen in de bacteriofaag weergeven vector pMES4 gevolgd door de expressie van het donormateriaal gesmolten tot Gen III van de draadvormige bacteriofaag voor de productie van de bacteriofaag oplossing.

3. enkel domein antilichamen pannen

  1. Het produceren van antigeen affiniteit platen met behulp van oppervlakte behandelde 96-wells-platen. Verdun 0,25 µg van het antigeen in 100 mM natriumcarbonaat buffer, pH 9.0. Voeg 100 µL van deze oplossing aan elk putje en na een nacht bebroeden bij 4 ° C. Jas twee putten per antigeen. Bereid een blanco-controle goed dat is bedekt met carbonaat buffer alleen.
    Opmerking: Platen kunnen worden geproduceerd en opgeslagen voor tot een week bij 4 ° C als meerdere rondes van de selectie zal worden uitgevoerd. Ook, deze methode maakt gebruik van directe absorptie die geen labelen vereist terwijl andere methoden maken gebruik van biotinylation of andere soorten labeling van strategieën.
  2. Na de plaat een nacht bebroeden. Omkeren om te verwijderen van de inhoud van de putten en was driemaal met 0,1 mL PBS-T.
  3. Blokkeren de putten door toevoeging van 0,1 mL BSA (20 mg/mL) in PBS en de plaat gedurende 2 uur bij kamertemperatuur incuberen.
  4. Spoel de plaat driemaal met PBS-T gevolgd door driemaal met PBS. Antigenen kunnen ook worden covalent geëtiketteerd en gebruikt in opname systemen zoals, bijvoorbeeld, streptavidine/Biotine systemen.
  5. De faag-oplossing (100 µL) met 100 µL van 40 mg/mL BSA in PBS op een trillend platform bij kamertemperatuur gedurende 30 minuten vooraf te behandelen.
  6. De faag oplossing aan het antigeen gecoat wells en incubeer met zachte agitatie gedurende 2 uur op kamertemperatuur toevoegen. Gebruik meerdere putten met het oog op een totaal van 1011 bacteriofaag voor elk antigeen.
  7. De niet-afhankelijke faag negeren door inversie en vervolgens was de putjes goed vijfmaal met 200 µL van PBS-T gevolgd door vijf keer met PBS.
  8. Elueer de afhankelijke faag door toevoeging van 0,1 mL van 0,25 mg/mL trypsine in PBS en incubatie gedurende 30 minuten bij kamertemperatuur op het trillende platform op 700 rpm.
  9. Breng de oplossing over in een flesje met 5 µL van 4 mg/mL 4-benzenesulfonyl fluoride hydrochloride(AEBSF) oplossing om quench trypsine activiteit.
  10. Groeien TG1 faag display bevoegde cellen bij 37 ° C met schudden tot OD600 = 0,5.
  11. 50 µL van geëlueerd bacteriofaag aan 3 mL van de TG1 cellen toevoegen.
  12. Incubeer bij 37 ° C zonder schudden voor 30 min.
  13. Voeg 7 mL van LB-media aangevuld met 100 µg/mL ampicilline, 2% glucose.
  14. Shake's nachts bij 37 ° C.
    Opmerking: Voor het verkrijgen van de meest uiteenlopende enkel domein antilichamen, kunnen klonen worden sequenced getest voor gewenste eigenschappen en gebruikt na een ronde van de pannen. Voor het verkrijgen van de hoogste affiniteit enkel domein antilichamen, moeten twee rondes van de pannen worden benut.
  15. Plaat de bacteriën na overnachting groei op LB agar platen aangevuld met 100 µg/mL ampicilline, 2% glucose. Verscheidene seriële verdunningen worden getest, moet beginnen met twee verdunningen, plating 100 µL van 1/10.000 en 1/100.000 verdunningen.
  16. Incubeer de plaat 's nachts bij 37 ° C.
  17. Kies de kolonies en de putten van een steriele 96-wells-plaat met 100 µL van 2XYT met 100 µg/mL ampicilline, 2% glucose, 10% (v/v): glycerol per putje beënten.
  18. Na een nacht bebroeden bij 37 ° C zonder schudden.
  19. De volgende dag, schudden bij 170 t/min bij 37 ° C gedurende 60 minuten.
  20. Verwijder 2 µL van de media in PCR buizen. De resterende oplossing kan worden achtergelaten in de plaat en opgeslagen bij 4 ° C gedurende 1-2 dagen of bevroren en opgeslagen bij-80 ° C voor later gebruik.
  21. Uitvoeren van PCR reactie gebruikend inleidingen die geschikt is voor de vector gebruikt. Voor pMES4 zijn PCR screening van positieve klonen gebruikt inleidingen die flank van de meerdere klonen site CCTATTGCCTACGGCAGCCGCTGGATTGTTATTAC en GGTGGTGTGAGGAGACGGTGACCTG. Gebruik maken van fietsen passende voorwaarden voor de polymerase gebruikt, een onthardende temperatuur van 57 ° C en 30 cycli.
  22. Het analyseren van de PCR reactie met het runnen van een agarose gel van 1% (m/v). Kolonies die positief hebben enkel domein antilichamen gene inzetstukken van ~ 500 bp. Zorg ervoor dat de positieve klonen 20-50% van het monster zijn.
    Opmerking: Deze methode biedt een manier voor kloon selectie en analyse die kan worden uitgevoerd in de meeste onderzoekslaboratoria. Als alternatief, volgende-generatie sequentie kan worden toegepast en biedt grote datasets waarmee statistische en vergelijkende analyses16.
  23. Beënt de positieve klonen van de plaat in verse buizen met 7 mL LB met 100 µg/mL ampicilline.
  24. Groeien met schudden voor overnachting bij 37 ° C.
  25. Het uitvoeren van een miniprep op de cultuur te verkrijgen van de plasmide DNA.
  26. Volgnummer positieve klonen met behulp van de standaard rangschikking primer pEX-Rev (CAGGCTTTACACTTTATGCTTCCGGC).
  27. Computationele analyses uit te voeren op de resulterende enkel domein antilichamen sequenties. Ervoor zorgen dat er geen stop-codonen of frame verschuift.
  28. Classificeren de resulterende sequenties voor gelijkenis en diversiteit. De sequenties die zijn herhaaldelijk zijn waarschijnlijk hoge affiniteit binden sequenties, met name na de twee rondes van de selectie.
  29. Express van het antilichaam van de één domein met behulp van een expressie BL21 afkomstige stam van E. spoel. Induceren van de expressie door de toevoeging van IPTG, groeiende 's nachts bij 22 ° C.
  30. Het zuiveren van het antilichaam van de één domein met behulp van de geïmmobiliseerdet metal affiniteitchromatografie (IMAC).
  31. Valideren van één domein antilichaam/antigeen bindende met behulp van een directe interactie assay zoals pull-down, inheemse gelelektroforese of ELISA.
  32. Controleer of toepassingsspecifieke enkel domein antilichamen prestaties, desgewenst voor de specifieke experiment.

Representative Results

Het hier gepresenteerde protocol werd gebruikt voor het genereren van één domein antilichamen tegen een aantal eiwit antigenen. Vijf antigenen werden gebruikt per alpaca. Immuun toezicht aangegeven dat de meerderheid van de antigenen robuuste reactie vanaf drie weken (Figuur 1 toonde). Productie aflopen en bibliotheek bouw na ongeveer zes weken geeft de beste balans voor de dieren dat hebben meerdere antigenen geïnjecteerd. Twee rondes van pannen werden uitgevoerd voor elk antigeen en geïsoleerde kolonies gescreend (Figuur 2). Sequentiebepaling van positieve kolonies geïdentificeerd divers enkel domein antilichamen sequenties voor de verschillende antigenen. Bijvoorbeeld werden drie unieke klonen geïsoleerd voor het referentieantigeen Maltose bindend proteïne (MBP) (figuur 3A). Zoals vaak wordt waargenomen, wordt de enkel domein antilichamen bevatten aanzienlijke reeks diversiteit en zeer variabele CDR3 lengte (Figuur 3). Deze functies zijn vooral belangrijk in één domein antilichaam/antigeen interacties zoals gezien in de verwijzing enkel domein antilichamen/CX3CL1 complexe17 (figuur 3B).

De meerderheid van de full-length enkel domein antilichamen sequenties kan worden uitgedrukt en gezuiverd op 1-10 mg/L van cultuur (figuur 4A). Vanwege de diversiteit in CDR3 lengte, heeft verschillende enkel domein antilichamen lichte variatie in moleculair gewicht weergeven. Bevestiging van directe binding en toepassing bestaan specifieke prestatie is van cruciaal belang. Bijvoorbeeld na twee rondes van de selectie tegen antigeen B, een panel van één domein antilichamen werden geïdentificeerd (Figuur 2). Meerdere identieke sequenties werden geïdentificeerd, en het antilichaam van één domein werd geproduceerd en gezuiverd. Het was vervolgens getest via directe pull down met antigeen affiniteit hars en toonde robuuste dosisafhankelijk bindende (figuur 4B). Nog belangrijker is, toonde het antilichaam van één domein geen binding met het controleren van de hars. Deze gegevens tonen een direct bindende interactie, en dat is zeer geschikt voor het vastleggen van de affiniteit in zowel pull-down en ELISA gebaseerde formaten.

Figure 1
Figuur 1 : Representatief immuun toezicht op twee verschillende antigenen, tonen de belangrijke specifieke immuunrespons aan verschillende antigenen in hetzelfde dier. Veel antigenen Toon robuust antwoord zo spoedig drie weken na het begin van immunisatie, met de meerderheid die het weergeven van maximale reactie na zes weken. Zes weken ook zorgt voor affiniteit rijping en is de aanbevolen tijd voor de afloop van de productie en de B-cel isolatie. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 : Bevestiging van positieve klonen PCR-gebaseerde. Inleidingen omspannen de MCS-server van het pMES4 vector, en een positieve nanobody kloon produceert een amplicon van ~ 500 bp (gemarkeerd met *). Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3 : Antigeen-specifieke opeenvolgingen Markeer alpaca enkel domein antilichamen diversiteit. (A) aanpassing van Selecteer één domein antilichaam sequenties geïsoleerd te MBP met een referentie één domein antilichaam 4XT1, met kader en complementariteit-bepalen regio's (Kabat) hieronder. (B) structuur van alpaca één domein antilichaam 4XT1 gebonden aan CX3CL1 (VOB 4XT1), nadruk op de cruciale rol van variabele CDR loops in specifieke antigeen bindende. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4 : Zuivering en validatie van één domein antilichamen. (A) SDS-pagina van IMAC gezuiverd enkel domein antilichamen, divers enkel domein antilichamen te vergelijken. Verschillende molecuulgewichten zijn voornamelijk te wijten aan de wisselende lengte van de lus van de CDR3. Verschillende niveaus van meningsuiting zijn ook waargenomen, met een minderheid van één domein antilichamen tonen van slechte oogsten van de gezuiverde eiwit. (B) keuring van directe binding met behulp van een antigeen affiniteit pull-down. Robuuste dosisafhankelijk enkel domein antilichamen bindende wordt waargenomen met antigeen-coupled hars maar niet met het besturingselement hars. Klik hier voor een grotere versie van dit cijfer.

Discussion

Zoals opgemerkt, de hoge affiniteit en de specificiteit van één domein antilichamen, gecombineerd met hun facile expressie en stabiliteit, maak hen ideaal reagentia voor de toepassingen in biomedisch onderzoek, als kritische biochemische reagentia, diagnostische hulpprogramma's, of therapeutische agenten18. Voor commerciële toepassingen zijn er sommige kwesties verband houden met intellectuele eigendom die moet worden beschouwd. Bovendien, kunnen één domein antilichamen worden ontworpen om te bevatten specifieke markers of tags die kunnen worden gebruikt als verslaggevers in cellulaire assays of diagnostiek. De sleutel tot deze toepassingen is de mogelijkheid om specifiek één domein antilichamen tegen de antigenen van belang te produceren. Een methode is hier beschreven voor de productie van één domein antilichamen met behulp van alpaca's, die een robuuste immuunrespons tegen een breed scala aan eiwit antigenen produceert. Overwegingen bij het dier verwerking en naleving van regelgeving worden beschreven. Dit zijn de sleutel tot het succes in dit deel van het proces.

Er zijn andere strategieën voor het produceren van één domein antilichamen die vereisen geen de immunisatie, maar in plaats daarvan semisynthetic bibliotheken gebruiken met verschillende systemen voor de selectie en iteratieve optimalisatie van affiniteiten19,20 . Het voordeel van het gebruik van bibliotheken die zijn afgeleid van geïmmuniseerde dieren is echter de mogelijkheid om op een betrouwbare manier isoleren zeer verrijkt, divers, en hoge-affiniteit enkel domein antilichamen. Daarnaast, niet alleen aanzienlijke reeks variaties wordt voldaan, maar een aanzienlijke meerderheid van specifieke enkel domein antilichamen geïsoleerd had unieke ingevoegde en verwijderde items, met name in CDR3.

Verder, enkel domein antilichamen geproduceerd kunnen worden via een eenvoudig proces dat alleen kleine injecties van het antigeen en na dit proces vereist, de dieren kunnen worden teruggebracht naar de kudde. Van de nota, het dier kan vrij worden gebruikt voor de productie van de vezel, maar moet worden uitgesloten van het gebruik als vlees (menselijke voedselketen) als gevolg van het gebruik van de test antigenen en niet-FDA goedgekeurde hulpstof voor de productie van het antilichaam van de één domein. Nadat de procedure is voltooid, kunnen de dieren moeten worden gecontroleerd voor één week, gegeven een veterinaire eindexamen, en vervolgens worden keerde terug naar hun huis boerderij of rustte gedurende zes maanden voorafgaand aan een andere ronde van de productie van het antilichaam van de één domein.

Disclosures

Drs. Whiteheart en Hersh zijn aan de Universiteit van Kentucky en opereren van een kern in het centrum voor moleculaire geneeskunde die geen enkel domein antilichamen aanmaakt in alpaca als een vergoeding voor de service.

Acknowledgments

Dit werk werd gesteund door de National Institutes of Health (P30GM103486).

Materials

Name Company Catalog Number Comments
GERBU FAMA adjuvant Biotechnik, Heidelberg, Germany  3003,6001
Serum collection tube Becton Dickinson 367983
Blood collection tube Becton Dickinson 366643
Vacutainer blood collection set Becton Dickinson 368652
Maxisorp Immuno plates Nunc 439454
BSA Sigma-Aldrich A7906
HRP-conjugated goat anti-llama IgG antibody  Bethyl Labs A160-100P
TMB reagent chromogenic peroxidase substrate  KPL 50-76-03
Plate Reader Spectramax M5 Any UV/VIS capable reader is acceptable
Uni-SepMAXI+ lyphocyte separation tube Novamed U-17
RNeasy Mini Kit Qiagen 74104
QIAshredder column Qiagen 79654
Superscript IV reverse transcriptase   Invitrogen 18064014
AEBSF solution Biosynth A-5440
TG1 phage display competent cells Lucigen 60502

DOWNLOAD MATERIALS LIST

References

  1. Krah, S., et al. Single-domain antibodies for biomedical applications. Immunopharmacology and Immunotoxicology. 38, (1), 21-28 (2016).
  2. Rothbauer, U., et al. Targeting and tracing antigens in live cells with fluorescent nanobodies. Nature Methods. 3, (11), 887-889 (2006).
  3. Maass, D. R., Sepulveda, J., Pernthaner, A., Shoemaker, C. B. Alpaca (Lama pacos) as a convenient source of recombinant camelid heavy chain antibodies (VHHs). Journal of Immunological Methods. 324, (1-2), 13-25 (2007).
  4. Pardon, E., et al. A general protocol for the generation of Nanobodies for structural biology. Nature Protocols. 9, (3), 674-693 (2014).
  5. Hertveldt, K., Belien, T., Volckaert, G. General M13 phage display: M13 phage display in identification and characterization of protein-protein interactions. Methods in Molecular Biology. 502, 321-339 (2009).
  6. Kushwaha, R., Schafermeyer, K. R., Downie, A. B. A protocol for phage display and affinity selection using recombinant protein baits. Journal of Visualized Experiments. (84), e50685 (2014).
  7. Hamers-Casterman, C., et al. Naturally occurring antibodies devoid of light chains. Nature. 363, (6428), 446-448 (1993).
  8. Muyldermans, S., et al. Camelid immunoglobulins and nanobody technology. Veterinary Immunology and Immunopathology. 128, (1-3), 178-183 (2009).
  9. Muyldermans, S. Nanobodies: natural single-domain antibodies. Annu Rev Biochem. 82, 775-797 (2013).
  10. Muyldermans, S., Cambillau, C., Wyns, L. Recognition of antigens by single-domain antibody fragments: the superfluous luxury of paired domains. Trends in Biochemical Sciences. 26, (4), 230-235 (2001).
  11. Wang, Y., et al. Nanobody-derived nanobiotechnology tool kits for diverse biomedical and biotechnology applications. International Journal of Nanomedicine. 11, 3287-3303 (2016).
  12. Van Saun, R. J. Nutritional requirements and assessing nutritional status in camelids. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 265-279 (2009).
  13. Jones, M., Boileau, M. Camelid herd health. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 239-263 (2009).
  14. Daley, L. P., Gagliardo, L. F., Duffy, M. S., Smith, M. C., Appleton, J. A. Application of monoclonal antibodies in functional and comparative investigations of heavy-chain immunoglobulins in new world camelids. Clinical and Diagnostic Laboratory Immunology. 12, (3), 380-386 (2005).
  15. Romao, E., et al. Identification of Useful Nanobodies by Phage Display of Immune Single Domain Libraries Derived from Camelid Heavy Chain Antibodies. Current Pharmaceutical Design. 22, (43), 6500-6518 (2016).
  16. Henry, K. A., et al. Isolation of TGF-beta-neutralizing single-domain antibodies of predetermined epitope specificity using next-generation DNA sequencing. Protein Engineering, Design and Selection. 29, (10), 439-443 (2016).
  17. Burg, J. S., et al. Structural biology. Structural basis for chemokine recognition and activation of a viral G protein-coupled receptor. Science. 347, (6226), 1113-1117 (2015).
  18. Wesolowski, J., et al. Single domain antibodies: promising experimental and therapeutic tools in infection and immunity. Medical Microbiology and Immunology. 198, (3), 157-174 (2009).
  19. Harmsen, M. M., De Haard, H. J. Properties, production, and applications of camelid single-domain antibody fragments. Applied Microbiology and Biotechnology. 77, (1), 13-22 (2007).
  20. McMahon, C., et al. Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nature Structural & Molecular Biology. 25, (3), 289-296 (2018).
Immunisatie van alpaca's (<em>Lama pacos</em>) met eiwit antigenen en productie van antigeen-specifieke enkel domein antilichamen
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).More

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter